Wx mutant protein based on gene editing technology and application of gene of Wx mutant protein in plant breeding

A mutant and protein technology, applied in application, plant products, genetic engineering, etc., can solve the problems of low chemical mutation frequency, unsatisfactory effect, and long breeding cycle, so as to achieve appropriate reduction in amylose content and improved palatability Sex and taste quality, and the effect of accelerating the breeding process

Active Publication Date: 2020-05-26
JIANGSU ACAD OF AGRI SCI +1
View PDF7 Cites 8 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

For quality traits, backcrossing is a commonly used method. Generally, 4-6 generations of backcrossing are required, and at least 3-5 generations are required for homozygous selfing. To improve a single trait and play a role in production, at least 6-8 years, the breeding cycle is long, it is difficult to meet the urgent needs of the market and the people for high-quality soft fragrant rice varieties
If we want to tap new soft rice genetic resources, we mainly rely on chemical mutagenesis at present. As we all know, the frequency of chemical mutations is low, and the initial investment is large. It may take 2-3 years to screen and obtain a stable material. At the same time, chemical mutagenesis may cause wild There are multiple gene mutations in the type material, and it needs to be improved through hybridization to eliminate bad gene mutations when it is applied to production
[0007] 2. Most soft rice japonica rice varieties have poor appearance quality
For single-base mutations, enzyme-cut target markers can be designed, but the process is relatively cumbersome. Allele-specific PCR is developed, and genotypes with high and low amylose content can be distinguished by two PCRs
[0013] At present, if scientific and technical personnel want to obtain new materials or new genes of soft rice with AC reduced to 8-12% and the appearance remains transparent, they need to undergo chemical or radiation mutagenesis, which requires a lot of work and the effect is not ideal.
Simultaneously, adopt conventional chemical mutagenesis and conventional transgenic breeding, its breeding life will be at least 6-8 years, and the breeding cycle is long, be difficult to satisfy the urgent demand of market and common people to high-quality soft fragrant rice variety
[0014] At the same time, there is no relevant report on the use of gene editing technology to perform site-directed mutations on the Wx gene of rice varieties to create new soft rice alleles

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Wx mutant protein based on gene editing technology and application of gene of Wx mutant protein in plant breeding
  • Wx mutant protein based on gene editing technology and application of gene of Wx mutant protein in plant breeding
  • Wx mutant protein based on gene editing technology and application of gene of Wx mutant protein in plant breeding

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0078] Example 1: Obtaining of genetically transformed plants

[0079] 1. Suken 118Wx gene cloning and target site design

[0080] Referring to the CTAB method of Murray et al., the genomic DNA of Suken 118 was extracted (Murray M G, et al., Nucleic Acids Research, 1980, 8(19):4321-4326). Genomic DNA was amplified by PCR with primers Wx-F: CCCTAGCCACCCAAGAAA (SEQ ID NO: 5), Wx-R: CACCCAGAAGAGTACAACATCA (SEQ ID NO: 6), and the amplified products were sent to Yingwei Jieji (Shanghai) Trading Co., Ltd. The company performs sequencing. The sequencing results were compared and analyzed by Blast in the NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) database, and it was found that the sequence of the Wx gene coding region of Suken 118 was the same as that of the reference genome rice Nipponbare.

[0081] According to the Wx gene sequence of Suken 118, the CRISPR-GE website (http: / / skl.scau.edu.cn / targetdesign / ) was used to predict that the target site wxb#9 was designed on the fou...

Embodiment 2

[0114] Example 2: Mutant exogenous DNA (T-DNA) was removed, genotype was identified again and homozygous plants were screened

[0115] The pH-nCas9-PBE-wxb#9 and pH-nCas9-PBE-wxb#24 vectors of the directional and precise single base editing Wx gene constructed by the present invention are both binary T-DNA vectors, and the T-DNA involved in the present invention is mainly Contains the hygromycin phosphotransferase HPT gene and the nCas9 nuclease gene. For the rice genome, the exogenous DNA represented by these two genes needs to be removed for the following reasons: 1) The hygromycin phosphotransferase HPT gene is mainly The role is as a screening marker in the process of genetic transformation, and the corresponding encoded hygromycin protein is a class of antibiotics; 2) The main function of the nCas9 gene is to complete the targeted cutting of the target gene target site, and if it continues to remain in the plant, it may cause Secondary editing; 3) T-DNA random insertion m...

Embodiment 3

[0121] Embodiment 3 mutant phenotype analysis

[0122] Eating and Cooking Quality (ECQ) is a direct factor that affects consumers' choices, and thus is the most important evaluation index in the composition of rice quality. Although my country has promulgated the national standard "Sensory Evaluation Method for Rice Cooking and Eating Quality" (GB / T15682-2008), the artificial tasting method still cannot accurately identify the quality of rice because the influence of subjective factors cannot be completely excluded. Since starch is the main component of rice endosperm, the composition and structure of starch are the most important factors affecting rice ECQ. This embodiment utilizes the 4 T obtained in embodiment 2 2 Seeds produced by homozygous mutants 118-1-1, 118-3-2, 118-5-1, and 118-9-15 of generation T-DNA knockout (T 3 Generation) to measure some physical and chemical indicators of starch, so as to evaluate rice ECQ objectively.

[0123] 1. Determination of amylose c...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

PUM

No PUM Login to view more

Abstract

The invention discloses a rice Wx mutant protein, a mutant gene and an application of the mutant protein and the mutant gene. The invention further discloses a breeding method for creating quality-improved rice which is transparent in appearance and properly reduced in amylose content by utilizing gene editing. According to the invention, a gene editing technology is used for carrying out single base editing on the Wx gene for the first time, and a new material without T-DNA, transparent in appearance, properly reduced in amylose content, improved in quality and stable in inheritance can be obtained in a T2 generation by screening offspring. Compared with breeding such as chemical mutagenesis and hybridization transformation, a gene editing directional improved molecular breeding technology has the advantages of quickness, accuracy, high efficiency and the like, gene function marker genotype selection is combined, or other mature rice varieties are directly used as background materialsfor conversion to obtain corresponding materials, so that the breeding efficiency can be greatly improved, and the breeding process is greatly accelerated.

Description

technical field [0001] The invention belongs to the fields of crop genetics and breeding, innovation of new resources for crop quality improvement, and breeding of good-tasting crops, and specifically relates to the application of Wx mutant protein and its gene in plant breeding based on gene editing technology. Background technique [0002] Rice (Oryza sativa L.) is an important food crop in China and even in the world, and plays a decisive role in ensuring food security. [0003] Rice quality refers to the basic characteristics that rice must possess in commercial circulation, including four main aspects: milling quality, appearance quality, cooking and eating quality, and nutritional quality, among which appearance quality and cooking and eating quality are particularly important. Seed endosperm is the main edible part of rice. From the analysis of chemical composition, the main component of endosperm is starch, which generally accounts for 90% of the dry weight of endosp...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to view more

Application Information

Patent Timeline
no application Login to view more
Patent Type & Authority Applications(China)
IPC IPC(8): C12N9/10C12N15/54C12N15/82A01H5/00A01H6/46C12Q1/6895
CPCC12N9/1051C12Y204/01021C12N15/8245C12N15/8261
Inventor 杨杰高彩霞许扬王芳权张瑞陈智慧
Owner JIANGSU ACAD OF AGRI SCI
Who we serve
  • R&D Engineer
  • R&D Manager
  • IP Professional
Why Eureka
  • Industry Leading Data Capabilities
  • Powerful AI technology
  • Patent DNA Extraction
Social media
Try Eureka
PatSnap group products

Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.

© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap