Molecular marker for rice amylose content micro-control genes SSIII-1 and application of molecular marker

A technology of amylose content and molecular markers, applied in the field of agricultural biotechnology engineering, can solve problems such as poor accuracy, and achieve the effect of overcoming long time periods and reducing amylose content

Inactive Publication Date: 2016-06-15
ZHEJIANG NORMAL UNIVERSITY
View PDF5 Cites 5 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the effects of one cause and multiple effects, multiple causes and one effect, regulatory genes, and modified genes among genes, there are often large differences between individual phenotypes and genotypes, so the accuracy of individual selection through field phenotypic traits is poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker for rice amylose content micro-control genes SSIII-1 and application of molecular marker
  • Molecular marker for rice amylose content micro-control genes SSIII-1 and application of molecular marker
  • Molecular marker for rice amylose content micro-control genes SSIII-1 and application of molecular marker

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0061] Example 1. Using the Indel marker SSIII-1-m to identify polymorphisms in the japonica rice Nipponbare with low amylose content and the indica rice Teqing with high amylose content

[0062] The specific method is as follows: select rice materials Nipponbare and Teqing, use Nipponbare and Teqing to cross to obtain its F1, and use primer SSIII-1-m to identify its polymorphism ( figure 1 ).

[0063] 1. DNA extraction

[0064] 1) Prepare DNA extraction buffer:

[0065] Add 1 volume of DNA extraction solution (0.35Msorbitol; 0.1MTris, pH8.2; 0.005MEDTA; the rest is water), 1 volume of nuclear lysis solution (0.2MTris, pH7.5; 0.05MEDTA; 2MNaCl; 0.055MCTAB) in sequence ; the rest are water) and 0.4 volumes of 5% (mass concentration) sarkosyl solution (i.e. the aqueous solution of sodium lauryl-N-methylglycinate); finally add sodium bisulfite to be mixed with DNA extraction buffer; bisulfite The final concentration of sodium in DNA extraction buffer was 0.02M.

[0066] The p...

Embodiment 2

[0085] Example 2. Using the Indel molecular marker SSIII-1-m to identify sequence differences between the japonica rice Nipponbare with low amylose content and the indica rice Teqing with high amylose content

[0086] The specific method is: use the Indel molecular marker SSIII-1-m to perform PCR amplification on the genomic DNA of Nipponbare and Teqing, entrust Shanghai Yingjun Biotechnology Co., Ltd. to sequence the amplified products, and compare the differences in their sequences ( figure 2 ).

[0087] 1. DNA extraction

[0088] 1) Prepare DNA extraction buffer:

[0089] With embodiment 1.

[0090] 2), the paddy rice blade of above-mentioned Nipponbare and special green is carried out as follows respectively:

[0091] With embodiment 1.

[0092] 3) PCR amplification

[0093] With embodiment 1.

[0094] 4) Recovery of PCR products

[0095] The recovery of PCR products was carried out by using the PCR product recovery kit (spin column type, catalog number: DP1403) de...

Embodiment 3

[0097] Example 3. Using the Indel marker SSIII-1-m to carry out assisted selection breeding for low amylose content

[0098] The specific method is: the gene donor parent Nipponbare with low amylose content, and the indica rice variety Teqing with high amylose content are sequentially crossed, backcrossed and selfed, and the resulting progeny are combined with the assisted selection of the molecular marker SSIII-1-m, A single plant with the same band type as Japan Sunshine in the segregation population was selected for breeding improvement.

[0099] 1. DNA extraction

[0100] 1) Prepare DNA extraction buffer:

[0101] With embodiment 1.

[0102] 2), above-mentioned Nipponbare, Teqing, and the rice blades of the gained offspring are respectively processed as follows:

[0103] With embodiment 1.

[0104] 2. Indel marker detection

[0105] 1), PCR amplification

[0106] With embodiment 1.

[0107] 2), electrophoresis detection

[0108] With embodiment 1.

[0109] 3. Inde...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker SSIII-1-m for rice amylose content micro-control genes SSIII-1. The molecular marker is characterized in that paddy rice is used as a species, primers of the molecular marker are selectively primer pairs, nucleotide sequences are 5'->3', the molecular marker SSIII-1-m in a forward direction is shown as AAGAAGGGAAGGGAGTCAGC, and the molecular marker SSIII-1-m in a reverse direction is shown as GCCATCTCCATTGCCAGC. The invention further discloses application of the molecular marker SSIII-1-m. The molecular marker SSIII-1-m can be used for identifying rice amylose contents of the paddy rice and / or assisting in selectively breeding progenies of the paddy rice. Single plants, with banding patterns consistent with Nipponbare banding patterns, of the progenies are selected for breeding when the progenies are progenies of Nipponbare indica rice.

Description

technical field [0001] The invention belongs to agricultural biotechnology engineering, and particularly relates to a molecular marker related to rice amylose content regulation gene SSIII-1 and its application. Background technique [0002] High yield and high quality have always been the long-term goal of rice breeding. After long-term efforts, especially the use of hybrid rice technology, my country has achieved universally recognized achievements in rice production. However, in the past, how to solve people's food and clothing problems has always been the first priority, so the focus of rice breeding work is mostly concentrated on the cultivation of new high-yield varieties of rice, resulting in a serious lag in the breeding of high-quality rice, especially some high-yield hybrid rice General deviations in quality. [0003] Another main reason for the slow progress in rice quality improvement is the complexity of rice quality inheritance and the limitations of traditio...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
IPC IPC(8): C12N15/11C12Q1/68
CPCC12Q1/6895C12Q2600/13C12Q2600/156
Inventor饶玉春徐江民钱前曾大力马路肖飒清胡瑚倩
OwnerZHEJIANG NORMAL UNIVERSITY