Wx mutant protein based on gene editing technology and application of gene of Wx mutant protein in plant breeding
A mutant and protein technology, applied in application, plant products, genetic engineering, etc., can solve the problems of low chemical mutation frequency, unsatisfactory effect, and long breeding cycle, so as to achieve appropriate reduction in amylose content and improved palatability Sex and taste quality, and the effect of accelerating the breeding process
- Summary
- Abstract
- Description
- Claims
- Application Information
AI Technical Summary
Problems solved by technology
Method used
Image
Examples
Embodiment 1
[0078] Example 1: Obtaining of genetically transformed plants
[0079] 1. Suken 118Wx gene cloning and target site design
[0080] Referring to the CTAB method of Murray et al., the genomic DNA of Suken 118 was extracted (Murray M G, et al., Nucleic Acids Research, 1980, 8(19):4321-4326). Genomic DNA was amplified by PCR with primers Wx-F: CCCTAGCCACCCAAGAAA (SEQ ID NO: 5), Wx-R: CACCCAGAAGAGTACAACATCA (SEQ ID NO: 6), and the amplified products were sent to Yingwei Jieji (Shanghai) Trading Co., Ltd. The company performs sequencing. The sequencing results were compared and analyzed by Blast in the NCBI (https: / / blast.ncbi.nlm.nih.gov / Blast.cgi) database, and it was found that the sequence of the Wx gene coding region of Suken 118 was the same as that of the reference genome rice Nipponbare.
[0081] According to the Wx gene sequence of Suken 118, the CRISPR-GE website (http: / / skl.scau.edu.cn / targetdesign / ) was used to predict that the target site wxb#9 was designed on the fou...
Embodiment 2
[0114] Example 2: Mutant exogenous DNA (T-DNA) was removed, genotype was identified again and homozygous plants were screened
[0115] The pH-nCas9-PBE-wxb#9 and pH-nCas9-PBE-wxb#24 vectors of the directional and precise single base editing Wx gene constructed by the present invention are both binary T-DNA vectors, and the T-DNA involved in the present invention is mainly Contains the hygromycin phosphotransferase HPT gene and the nCas9 nuclease gene. For the rice genome, the exogenous DNA represented by these two genes needs to be removed for the following reasons: 1) The hygromycin phosphotransferase HPT gene is mainly The role is as a screening marker in the process of genetic transformation, and the corresponding encoded hygromycin protein is a class of antibiotics; 2) The main function of the nCas9 gene is to complete the targeted cutting of the target gene target site, and if it continues to remain in the plant, it may cause Secondary editing; 3) T-DNA random insertion m...
Embodiment 3
[0121] Embodiment 3 mutant phenotype analysis
[0122] Eating and Cooking Quality (ECQ) is a direct factor that affects consumers' choices, and thus is the most important evaluation index in the composition of rice quality. Although my country has promulgated the national standard "Sensory Evaluation Method for Rice Cooking and Eating Quality" (GB / T15682-2008), the artificial tasting method still cannot accurately identify the quality of rice because the influence of subjective factors cannot be completely excluded. Since starch is the main component of rice endosperm, the composition and structure of starch are the most important factors affecting rice ECQ. This embodiment utilizes the 4 T obtained in embodiment 2 2 Seeds produced by homozygous mutants 118-1-1, 118-3-2, 118-5-1, and 118-9-15 of generation T-DNA knockout (T 3 Generation) to measure some physical and chemical indicators of starch, so as to evaluate rice ECQ objectively.
[0123] 1. Determination of amylose c...
PUM
Abstract
Description
Claims
Application Information
- R&D Engineer
- R&D Manager
- IP Professional
- Industry Leading Data Capabilities
- Powerful AI technology
- Patent DNA Extraction
Browse by: Latest US Patents, China's latest patents, Technical Efficacy Thesaurus, Application Domain, Technology Topic.
© 2024 PatSnap. All rights reserved.Legal|Privacy policy|Modern Slavery Act Transparency Statement|Sitemap