Molecular marker of rice amylose content micro-control gene AGPL1 and application

A technology of amylose content and molecular markers, applied in the field of agricultural biotechnology engineering, can solve the problems of poor accuracy and achieve the effect of overcoming the long time period

Active Publication Date: 2016-08-17
CHINA NAT RICE RES INST
View PDF3 Cites 3 Cited by
  • Summary
  • Abstract
  • Description
  • Claims
  • Application Information

AI Technical Summary

Problems solved by technology

Due to the effects of one cause and multiple effects, multiple causes and one effect, regulatory genes, and modified genes among genes, there are often large differences between individual phenotypes and genotypes, so the accuracy of individual selection through field phenotypic traits is poor

Method used

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
View more

Image

Smart Image Click on the blue labels to locate them in the text.
Viewing Examples
Smart Image
  • Molecular marker of rice amylose content micro-control gene AGPL1 and application
  • Molecular marker of rice amylose content micro-control gene AGPL1 and application
  • Molecular marker of rice amylose content micro-control gene AGPL1 and application

Examples

Experimental program
Comparison scheme
Effect test

Embodiment 1

[0063] Example 1. Identification of polymorphisms of low-amylose japonica rice Nipponbare and high-amylose indica rice Teqing using Indel marker AGPL1-m

[0064] The specific method is: select rice materials Nipponbare and Teqing from the germplasm resource bank of China Rice Research Institute, obtain their F1 by crossing Nipponbare and Teqing, and use primer AGPL1-m to identify their polymorphisms ( figure 1 ).

[0065] 1. DNA extraction

[0066] 1), prepare DNA extraction buffer:

[0067] Add 1 volume of DNA extraction solution (0.35M sorbitol; 0.1M Tris, pH8.2; 0.005MEDTA; the rest is water) and 1 volume of nuclear lysis solution (0.2M Tris, pH7.5; 0.05M EDTA; 2M NaCl; 0.055MCTAB; the rest is water) and 0.4 volume of 5% (mass concentration) sarkosyl solution (that is, an aqueous solution of sodium dodecanoyl-N-methylglycinate); finally, sodium bisulfite was added to prepare a DNA extraction buffer solution; the final concentration of sodium bisulfite in DNA extraction b...

Embodiment 2

[0087] Example 2. Identification of the sequence difference between the low amylose japonica rice Nipponbare and the high amylose content indica rice Teqing using the Indel molecular marker AGPL1-m

[0088] The specific method is: using the Indel molecular marker AGPL1-m to carry out PCR amplification of the genomic DNA of Nipponbare and Teqing, and entrust Shanghai Yingjun Biotechnology Co., Ltd. to sequence the amplified products, and compare their sequence differences ( figure 2 ).

[0089] 1. DNA extraction

[0090] 1), prepare DNA extraction buffer:

[0091] Same as Example 1.

[0092] 2), the following treatments are respectively carried out to the rice leaves of the above-mentioned Nipponbare and Teqing:

[0093] Same as Example 1.

[0094] 3) PCR amplification

[0095] Same as Example 1.

[0096] 4) Recovery of PCR products

[0097] The recovery of PCR products was carried out using the PCR product recovery kit (spin column type, catalog number: DP1403) develop...

Embodiment 3

[0099] Example 3. Using Indel marker AGPL1-m to carry out assisted selection breeding with low amylose content

[0100] The specific method is as follows: the gene donor parent Nipponbare with low amylose content is crossed, backcrossed and self-crossed with the indica rice variety Teqing with high amylose content, and the obtained progeny is combined with the assisted selection of molecular marker AGPL1-m to select the segregating population The single plant with the middle belt type and the Nipponbare belt type is used for breeding improvement.

[0101] 1. DNA extraction

[0102] 1), prepare DNA extraction buffer:

[0103] Same as Example 1.

[0104] 2), the rice leaves of above-mentioned Nipponbare, Teqing, gained progeny are respectively carried out as follows:

[0105] Same as Example 1.

[0106] 2. Indel marker detection

[0107] 1), PCR amplification

[0108] Same as Example 1.

[0109] 2), electrophoresis detection

[0110] Same as Example 1.

[0111] 3. Indel...

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

PUM

No PUM Login to View More

Abstract

The invention discloses a molecular marker AGPL1-m of a rice amylose content micro-control gene AGPL1. Rice is used as a species, a molecular marker primer is selected from the following primer pairs, wherein a nucleotide sequence is 5'->3', the forward AGPL1-m is TCTGCGAGCCTTGTTATCCA, and the reverse AGPL1-m is TGCCAGGGAGAAATGGAGAA. The molecular marker AGPL1-m is used for identification of paddy rice amylose content and / or assistant selective breeding their offspring.

Description

technical field [0001] The invention belongs to agricultural biotechnology engineering, and particularly relates to a molecular marker AGPL1-m related to the rice amylose content regulation gene AGPL1 and a method for obtaining the same. Background technique [0002] High yield and high quality have always been the long-term goals of rice breeding. After long-term efforts, especially the utilization of hybrid rice technology, my country has achieved world-recognized achievements in rice production. However, since the problem of food and clothing has always been the first priority in the past, the focus of rice breeding work has mostly been on the cultivation of new high-yield varieties of rice, which has led to a serious delay in the breeding of high-quality rice, especially some high-yield hybrid rice. General quality deviation. [0003] Another main reason for the slow progress of rice quality improvement is the complexity of rice quality genetics and the limitations of ...

Claims

the structure of the environmentally friendly knitted fabric provided by the present invention; figure 2 Flow chart of the yarn wrapping machine for environmentally friendly knitted fabrics and storage devices; image 3 Is the parameter map of the yarn covering machine
Login to View More

Application Information

Patent Timeline
no application Login to View More
Patent Type & AuthorityApplications(China)
IPC IPC(8): C12Q1/68
CPCC12Q1/6895C12Q2600/156
Inventor代丽萍曾大力钱前胡江张光恒朱丽董国军郭龙彪高振宇陈光
OwnerCHINA NAT RICE RES INST