Regulation of gene expression through aptamer-mediated modulation of alternative splicing

Abstract

The present invention provides a platform for regulating the expression of a target gene using exposure to an aptamer ligand (e.g., a small molecule) and methods of using the platform. The platform features a polynucleotide gene regulatory cassette that is placed in the target gene and includes a synthetic riboswitch placed in a 5' intron selective exon 3' intron context. The riboswitch comprises an effector region and a sensor region (e.g., an aptamer that binds a small molecule ligand) such that when the ligand is not present, the selective exon is spliced ​​into the target gene mRNA, thereby preventing the expression of the target gene. When the ligand is present, the selective exon is not spliced ​​into the target gene mRNA, thereby providing expression of the target gene.

Description

[0001] This application is a divisional application of an invention patent application filed on February 2, 2016, with application number 201680020102.7 and invention name “Gene expression regulation by aptamer-mediated regulation of selective splicing”.

[0002] CROSS-REFERENCE TO RELATED APPLICATIONS

[0003] This application claims priority to U.S. Application No. 62 / 110,919, filed February 2, 2015, which is incorporated herein by reference in its entirety. Technical Field

[0004] The present invention provides a platform for regulating the expression of a target gene using exposure to small molecules and methods of using the platform. The platform features a polynucleotide cassette that is placed in the target gene and includes a synthetic riboswitch placed in a 5' intron-selective exon-3' intron context. The riboswitch comprises an effector region and an aptamer that binds a ligand (e.g., a small molecule) and provides control of the expression of the target gene through exposure to the ligand. Background Art

[0005] Splicing refers to the process of removing intron sequences from nascent pre-messenger RNA (pre-mRNA) and connecting exons together to form mRNA. The splicing site is the junction between exons and introns, and is determined by different consensus sequences at the 5' and 3' ends of the introns (i.e., splicing donor and splicing acceptor sites, respectively). Selective pre-mRNA splicing or alternative splicing is a common process that exists in most human genes containing multiple exons. It is carried out by a majority component structure called a spliceosome, which is a collection of small nuclear ribonucleoproteins (snRNPs) and a series of different auxiliary proteins. By identifying various cis-regulatory sequences, the spliceosome determines the exon / intron boundary, removes intron sequences, and splices exons together to become final translatable information (i.e., mRNA). In the case of alternative splicing, some exons can be included or excluded to change the final coding information, thereby changing the resulting expressed protein.

[0006] Regulating the expression of a target gene (e.g., a therapeutic transgene) is necessary in many cases. In the context of therapeutic expression of a gene, technologies that achieve regulated transgenic expression have the potential to enhance safety by regulating the level of expression and its timing. Systems that regulate and control protein expression have a practical and, in some cases, essential role for safe and effective therapeutic applications. Summary of the invention

[0007] In one aspect, the present invention provides a polynucleotide cassette for regulating the expression of a target gene, the polynucleotide cassette comprising (a) a riboswitch and (b) an alternatively spliced ​​exon, the alternatively spliced ​​exon flanked by a 5' intron and a 3' intron, wherein the riboswitch comprises (i) an effector region, the effector region comprising a stem, the stem comprising a 5' splice site of the 3' intron; and (ii) an aptamer, wherein the alternatively spliced ​​exon comprises a stop codon, the stop codon is in frame with the target gene when the alternatively spliced ​​exon is spliced ​​into the target gene mRNA. In one embodiment, the aptamer specifically binds to a small molecule ligand.

[0008] In one embodiment, the polynucleotide for regulating the expression of the target gene ("gene regulatory cassette", "regulatory cassette" or "polynucleotide cassette") contains 5' and 3' introns, which are derived from endogenous introns from the target gene. In one embodiment, the 5' and 3' introns are exogenous to the target gene. In one embodiment, the 5' and 3' introns are derived from intron 2 of the human β-globin gene. In one embodiment, the 5' intron contains a stop codon in the same frame as the target gene. In one embodiment, the length of the 5' and 3' introns is each independently about 50 to about 300 nucleotides. In one embodiment, the length of the 5' and 3' introns is each independently about 125 to about 240 nucleotides. In one embodiment, the 5' and / or 3' introns have been modified to include an intron splicing enhancer, an intron splicing enhancer, a 5' splice site, a 3' splice site or a branch point sequence, or their sequence is changed.

[0009] In one embodiment, the effector region stem of a riboswitch is about 7 to about 20 base pairs in length. In one embodiment, the effector region stem is 8 to 11 base pairs in length.

[0010] In one embodiment, the alternatively spliced ​​exon is derived from exon 2 of the human dihydrofolate reductase gene (DHFR), mutant human Wilms tumor 1 exon 5, mouse calcium / calmodulin-dependent protein kinase II delta exon 16, or SIRT1 exon 6. In one embodiment, the alternatively spliced ​​exon is a modified DHFR exon 2 from SEQ ID NO: 15. In one embodiment, the alternatively spliced ​​exon has been modified with one or more of the group consisting of: changing the sequence of an exonic splicing silencer, changing the sequence of an exonic splicing enhancer, adding an exonic splicing enhancer, and adding an exonic splicing donor. In one embodiment, the alternatively spliced ​​exon is synthetic (i.e., not derived from a naturally occurring exon).

[0011] In another aspect, the invention provides a method of regulating expression of a target gene, the method comprising (a) inserting a polynucleotide cassette of the invention (as described, e.g., above and herein) into the target gene, (b) introducing the target gene comprising the polynucleotide cassette into a cell, and (c) exposing the cell to a small molecule ligand that specifically binds to the aptamer in an amount effective to induce expression of the target gene.

[0012] In one embodiment, the expression of the target gene when the small molecule ligand is present is about 5 times higher than the expression level when the small molecule ligand is not present. In one embodiment, the expression of the target gene when the small molecule ligand is present is about 10 times higher than the expression level when the small molecule ligand is not present.

[0013] In one embodiment, the polynucleotide cassette is inserted into the protein coding region of the target gene. In one embodiment, two or more polynucleotide cassettes are inserted into the target gene. In one embodiment, the two or more polynucleotide cassettes comprise different aptamers that specifically bind to different small molecule ligands. In another embodiment, the two or more polynucleotide cassettes comprise the same aptamer that specifically binds to different aptamers of the same ligand.

[0014] In one embodiment, the target gene comprising the polynucleotide box is incorporated into a vector for expression of the target gene. In one embodiment, the vector is a viral vector. In other embodiments, the viral vector is selected from the group consisting of: an adenoviral vector, an adeno-associated viral vector, and a lentiviral vector.

[0015] In another aspect, the present invention provides a method of regulating the expression of a target gene in an eye of a mammal, the method comprising (a) introducing into the eye a vector comprising a target gene, the target gene comprising a polynucleotide cassette comprising (i) a riboswitch and (ii) an alternatively spliced ​​exon, the alternatively spliced ​​exon flanked by a 5' intron and a 3' intron, wherein the synthetic riboswitch comprises an effector region, the effector region comprising a stem, the stem comprising a 5' splice site of the 3' intron; and an aptamer, the aptamer specifically binds to a ligand, wherein the alternatively spliced ​​exon comprises a stop codon, the stop codon is in frame with the target gene when the alternatively spliced ​​exon is spliced ​​into the target gene mRNA; and (b) providing a ligand to the mammal in an amount effective to induce expression of the target gene. In one embodiment, the ligand is a small molecule.

[0016] In one embodiment, the vector is introduced into the eye by intraocular injection. In one embodiment, the vector is a viral vector. In one embodiment, the viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, and a lentiviral vector.

[0017] In one embodiment, the polynucleotide for regulating the expression of a target gene in the eye contains 5' and 3' introns, which are derived from endogenous introns from the target gene. In one embodiment, the 5' and 3' introns are exogenous to the target gene. In one embodiment, the 5' and 3' introns are derived from intron 2 of the human beta-globin gene. In one embodiment, the 5' intron comprises a stop codon in frame with the target gene. In one embodiment, the length of the 5' and 3' introns is each independently about 50 to about 300 nucleotides. In one embodiment, the length of the 5' and 3' introns is each independently about 125 to about 240 nucleotides. In one embodiment, the 5' and / or 3' introns have been modified to include an intronic splicing enhancer, an intronic splicing enhancer, a 5' splice site, a 3' splice site, or a branch point sequence, or to change its sequence. In one embodiment, the length of the effector region stem of the riboswitch is about 7 to about 20 base pairs. In one embodiment, the length of the effector region stem is 8 to 11 base pairs. In one embodiment, the alternatively spliced ​​exon is derived from exon 2 of the human dihydrofolate reductase gene (DHFR), mutant human Wilms tumor 1 exon 5, mouse calcium / calmodulin-dependent protein kinase II delta exon 16, or SIRT1 exon 6. In one embodiment, the alternatively spliced ​​exon is a modified DHFR exon 2 from SEQ ID NO: 15, i.e., a modified exon 2 from human DHFR. In one embodiment, the alternatively spliced ​​exon has been modified with one or more of the group consisting of: changing the sequence of an exonic splicing silencer, changing the sequence of an exonic splicing enhancer, adding an exonic splicing enhancer, and adding an exonic splicing donor. In one embodiment, the alternatively spliced ​​exon is synthetic (i.e., not derived from a naturally occurring exon).

[0018] In one aspect, the invention provides a recombinant polynucleotide comprising a target gene containing a polynucleotide box for regulating the expression of the target gene (such as described above). In one embodiment, the polynucleotide box is positioned in the protein coding sequence of the target gene.

[0019] In one aspect, the present invention provides a vector comprising a target gene, the target gene containing a polynucleotide box for regulating the expression of the target gene (such as described above). In one embodiment, the vector is a viral vector. In one embodiment, the viral vector is selected from the group consisting of: an adenoviral vector, an adeno-associated viral vector, and a lentiviral vector. BRIEF DESCRIPTION OF THE DRAWINGS

[0020] Figure 1aSchematic view of the splicing construct "Con 1" with a truncated human β-globin intron 2 (IVS2Δ) inserted into the coding sequence of the luciferase gene. The designations "Luci exon 1" and "Luci exon 2" refer to the portion of the luciferase gene divided into the 5' and 3' coding sequences. Splicing of the inserted intron sequence IVS2Δ produces a full-length mRNA that is translated into a full-length protein.

[0021] Figure 1b .Effect of intron insertion and splice site sequence on luciferase expression. Con 1 to Con 7 have different intron splice sites (see Table 1). Con 1 has IVS2Δ containing the original IVS2 5' splice site and 3' splice site ("5'ss" and "3'ss", respectively). Con 2 to Con 7 have inserted IVS2Δ, but have 5'ss and 3'ss sequence differences as listed in Table 1. Con 8 does not have the IVS2Δ intron. Con 1 to Con 3 showed no effect of intron insertion on luciferase expression compared to the luciferase control without intron insertion (Con 8). Con 4 to Con 7, which have weaker splice sites, exhibited reduced luciferase expression.

[0022] Figure 2a Schematic diagram of an intron-exon-intron cassette with exon inclusion (I) and exclusion (II) splicing patterns depicted. Indicates the stop codon in DHFR exon 2. When the alternative DHFR exon is included in the target gene (luciferase) mRNA due to splicing (I), the resulting transcript contains an in-frame stop codon that blocks luciferase gene expression. The target gene is expressed only when the alternative DHFR exon containing the stop codon is excluded from the final mRNA (II).

[0023] Figure 2b .Inclusion or exclusion of DHFR selective exons on the expression of luciferase gene. Figure 2aLuciferase analysis was performed on HEK 293 cells transfected with different luciferase reporter gene constructs of the intron-exon-intron cassette shown in . DHFR exon 2 with wild-type splice site sequence (DHFR_wt) was compared with DHFR exons containing mutations in the 5′ss (DHFR_wt5ssC) or replacing the native 5′ss with a stronger Con 1 5′ss (DHFR_Con15ss) or with a weak 5′ss from Con 4 (DHFR_Con45ss). The construct used in lane 1 in 2b and 2c is Con 1, which is shown in FIG. 1 and Example 1. Insertion of DHFR exon 2 into luciferase mRNA results in reduced luciferase expression, which does not occur when the 5′ss (i.e., splice donor) of DHFR exon 2 is mutated (compare DHFR_wt with DHFR_wt5ssC). When the 5'ss of the DHFR exon was replaced with a stronger 5'ss from Con 1 (construct DHFR-Con1 5'ss), incorporation of the DHFR exon was enhanced, resulting in 545-fold lower luciferase expression compared to Con 1. When a weak 5'ss (from Con 4 in Example 1) was used in place of the wild-type 5'ss, splicing at this site was reduced, preventing incorporation of the DHFR exon, resulting in increased luciferase expression.

[0024] Figure 2c Exonic splicing enhancer (ESE) or suppressor (ESS) elements within DHFR exon sequences affect splicing of alternative DHFR exons and regulate target gene expression. Mutation of the SRp40 binding site within DHFR exon 2 significantly reduced luciferase expression: DHFR_wtmtSRp40 expression differed by 2,982-fold compared to Con 1 ( Figure 2c DHFR_wtmtSRp40; Table 2). Mutation of the putative binding site of the splicing enhancer SC35 to generate a stronger SC35 binding site (Table 2, StrSC35) further reduced luciferase expression (139-fold) compared to Con 1 ( Figure 2c , DHFR_wtStrSC35), which may be due to the increased efficiency of DHFR exon incorporation. Replacing the binding site of the splicing enhancer SC35 with the binding site of the splicing inhibitor hnRNP A1 (Table 2, SC35hnRNPA1) increased luciferase expression by 4.3-fold compared with wild-type DHFR exon 2 ( Figure 2c , DHFR_wt SC35hnRNPA1).

[0025] Figure 3aSchematic diagram of an intron-exon-intron cassette containing a hairpin structure at the 5'ss of the alternative DHFR exon 2. When the DHFR 5'ss is embedded within the hairpin structure, the DHFR exon will not be incorporated into the transcript, thus allowing luciferase to be expressed (x indicates the DHFR exon 5'ss buried in the hairpin).

[0026] Figure 3b .exist Figure 3a The sequences and structures of the four different hairpins tested in the intron-exon-intron cassette described in .

[0027] Figure 3c .Effect of the hairpin structure at the 5'ss of DHFR exon 2 on target gene expression. The construct containing the DHFR exon with the Con 1 5'ss sequence efficiently inhibited luciferase expression due to the inclusion of the DHFR exon in the spliced ​​mRNA (DHFR_Con15ss, Figure 3c ). However, the 5'ss embedded hairpin structure of the DHFR exon efficiently prevents the incorporation of the DHFR exon and allows luciferase expression (DHFR_Con15ss_HP15 Figure 3c ). The hairpin sequence with a disrupted stem did not restore luciferase expression ( Figure 3c .DHFR_Con15ss_HP15x). The DHFR_wtmtSRp40 construct (Example 2) did not express luciferase unless the 5'ss of the DHFR exon was stably sequestered in a hairpin structure (DHFR_wtmtSRp40_HP15). Even in the context of a mutant SRp40 binding site with strong splicing activity (DHFR_wtmtSRp40_HP15x), destabilization of the hairpin prevented luciferase expression.

[0028] Figure 4a .and Figure 4b Schematic diagram of gene regulation by an intron-exon-intron regulatory cassette containing a synthetic riboswitch. In the absence of aptamer / ligand binding, the aptamer sequence disrupts hairpin stem formation, making the DHFR exon 5'ss accessible and causing incorporation of the DHFR exon, thereby preventing translation and blocking protein expression ( Figure 4a ). When aptamer / ligand binding occurs, ligand-dependent conformational changes in the aptamer stabilize the stem formation, thereby sequestering the DHFR exon 5'ss, leading to DHFR exon exclusion and luciferase gene expression ( Figure 4b ).

[0029] Figure 4c.Hairpin stems and theophylline aptamer configurations with different connection stem lengths.The stem of theophylline aptamer is directly connected to the hairpin stem, thereby chelating the DHFR exon 5'ss, producing a 20bp synthetic stem.The stem sequence is truncated, thereby producing a series of hairpins with different stem lengths.The stem structures of DHFR_Theo1, 12, 13 and 14 are shown, and the stem lengths are 20bp, 9bp, 8bp and 7bp respectively.Theophylline is represented by the symbol (▲).

[0030] Figure 4d . Effect of different stem lengths of theophylline aptamers on target gene expression in the presence and absence of theophylline. The regulatory cassette ( Figure 4c ) regulated luciferase expression. In constructs Theo 1 to 12, as the stem length of 20 bp is reduced to 9 bp, the hairpin stem has sufficient length to form a stable structure in the absence of aptamer / ligand binding. DHFR_Theo13 does not form a stable hairpin stem in the absence of a ligand, so the DHFR exon 5'ss is not hidden, causing the inclusion of the DHFR exon, blocking luciferase expression. In the presence of theophylline, the hairpin is stabilized and the DHFR exon 5'ss is inaccessible to the splicing machinery. This causes the exclusion of the DHFR exon, allowing luciferase expression. In the presence of 3mM theophylline, DHFR_Theo_13 shows a 43-fold induction relative to the uninduced baseline expression level. In the presence or absence of theophylline, DHFR_Theo_14 does not show luciferase expression, indicating that even when the aptamer is bound to its ligand, this 7 bp stem is too short to form a stable hairpin. Therefore, the DHFR exon is spliced ​​into the transcript and blocks luciferase expression.

[0031] Figure 5a .Sequence of the synthetic stem connecting the xpt-guanine aptamer and the DHFR exon 5'ss sequence generated by sequential truncation of the hairpin stem and the aptamer P1 stem. Guanine is represented by the symbol (·).

[0032] Figure 5b Effect of stem length on the ability of riboswitches to regulate luciferase expression in response to aptamer ligand binding. 18 riboswitches of varying stem lengths were inserted into a regulatory cassette and the constructs were transfected into HEK 293 cells, which were grown in the presence or absence of 500 μM guanine. In the absence of guanine, constructs G14 to G18 exhibited reduced luciferase expression compared to the unregulated Con 1 control. In the presence of guanine, luciferase expression was restored to varying degrees.

[0033] Figure 5c and 5d . Further analysis of the effect of stem length on the ability of the riboswitch to regulate luciferase expression in response to aptamer ligand binding. Constructs G11 to G18 were validated using a luciferase assay. Figure 5d Shown is the basis and the induced luciferase level relative to Con1.In the absence of guanine, construct G14 to G17 shows clear regulation and control of luciferase expression by aptamer ligand (guanine in this case).In the absence of guanine, luciferase expression level is low.In the presence of guanine, luciferase expression is significantly activated. Figure 5d Shown is the percentage of Con 1 control expression achieved by these regulated constructs following induction with guanine.

[0034] Figure 5e .The regulatory cassette containing the xpt-G17 riboswitch in many different mammalian cell types allows for regulation of gene expression in response to a ligand. DHFR_G17 was transfected into HepG2, AML12, RD and C2C12 cell lines, and the luciferase expression of induction was analyzed after treatment with guanine. The multiple induction of luciferase expression when cells were grown in the presence of a ligand was shown compared to the uninduced baseline expression level when guanine was not added to the cell culture medium.

[0035] Figure 5f .Regulation of luciferase by containing xpt-G17 regulatory cassette in the context of viral vectors. A construct with a luciferase gene containing the xpt-G17 regulatory cassette was transferred to an AAV vector backbone and used to transfect cells. Cells were grown in the presence and absence of guanine. The fold induction of luciferase in the presence of guanine was shown, and after treatment with guanine, a 1687-fold expression induction was observed.

[0036] Figure 5g Regulation of the antibody by a regulatory cassette in response to an aptamer-binding ligand. An intron-exon-intron regulatory cassette with an xpt-G17 riboswitch was inserted into the leader peptide sequence of the anti-KDR antibody sequence, and the resulting construct was transfected into HEK 293 cells. As analyzed by ELISA, there was an 80-fold induction of antibody protein expression after treatment of the transfected cells with the ligand compared to untreated cells. The induced expression level reached approximately 40% of the control construct containing the Con 1 intron sequence.

[0037] Figure 5h. Regulation of secreted erythropoietin protein (EPO) by a regulatory cassette in response to aptamer / ligand binding. An intron-exon-intron regulatory cassette with an xpt-G17 riboswitch was inserted into the murine erythropoietin (Epo) gene, and the resulting construct was transfected into HEK 293 cells. As analyzed by ELISA, low-level expression of EPO was observed in the absence of guanine. In the presence of guanine, a 140-fold induction of EPO expression was observed.

[0038] Figure 6a Structures of the stems of different purine riboswitches tested in the regulatory cassette. Purines are represented by the symbol ·.

[0039] Figure 6b-6e Dose response of constructs with regulatory cassettes containing different aptamer-based riboswitches ( Figure 6a The riboswitch stem is illustrated in FIG.

[0040] Figure 6b .The regulatory cassette containing the guanine aptamer responds to guanine.

[0041] Figure 6c .The regulatory cassette containing the guanine aptamer responds to guanosine.

[0042] Figure 6d . The regulatory cassette containing the guanine aptamer responds to 2'dG.

[0043] Figure 6e .The regulatory cassette containing the adenine aptamer responds to adenine.

[0044] Figure 7a . Induction of EGFP by guanine in the presence of the xpt-G17 regulatory cassette. The intron-exon-intron cassette with the xpt-G17 riboswitch was cloned into the EGFP gene. HEK 293 cells stably transfected with the construct were treated with 500 μM guanine and GFP expression was analyzed 6 h after treatment by flow cytometry analysis. Guanine treatment resulted in an increase in EGFP expression, Figure 7a , (B).

[0045] Figure 7b.Response of target gene expression to the presence or absence of ligand. HEK293 cells stably transfected with EGFP using an intron-exon-intron cassette containing the xpt-G17 riboswitch were treated with 500 μM guanine for 3 days and analyzed by flow cytometry analysis every 24 h for 3 days. The guanine-containing medium was washed away from the cells and allowed to continue to grow for another 10 days in the absence of guanine treatment and EGFP expression was monitored. EGFP expression increased when guanine was present in the cell culture medium. When guanine was withdrawn, EGFP expression was lost.

[0046] Figure 8a . Luciferase expression regulated by two copies of the xpt-G15 containing regulatory cassette. The figure shows the guanine dose response of constructs containing a single xpt-G17 or xpt-G15 regulatory cassette inserted into the target gene and a construct with two copies of the xpt-G15 containing regulatory cassette (xpt-G15 double).

[0047] Figure 8b .EGFP expression regulated by different regulatory cassettes in tissue culture cells. One copy of the xpt-G17 cassette (EGFP-xpt-G17) resulted in low uninduced baseline expression (A) and reached lower induced expression levels (D) compared to cells containing the EGFP-xpt-G15 construct. One copy of the xpt-G15 cassette (EGFP-xpt-G15) resulted in higher uninduced baseline expression (B) as well as higher induced expression (E). In the case of a construct containing two copies of the xpt-G15 cassette (EGFP-xpt-G15 double), background uninduced expression was reduced (C) without reducing induced expression levels (F), so fold induction was increased. Cells were treated with guanine and imaged 24 h after treatment.

[0048] Figure 8c . Response of the regulatory cassette containing the xpt-G15 and xpt-G17 riboswitches to guanine and guanosine. Quantification of EGFP expression (mean fluorescence intensity) was analyzed by flow cytometry, and fold induction was calculated as the mean fluorescence intensity (MFI) obtained with guanine or guanosine treatment divided by the MFI obtained with no treatment. Treatment with guanine and guanosine gave similar levels and fold induction.

[0049] Figure 8d .Luciferase expression from a construct containing one copy of the xpt-G17 regulatory cassette in addition to one copy of the Ydh1-A5 regulatory cassette. HEK 293 cells transfected with this construct were treated with guanine or adenine or both. The highest luciferase induction was observed at the highest concentration of the two ligands used in combination.

[0050] Figure 9a and 9b Effect of intron truncation on luciferase expression regulated by an intron-exon-intron regulatory cassette containing the xpt-G17 riboswitch. Figure 9a Fold induction is shown, while 9b shows the percentage of luciferase expression compared to Con1.

[0051] Fig.9c . Diagram of the sequences deleted relative to the intron-exon-intron regulatory construct DHFR_G17. The deleted sequences are depicted by open bars and the remaining sequences by solid bars.

[0052] Figure 9d and 9e . Fig.9c Effects of different intron deletions on gene regulation as depicted in . Sequences flanking alternative DHFR exons within introns alter exon splicing and relative gene regulation. For example, DHFR-G17_2IR_3 exhibits an intron deletion that results in a significant fold increase in target gene expression. Figure 9d shows the fold induction, while Fig.9e Absolute protein expression levels relative to Con 1 control are shown.

[0053] Fig.10a and 10b .Different exons can act as alternative exons in intron-exon-intron regulatory cassettes to regulate gene expression. Fig.10a Constructs with different exons are shown with various uninduced baseline and induced (500 μM guanine) luciferase expression levels. Fig.10b Fold induction is shown for these constructs, with CaMKIId-e16 producing equivalent fold induction to the DHFR exon with an SRp40 activating mutation (mtDHFR).

[0054] Fig.11a -c. Regulation of luciferase expression in vivo in mice. Two copies of the xpt-G15 regulatory cassette (xpt-G15 double, Example 8, Figure 8a ) construct was delivered to the liver of mice. Mice were orally given different doses of guanosine at 2h and 12h after DNA delivery and then imaged. Oral administration of the ligand caused dose-dependent activation of the expression of the regulated target gene in the liver of mice ( Fig.11a and Fig.11b ).

[0055] In another experiment, guanosine ( Fig.11c). The images show the luciferase expression before and after treatment with 100 mg / kg or 300 mg / kg dose of guanosine. Fig.11d ), with average photons / second / mm 2 ± standard deviation represents luciferase activity. (n=5).

[0056] Fig.12 . EGFP transgene expression mediated by riboswitch-based AAV vector in mouse retina. Fluorescent fundus photography (exposure time: 30 s) showing EGFP transgene expression mediated by AAV2 / 8-GTX7 in the retina 8 days after subretinal injection.

[0057] Fig.13a and 13b .Representative fundus images of a single murine eye injected subretina with AAV2 / 8-GTX7, showing changes in EGFP transgene expression in the retina over time. AE: Images acquired at 2, 8, 9, 10, and 12 days after vector injection under white light illumination with an exposure time of 200 ms. The circular graph shows the retinal area visible through the pupil, which was considered as the ROI for quantification. FJ: Images acquired at an exposure time of 30 s under 475±25 nm illumination, showing eGFP fluorescence at 2, 8, 9, 10, and 12 days after vector injection. KO: Images acquired at 2, 8, 9, 10, and 12 days after vector injection under 475±25 nm illumination with an exposure time of 30 s, highlighting pixels within the ROI (circles) that exceed an intensity threshold of 50. Fig.13b High-resolution images before (A) and after (B) induction are shown.

[0058] Fig.13c Quantification of EGFP transgene expression over time after subretinal injection of AAV2 / 8-GTX7 in the murine retina. Fluorescent fundus photographs were acquired at the following time points: 2, 8, 9, 10, and 12 days after subretinal injection of AAV2 / 8-GTX7. Exposure time: 30 s, pixel intensity threshold for analysis: 50. Intraperitoneal induction was performed after imaging at 8, 9, and 10 days after subretinal injection of AAV2 / 8-GTX7. In addition, intravitreal induction was performed 11 days after subretinal injection of AAV2 / 8-GTX7. Statistical significance was shown based on one-way ANOVA with Dunnetts correction, and 8 days after injection served as the control point.

[0059] Fig.13dQuantification of EGFP transgene expression over time after subretinal injection of AAV2 / 8-GTX5 in the murine retina (positive control). Fluorescent fundus photographs were acquired at the following time points: 2, 8, 9, 10 and 12 days after subretinal injection of AAV2 / 8-GTX5. Exposure time: 10 s, pixel intensity threshold for analysis: 190. Intraperitoneal administration of guanosine was performed after imaging at 8, 9 and 10 days after subretinal injection of AAV2 / 8-GTX5. In addition, intravitreal administration of guanosine was performed 11 days after subretinal injection of AAV2 / 8-GTX5. One-way ANOVA with Bonferroni correction was applied, and no statistically significant differences were found in EGFP expression after treatment with guanosine. Specific implementation plan

[0060] The present invention provides a gene regulation cassette comprising a riboswitch in a 5' intron-alternative exon-3' intron context. A gene regulation cassette refers to a recombinant DNA construct that, when incorporated into the DNA of a target gene, provides the ability to regulate the expression of a target gene through aptamer / ligand-mediated alternative splicing of the resulting pre-mRNA. A riboswitch in the context of the present invention contains a sensing region (e.g., an aptamer) and an effector region that together are responsible for sensing the presence of a small molecule ligand and altering the splicing of the alternative exon. In one embodiment, the expression of the target gene is increased in the presence of an aptamer ligand and decreased in the absence of the ligand.

[0061] Riboswitch

[0062] As used herein, the term "riboswitch" refers to a regulatory segment of an RNA polynucleotide. A riboswitch in the context of the present invention contains a sensing region (e.g., an aptamer) and an effector region, which together are responsible for sensing the presence of a ligand (e.g., a small molecule) and altering the splicing of an alternative exon. In one embodiment, the riboswitch is recombinant using polynucleotides from two or more sources. As used herein, the term "synthetic" refers to a riboswitch that does not exist naturally in the context of a riboswitch. In one embodiment, the sensing region and the effector region are connected by a polynucleotide linker. In one embodiment, the polynucleotide linker forms an RNA stem (i.e., a region of a double-stranded RNA polynucleotide).

[0063] Effect area

[0064] In one embodiment, the effector region comprises the 5' splice site ("5'ss") sequence of the 3' intron (i.e., the intronic splice site sequence immediately 3' to the alternative exon). The effector region comprises the 5'ss sequence of the 3' intron and a sequence complementary to the 5'ss sequence of the 3' intron. When the aptamer binds its ligand, the effector region forms a stem and thus prevents splicing to the splice donor site at the 3' end of the alternative exon (see, e.g., Figure 4b Under certain conditions (e.g., when the aptamer is not bound to its ligand), the effector region is in a context that provides access to the splice donor site at the 3′ end of the alternative exon, thereby allowing the alternative exon to be included in the target gene mRNA (see, e.g., Figure 4a ).

[0065] The stem portion of the effector region should be of sufficient length (and GC content) to substantially prevent alternative splicing of the alternative exon upon ligand binding to the aptamer, while allowing access to the splice site when the ligand is not present in sufficient amounts. In embodiments of the invention, the stem portion of the effector region comprises a stem sequence in addition to the 5'ss sequence of the 3' intron and its complementary sequence. In embodiments of the invention, this additional stem sequence comprises a sequence from the stem of the aptamer. The length and sequence of the stem portion can be modified using known techniques to identify stems that allow acceptable background target gene expression when the ligand is not present, but allow acceptable target gene expression levels when the ligand is present (see, e.g., Examples 4 and 5 and Figure 4c and 4d , 5a, 5b, 5c, 5d). If the stem is, for example, too long, it may hide access to the 5'ss sequence of the 3' intron in the presence or absence of a ligand. If the stem is too short, it may not form a stable stem that can chelate the 5'ss sequence of the 3' intron, in which case the selective exon will be spliced ​​into the target gene information in the presence or absence of a ligand. In one embodiment, the total length of the effector region stem is between about 7 base pairs and about 20 base pairs. In some embodiments, the length of the stem is between about 8 base pairs and about 11 base pairs. In some embodiments, the length of the stem is 8 base pairs to 11 base pairs. In addition to the length of the stem, the GC base pair content of the stem can be changed to change the stability of the stem.

[0066] Aptamer / ligand

[0067] As used herein, the term "aptamer" refers to an RNA polynucleotide that specifically binds to a ligand. The term "ligand" refers to a molecule that is specifically bound by an aptamer. In one embodiment, the ligand is a low molecular weight (less than about 1,000 Dalton) molecule, including, for example, lipids, monosaccharides, second messengers, other natural products and metabolites, nucleic acids, and most therapeutic drugs. In one embodiment, the ligand is a polynucleotide having 2 or more nucleotide bases.

[0068] The aptamer has a binding region that can form a complex with the expected target molecule (i.e., ligand). The specificity of binding can be defined according to the comparative dissociation constant (Kd) of the aptamer to its ligand as compared with the dissociation constant of the aptamer to an unrelated molecule. Therefore, the ligand is a molecule that is bound to the aptamer with a higher affinity than an unrelated material. Generally, the Kd of the aptamer about its ligand will be at least about 10 times smaller than the Kd of the aptamer and the unrelated molecule. In other embodiments, the Kd will be at least about 20 times smaller, at least about 50 times smaller, at least about 100 times smaller, and at least about 200 times smaller. The length of the aptamer will generally be between about 15 and about 200 nucleotides. More commonly, the length of the aptamer will be between about 30 and about 100 nucleotides.

[0069] Aptamers that can be incorporated as part of a riboswitch can be naturally occurring aptamers or modified versions thereof, or aptamers that are designed de novo or synthetically screened by systematic evolution of ligands by exponential enrichment (SELEX). Examples of aptamers that bind small molecule ligands include, but are not limited to, theophylline, dopamine, sulforhodamine B, and cellobiose kanamycin A, lividomycin, tobramycin, neomycin B, puromycin, chloramphenicol, streptomycin, cytokines, cell surface molecules, and metabolites. For reviews of aptamers that recognize small molecules, see, for example, Famulok, Science 9:324-9 (1999) and McKeague, M. and DeRosa, MC J Nuc. Aci. 2012. In another embodiment, the aptamer is a complementary polynucleotide.

[0070] In one embodiment, the aptamer is designed to bind a specific small molecule ligand. Methods for designing aptamers include, for example, SELEX. For example, U.S. Patent Nos. 5,475,096, 5,270,163 and Abdullah Ozer et al. Nuc.Aci.2014 disclose methods for designing aptamers that selectively bind to small molecules using SELEX, and these references are incorporated herein by reference. Improvements to the SELEX method are described in U.S. Patent Nos. 5,580,737 and 5,567,588, which are incorporated herein by reference.

[0071] Selection techniques for identifying aptamers generally involve preparing a large pool of DNA or RNA molecules of the desired length containing randomized or mutagenized regions. For example, the oligonucleotide pool for aptamer selection may contain a region with 20-100 randomized nucleotides, which is flanked by about 15-25 nucleotides long and can be used to bind to the region of the specified sequence of PCR primers. Use standard PCR techniques or other means to allow amplification of the selected nucleic acid sequence to amplify the oligonucleotide pool. When RNA aptamers are needed, the DNA pool can be transcribed in vitro to produce a pool of RNA transcripts. The pool of RNA or DNA oligonucleotides is then selected based on the ability to specifically bind to the desired ligand. Selection techniques include, for example, affinity chromatography, but any scheme that will allow the ability to specifically bind to another molecule to select nucleic acids can be used. Selection techniques for identifying aptamers that bind to small molecules and function in cells may involve cell-based screening methods. In the case of affinity chromatography, oligonucleotides are contacted with a target ligand that is fixed on a matrix in a column or fixed on a magnetic bead. Preferably, oligonucleotides are selected for ligand binding in the presence of salt concentration, temperature, and other conditions simulating normal physiological conditions. Oligonucleotides bound to ligands in the pool are retained on posts or beads, while non-binding sequences are washed away. Then, the oligonucleotides binding to ligands are amplified by PCR (usually after elution) (if RNA transcripts are utilized, then after reverse transcription). The selection process is repeated for the selected sequence, and an iterative selection program of about three to ten rounds is performed. Then, standard procedures are used to amplify, clone, and sequence the obtained oligonucleotides to identify the oligonucleotide sequences that can bind to the target ligand. Once the aptamer sequence has been identified, the aptamer can be further optimized by starting with an additional round of selection from the oligonucleotide pool comprising the mutagenic aptamer sequence.

[0072] In vivo aptamer screening can be used after one or more rounds of in vitro selection (e.g., SELEX). For example, Konig, J. et al. (RNA. 2007, 13(4): 614-622, incorporated herein by reference) describe the use of SELEX in combination with the yeast three-hybrid system for in vivo selection of aptamers.

[0073] Alternative exons

[0074] The selective exon as part of the gene regulatory polynucleotide box of the present invention can be any polynucleotide sequence that can be transcribed as pre-mRNA and selectively spliced ​​into the mRNA of the target gene. The selective exon as part of the gene regulatory box of the present invention contains at least one sequence that inhibits translation, so that when the selective exon is incorporated into the target gene mRNA, the target gene expression caused by the mRNA is prevented or reduced. In a preferred embodiment, the selective exon contains a stop codon (TGA, TAA, TAG) in the same frame as the target gene when the selective exon is incorporated into the target gene mRNA due to splicing. In an embodiment, the selective exon includes (in addition to the stop codon or as a substitute for the stop codon) other sequences that reduce or substantially prevent translation when the selective exon is incorporated into the target gene mRNA by splicing, including, for example, a microRNA binding site, which causes degradation of the mRNA. In one embodiment, the selective exon includes a miRNA binding sequence, which causes degradation of the mRNA. In one embodiment, the selective exon encodes a polypeptide sequence that reduces the stability of the protein containing this polypeptide sequence. In one embodiment, the selectable exon encodes a polypeptide sequence that directs the degradation of a protein containing the polypeptide sequence.

[0075] The basal or background splicing level of the alternative exon can be optimized by changing the exonic splicing enhancer (ESE) sequence and the exonic splicing suppressor (ESS) sequence and / or by introducing the ESE or ESS sequence into the alternative exon. Such changes to the sequence of the alternative exon can be achieved using methods known in the art, including but not limited to site-directed mutagenesis. Alternatively, oligonucleotides of the desired sequence (e.g., comprising all or part of the alternative exon) can be obtained from commercial sources and cloned into a gene regulatory cassette. The identification of ESS and ESE sequences can be achieved by methods known in the art, including, for example, using ESEfinder 3.0 (Cartegni, L. et al. ESEfinder: a web resource to identify exonic splicing enhancers. Nucleic Acid Research, 2003, 31 (13): 3568-3571) and / or other available resources.

[0076] In one embodiment, the selective exon is exogenous to the target gene, although it may be derived from a sequence derived from the organism in which the target gene is to be expressed. In one embodiment, the selective exon is a synthetic sequence (see Example 10).

[0077] In one embodiment, the selective exon is a naturally occurring exon (see Example 10). In another embodiment, the selective exon is derived from all or part of a known exon (see Example 10). In this context, "derived" refers to a sequence or portion thereof containing a selective exon that is substantially homologous to a naturally occurring exon, but may contain various mutations, such as to introduce a stop codon that will be in frame with the target gene sequence, or to introduce or delete an exon splicing enhancer and / or to introduce a deletion exon splicing inhibitor. In one embodiment, the selective exon is derived from exon 2 of the human dihydrofolate reductase gene (DHFR), mutant human Wilms tumor 1 exon 5, mouse calcium / calmodulin-dependent protein kinase II δ exon 16, or SIRT1 exon 6.

[0078] 5′ and 3′ intron sequences

[0079] The selective exon is flanked by 5' and 3' intron sequences. The 5' and 3' intron sequences that can be used in the gene regulatory cassette of the present invention can be any sequence that can be spliced ​​out of the target gene to form the target gene mRNA or the target gene containing the selective exon in the mRNA, depending on the presence or absence of the ligand that binds the aptamer. The 5' and 3' introns each have sequences necessary for splicing, i.e., splice donor, splice acceptor, and branch point sequences. In one embodiment, the 5' and 3' intron sequences of the gene regulatory cassette are derived from one or more naturally occurring introns or portions thereof. In one embodiment, the 5' and 3' intron sequences are derived from truncated human β-globin intron 2 (IVS2Δ). In other embodiments, the 5′ and 3′ intron sequences are derived from SV40 mRNA introns (used in pCMV-LacZ vectors from Clonetech), intron 6 of the human triosephosphate isomerase (TPI) gene (Nott Ajit et al. RNA. 2003, 9: 6070617), or introns from human factor IX (Sumiko Kurachi et al. J. Bio. Chem. 1995, 270(10), 5276), the target gene's own endogenous introns, or any genomic fragment or synthetic intron (Yi Lai et al. Hum Gene Ther. 2006: 17(10): 1036) that contains sufficient elements for regulated splicing (Thomas A. Cooper, Methods 2005(37): 331).

[0080] In one embodiment, the selective exons and riboswitches of the present invention are engineered to be located in endogenous introns of the target gene. That is, the intron (or substantially similar intron sequence) is naturally present at the position of the target gene. In this case, the intron sequence immediately upstream of the selective exon is referred to as the 5' intron or 5' intron sequence, and the intron sequence immediately downstream of the selective exon is referred to as the 3' intron or 3' intron sequence. In this case, the endogenous intron is modified to contain a splice acceptor sequence and a splice donor sequence flanking the 5' and 3' ends of the selective exon.

[0081] The splice donor and splice acceptor sites in the gene regulatory cassette of the present invention can be modified to enhance or weaken them. That is, the splice sites can be modified by standard cloning methods, site-directed mutagenesis, etc. to be closer to the consistency for the splice donor or acceptor. Splice sites that are more similar to the splice consistency tend to promote splicing and are therefore enhanced. Splice sites that are less similar to the splice consistency tend to hinder splicing and are therefore weakened. Consistent for the splice donor of the most common type of intron (U2) is A / CAG||GTA / GAGT (where || represents the exon / intron boundary). Consistent for the splice acceptor is CAG||G (where || represents the exon / intron boundary). The frequency of specific nucleotides at the splice donor and acceptor sites is described in the art (see, for example, Zhang, MQ, Hum Mol Genet. 1988.7 (5): 919-932). The strength of the 5'ss and 3' splice sites can be adjusted to regulate the splicing of selective exons.

[0082] Additional modifications may be made to the 5' and 3' introns in the gene regulatory cassette to modulate splicing, including modification, deletion and / or addition of intronic splicing enhancer elements and / or intronic splicing repressor elements and / or alteration of branch site sequences.

[0083] In one embodiment, the 5' intron has been modified to contain a stop codon that will be in frame with the target gene. The 5' and 3' intron sequences can also be modified to remove cryptic cleavage sites that can be identified with publicly available software (see, e.g., Kapustin, Y. et al. Nucl. Acids Res. 2011. 1-8). The length of the 5' and 3' intron sequences can be adjusted, for example, to meet the size requirements of the viral expression construct. In one embodiment, the length of the 5' and 3' intron sequences is independently about 50 to about 300 nucleotides. In one embodiment, the length of the 5' and 3' intron sequences is independently about 125 to about 240 nucleotides.

[0084] Target Gene

[0085] The gene regulatory cassette of the present invention is a platform for regulating the expression of any target gene that can be expressed in a target cell, tissue or organism. The term "target gene" refers to a polynucleotide that is introduced into a cell and can be transcribed into RNA and translated and / or expressed under appropriate conditions. Alternatively, the target gene is endogenous to the target cell, and the gene regulatory cassette of the present invention is placed in the target gene (e.g., in an existing intron of an endogenous target gene). An example of a target gene is a polynucleotide encoding a therapeutic polypeptide. In one embodiment, when the gene regulatory cassette of the present invention is used to express the target gene, the target gene is not expressed as a fusion protein comprising a selective exon. The inclusion of the selective exon minimizes the translation of the mRNA due to, for example, causing the degradation of the information containing the selective exon, or, for example, due to its premature truncation, prevents the expression of the functional target gene. In one embodiment, the target gene is exogenous to the cell in which the recombinant DNA construct is to be transcribed. In another embodiment, the target gene is endogenous to the cell in which the recombinant DNA construct is to be transcribed. In one embodiment, the selective exon may contain a stop codon in the same frame as the coding sequence of the target gene. In other embodiments, the alternative exon may contain additional sequences that drive transcript degradation and / or block translation of the target gene.

[0086] The target gene according to the present invention can be a gene encoding a protein, or a sequence encoding a non-protein encoding RNA. The target gene can be, for example, a gene encoding a structural protein, an enzyme, a cell signaling protein, a mitochondrial protein, a zinc finger protein, a hormone, a transporter, a growth factor, a cytokine, an intracellular protein, an extracellular protein, a transmembrane protein, a cytoplasmic protein, a nucleoprotein, a receptor molecule, an RNA binding protein, a DNA binding protein, a transcription factor, a translation mechanism, a channel protein, a motor protein, a cell adhesion molecule, a mitochondrial protein, a metabolic enzyme, a kinase, a phosphatase, an exchange factor, a chaperone protein, and any of these regulators. In embodiments, the target gene encodes erythropoietin (Epo), human growth hormone (hGH), a transcription activator-like effector nuclease (TALEN), human insulin, CRISPR-associated protein 9 (cas9) or an immunoglobulin (or part thereof), including, for example, therapeutic antibodies.

[0087] Expression constructs

[0088] The present invention encompasses the use of recombinant vectors to introduce polynucleotides encoding target genes and containing gene regulatory boxes of the present invention into target cells. In many embodiments, the recombinant DNA construct of the present invention includes additional DNA elements, which include DNA segments providing replication of DNA in host cells and expression of the appropriate level of target genes in the cells. Ordinary technical technicians understand the ability to promote the expression of target genes in target cells to select expression control sequences (promoters, enhancers, etc.). "Vector" means a recombinant plasmid, yeast artificial chromosome (YAC), minichromosome, DNA minicircle or virus (including virus-derived sequences) containing polynucleotides to be delivered to host cells in vitro or in vivo. In one embodiment, the recombinant vector is a combination of viral vectors or multiple viral vectors.

[0089] Viral vectors for expression of target genes in target cells, tissues or organisms are known in the art and include adenoviral (AV) vectors, adeno-associated viral (AAV) vectors, retroviral and lentiviral vectors, and herpes simplex type 1 (HSV1) vectors.

[0090] Adenoviral vectors include, for example, those based on human adenovirus type 2 and human adenovirus type 5, which have become replication-defective by deletions in the E1 and E3 regions. The transcription cassette can be inserted into the E1 region to produce a recombinant E1 / E3 deleted AV vector. Adenoviral vectors also include helper-dependent high-capacity adenoviral vectors (also referred to as high-capacity "visceral-free" or "de-visceral" vectors), which do not contain viral coding sequences. These vectors contain cis-acting elements required for viral DNA replication and packaging, mainly inverted terminal repeats (ITRs) and packaging signals (Ψ). These helper-dependent AV vector genomes have the potential to carry foreign DNA from several hundred base pairs to about 36 kb.

[0091] Recombinant adeno-associated virus "rAAV" vectors include any vector derived from any adeno-associated virus serotype, including but not limited to AAV-1, AAV-2, AAV-3, AAV-4, AAV-5, AAV-7 and AAV-8, AAV-9, AAV-10, etc. The rAAV vector may have one or more of the AAV wild-type genes deleted in whole or in part, preferably the Rep and / or Cap genes, but retain functional flanking ITR sequences. Functional ITR sequences are retained for rescue, replication, packaging, and potential chromosomal integration of the AAV genome. ITRs do not need to be wild-type nucleotide sequences and may be altered (e.g., by insertion, deletion, or substitution of nucleotides) as long as the sequence provides functional rescue, replication, and packaging.

[0092] Alternatively, other systems such as lentiviral vectors may be used in embodiments of the present invention. Lentivirus-based systems can transduce non-dividing as well as dividing cells, making them useful for applications targeting non-dividing cells such as the CNS. Lentiviral vectors are derived from human immunodeficiency virus and, like the virus, integrate into the host genome, providing the potential for very long-term gene expression.

[0093] It is also possible to use, for example, cationic lipids, polymers or both as carriers to introduce polynucleotides including plasmids, YACs, minichromosomes and minicircles carrying target genes containing gene regulatory cassettes into cells or organisms through non-viral vector systems. Conjugated poly-L-lysine (PLL) polymers and polyethyleneimine (PEI) polymer systems can also be used to deliver vectors to cells. For cell culture and organisms, other methods for delivering vectors to cells include hydrodynamic injection and electroporation and the use of ultrasound. For a review of viral and non-viral delivery systems for gene delivery, see Nayerossadat, N. et al. (Adv Biomed Res. 2012; 1: 27), which is incorporated herein by reference.

[0094] Methods for regulating the expression of target genes

[0095] In one aspect, the invention provides a method of regulating the expression of a target gene (e.g., a therapeutic gene) by (a) inserting a gene regulatory cassette of the invention into a target gene; (b) introducing a target gene comprising a gene regulatory cassette into a cell; and (c) exposing the cell to a ligand that binds an aptamer. In one embodiment, the ligand is a small molecule. In various aspects, expression of the target gene in a target cell confers the desired properties of the cell into which it is introduced, or otherwise produces a desired therapeutic outcome.

[0096] In a preferred embodiment, the gene regulatory cassette is inserted into the protein coding sequence (rather than the 5' or 3' untranslated region) of the target gene. In one embodiment, a single gene regulatory cassette is inserted into the target gene. In other embodiments, 2, 3, 4 or more gene regulatory cassettes are inserted into the target gene. In one embodiment, two gene regulatory cassettes are inserted into the target gene. When multiple gene regulatory cassettes are inserted into the target gene, they can each contain the same aptamer, so that a single ligand can be used at multiple cassettes to regulate alternative splicing and thereby regulate target gene expression. In other embodiments, multiple gene regulatory cassettes are inserted into the target gene, and each of the multiple gene regulatory cassettes can contain different aptamers, so that exposure to multiple different small molecule ligands regulates target gene expression. In other embodiments, multiple gene regulatory cassettes are inserted into the target gene, and each of the multiple gene regulatory cassettes contains different 5' introns, selective exons, and 3' intron sequences. This can be useful in reducing recombination and improving the ease of merging into viral vectors.

[0097] Treatment methods and pharmaceutical compositions

[0098] One aspect of the invention provides a method for regulating the level of a therapeutic protein delivered by gene therapy. In this embodiment, a "target gene" may encode a therapeutic protein. A "target gene" may encode a protein that is endogenous or exogenous to a cell.

[0099] For example, a therapeutic gene sequence containing a regulatory cassette with an aptamer-driven riboswitch is delivered to a target cell in vivo via a vector. The cell specificity of the "target gene" can be controlled by a promoter or other elements within the vector. Delivery of a vector construct containing a target gene and transfection of the target tissue to produce a stable transfection of the regulated target gene is the first step in producing a therapeutic protein.

[0100] However, due to the presence of the regulatory cassette within the target gene sequence, the target gene is not expressed at a significant level, i.e., it is in an "off state" in the absence of a specific ligand that binds to the aptamer contained within the regulatory cassette riboswitch. Only when the aptamer-specific ligand is applied is target gene expression activated.

[0101] The delivery of the vector construct containing the target gene and the delivery of the activating ligand are usually separated in time. The delivery of the activating ligand will control when the target gene is expressed and the level of protein expression. The ligand can be delivered by many approaches, including but not limited to oral, intramuscular (IM), intravenous (IV), intraocular or local.

[0102] The delivery time of the ligand will depend on the requirements for activating the target gene. For example, if the therapeutic protein encoded by the target gene is continuously needed, then the oral small molecule ligand can be delivered daily or multiple times a day to ensure the continuous activation of the target gene and thus the continuous expression of the therapeutic protein. If the target gene has a long-lasting effect, then the inducing ligand can be given less frequently.

[0103] The present invention allows for temporal control of expression of therapeutic transgenes in a manner determined by the timed administration of ligands specific for the aptamers within the regulatory cassette. Expression of the therapeutic transgene only after ligand administration increases the safety of gene therapy treatments by allowing the target gene to be turned off in the absence of ligand.

[0104] Different aptamers can be used to activate target genes with different ligands. In certain embodiments of the invention, each therapeutic gene containing a regulatory cassette will have a specific aptamer in the cassette that will be activated by a specific small molecule. This means that each therapeutic gene can only be activated by a ligand that is specific for the aptamer contained therein. In these embodiments, each ligand will only activate one therapeutic gene. This makes it possible that several different "target genes" can be delivered to an individual, and each will be activated after delivery of a ligand that is specific for the aptamer contained in the regulatory cassette contained in each target gene.

[0105] The present invention allows any therapeutic protein (such as erythropoietin (EPO) or therapeutic antibodies) that can be delivered to the body by gene production when an activating ligand is delivered. This therapeutic protein delivery method can replace the production of such therapeutic proteins outside the body and then injecting or infusing the therapeutic proteins, such as antibodies used in cancer or for blocking inflammatory or autoimmune diseases. The body containing the regulated target gene becomes a biologic manufacturing factory, which is turned on when the gene-specific ligand is administered.

[0106] The level and timing of administration of a therapeutic protein can be critical to the therapeutic effect. The present invention increases the ease of dosing in response to monitoring of therapeutic protein levels and effects.

[0107] In one embodiment, the target protein may be a nuclease that can target and edit a specific DNA sequence. Such nucleases include Cas9, zinc finger nucleases or TALEN. In the case of these nucleases, the nuclease protein may only need a short period of time sufficient to edit the target endogenous gene. However, if the unregulated nuclease gene is delivered to the body, this protein may exist in the remaining life of the cell. In the case of nucleases, the longer the nuclease exists, the higher the risk of off-target editing. The regulation of the expression of such proteins has significant safety advantages. In this case, a vector containing a nuclease target gene containing a regulatory cassette can be delivered to appropriate cells in vivo. In the absence of a cassette-specific ligand, the target gene is in a "closed" state, so no nuclease is produced. Only when an activating ligand is applied, a nuclease is produced. When enough time has passed, allowing enough editing to occur, the ligand is withdrawn and no longer applied. Therefore, the nuclease gene is thus in a "closed" state, and no nuclease is produced, and editing stops. This approach can be used to overcome genetic conditions, including many inherited retinopathies such as LCA10, caused by mutations in CEP290, and Stargardts disease, caused by mutations in ABCA4.

[0108] Administration of regulated target genes encoding therapeutic proteins that are activated only upon administration of a specific ligand can be used to regulate therapeutic genes to treat many different types of diseases, such as treating cancer with therapeutic antibodies, treating immune disorders, metabolic diseases with immunomodulatory proteins or antibodies, treating rare diseases such as PNH with anti-C5 antibodies or antibody fragments as regulated genes or treating ocular angiogenesis with therapeutic antibodies, and treating dry AMD with immunomodulatory proteins.

[0109] A variety of specific target genes that allow for the treatment of a variety of specific diseases and conditions are suitable for use in the present invention. For example, insulin or insulin analogs (preferably human insulin or human insulin analogs) can be used as target genes for the treatment of type I diabetes, type II diabetes, or metabolic syndrome; human growth hormone can be used as a target gene for the treatment of children with growth disorders or adults who lack growth hormone; erythropoietin (preferably human erythropoietin) can be used as a target gene for the treatment of anemia caused by chronic kidney disease, anemia caused by myelodysplasia, or anemia caused by cancer chemotherapy.

[0110] The present invention is particularly suitable for treating diseases caused by single gene defects, such as cystic fibrosis, hemophilia, muscular dystrophy, thalassemia or sickle cell anemia. Thus, human β-globulin, γ-globulin, δ-globulin or ζ-globulin can be used as target genes for treating β-thalassemia or sickle cell anemia; human factor VIII or factor IX can be used as target genes for treating hemophilia A or hemophilia B.

[0111] The ligand used in the present invention is usually combined with one or more pharmaceutically acceptable carriers to form a pharmaceutical composition suitable for administration to a patient. Pharmaceutically acceptable carriers include solvents, adhesives, diluents, disintegrants, lubricants, dispersion media, coatings, antibacterial and antifungal agents, isotonic and absorption delay agents, etc., which are commonly used in the pharmaceutical field. The pharmaceutical composition can be in the form of tablets, pills, capsules, lozenges, etc., and is formulated to be compatible with its expected route of administration. Examples of routes of administration include parenteral, such as intravenous, intradermal, intranasal, subcutaneous, oral, inhaled, through the dermis (topical), through the mucosa, and through the rectum.

[0112] A pharmaceutical composition comprising a ligand is administered to a patient in a dosage regimen such that an amount of the ligand sufficient to properly regulate the target gene is delivered to the patient. When the ligand is a small molecule and the dosage form is a tablet, a pill, etc., preferably, the pharmaceutical composition comprises 0.1 mg to 10 g of the ligand; 0.5 mg to 5 g of the ligand; 1 mg to 1 g of the ligand; 2 mg to 750 mg of the ligand; 5 mg to 500 mg of the ligand; or 10 mg to 250 mg of the ligand.

[0113] The pharmaceutical composition may be administered once a day or multiple times a day (e.g., 2, 3, 4, 5 or more times a day). Alternatively, the pharmaceutical composition may be administered less than once a day, e.g., once every 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13 or 14 days, once a month, or once every several months. In some embodiments of the invention, the pharmaceutical composition may be administered to the patient only a few times, e.g., once, twice, three times, etc.

[0114] The present invention provides a method for treating a patient in need of increased expression of a therapeutic protein encoded by a target gene, the method comprising administering to the patient a pharmaceutical composition comprising a ligand for an aptamer, wherein the patient has previously been administered a recombinant DNA comprising the target gene, wherein the target gene contains a gene regulatory cassette of the present invention, and the gene regulatory cassette of the present invention provides the ability for the ligand of the aptamer to regulate the expression of the target gene through alternative splicing of the pre-mRNA of the target gene, thereby increasing the expression of the therapeutic protein.

[0115] Products and kits

[0116] Also provided are kits and articles for use in the methods described herein. In various aspects, the kit is included in the compositions described herein in suitable packaging (e.g., compositions for delivering vectors containing target genes containing gene regulatory cassettes). Packaging suitable for the compositions described herein (such as injectable ophthalmic compositions) is known in the art, and includes, for example, vials (such as sealed vials), containers, ampoules, bottles, cans, flexible packages (e.g., sealed Mylar or plastic bags), etc. These articles may be further sterilized and / or sealed.

[0117] The present invention also provides a kit comprising the composition described herein, and may further include instructions for methods of using the composition, such as the uses described herein. The kit described herein may further include other materials that are ideal from a commercial and user perspective, including other buffers, diluents, filters, needles, syringes, and package inserts with instructions for administering (including, for example, any method described herein). For example, in some embodiments, the kit includes rAAV for the expression of a target gene comprising a gene regulatory cassette of the present invention, a pharmaceutically acceptable carrier suitable for injection, and one or more of the following: buffers, diluents, filters, needles, syringes, and package inserts with instructions for injection. In some embodiments, the kit is suitable for intraocular injection, intramuscular injection, intravenous injection, etc.

[0118] As used herein, "homology" and "homologous" refer to the percent identity between two polynucleotide sequences or between two polypeptide sequences. The correspondence between one sequence and another can be determined by techniques known in the art. For example, homology can be determined by comparing sequence information and directly comparing two polypeptide molecules using readily available computer programs. Alternatively, homology can be determined as follows: polynucleotides are hybridized under conditions where a stable duplex is formed between homologous regions, followed by digestion with a single-stranded specific nuclease, and the size of the digested fragments is determined. When, after optimal alignment with appropriate insertions or deletions, as determined using the above method, at least about 80%, at least about 85%, at least about 90%, and at least about 95% of nucleotides or amino acids match on a molecule of a determined length, respectively, two polynucleotides or two polypeptide sequences are "substantially homologous" to each other.

[0119] "Percentage of sequence identity" relative to a reference polypeptide or nucleic acid sequence is defined as the percentage of amino acid residues or nucleotides in the candidate sequence that are identical to the amino acid residues or nucleotides in the reference polypeptide or nucleic acid sequence, after aligning the sequences and introducing gaps (if necessary) to achieve the maximum percentage of sequence identity. Alignment for the purpose of determining percentage of amino acid or nucleic acid sequence identity can be achieved in a manner known to the skilled artisan, for example, using publicly available computer software programs, including BLAST, BLAST-2, ALIGN, and Megalign (DNASTAR) software.

[0120] As used herein, the term "polynucleotide" or "nucleic acid" refers to a polymeric form of nucleotides (ribonucleotides or deoxyribonucleotides) of any length. Thus, this term includes, but is not limited to, single-stranded, double-stranded or multi-stranded DNA or RNA, genomic DNA, cDNA, DNA-RNA hybrids, or polymers containing purine and pyrimidine bases or other natural, chemically or biochemically modified, non-natural or derived nucleotide bases.

[0121] "Heterologous" or "exogenous" means an entity that is genotypically different from the rest of the entity to which it is compared or introduced or incorporated. For example, a polynucleotide introduced into a different cell type by genetic engineering techniques is a heterologous polynucleotide (and can encode a heterologous polypeptide when expressed). Similarly, a cellular sequence (e.g., a gene or portion thereof) incorporated into a viral vector is a heterologous nucleotide sequence relative to the vector.

[0122] It should be understood and expected that those skilled in the art may make changes to the principles of the invention disclosed herein, and such modifications are intended to be included within the scope of the invention. The following examples further illustrate the present invention, but should not be construed as limiting the scope of the invention in any way. All references cited herein are incorporated herein by reference in their entirety.

[0123] Example

[0124] Example 1. Effect of splice site strength on the expression of regulated genes

[0125] Experimental Procedure

[0126] Plasmid construct: Luci-BsaI-receptor: A DNA fragment containing a CMV promoter was released from a pHAGE-CMV-eGFP-W (Harvard University) vector by restriction enzymes SpeI and NotI, and this fragment was cloned into a pHDM-G (Harvard University) vector digested with SpeI and NotI. The fragment containing the SV40 Ori sequence in the resulting vector was deleted by digestion with BsmI and BstXI, removal of the 3' overhang and ligation. The subsequent vector was subjected to site-directed mutagenesis (Agilent) to delete the BsaI site in the AmpR gene. The resulting vector was then digested with NotI and BamHI, and ligated with a fragment containing NotI-BsaI-BamHI sites to produce the final Luci-BsaI-receptor vector. pHDM-G was used as a template for a human β-globin intron 2 ("IVS2Δ") containing a deletion of the middle portion that is not considered critical for splicing (see Table 5, SEQ ID NO: 1). pGL3-promoter (Promega) was used as a template for the firefly luciferase gene. Construct 8: The luciferase gene was amplified by PCR using primers Luc-For-BsaI and Luci-Rev-BsaI. The PCR product was digested with BsaI and cloned into the BsaI-digested Luci-BsaI-acceptor vector. Splicing constructs 1-7 (Con 1-7, SEQ ID NO.1-SEQID NO.7) were prepared by ligating the 3BsaI-digested PCR product into the BsaI-digested Luci-BsaI-acceptor, which express the luciferase gene inserted with intron IVS2Δ, which has different 5′ss and 3′ss at each end of the intron sequence. pGL3-promoter vector was used as a luciferase template, and pHDM-G was used as a template for IVS2Δ.For Con 1-7, the primer pairs used to amplify the PCR fragments were as follows: Con 1: Luci-For-BsaI / Luci-splicing-Rev_1, IVS2-BsaI-For / IVS2-BsaI-Rev_1, and Luci-splicing-For_1 / Luci-Rev-BsaI; Con 2: Luci-For-BsaI / Luci-splicing-Rev_2, IVS2-BsaI-For / IVS2-BsaI-Rev_2, and Luci-splicing-For_2 / Luci-Rev-BsaI; Con 3: Luci-For-BsaI / Luci-splicing-Rev_3, IVS2-BsaI-For / IVS2-BsaI-Rev_3, and Luci-splicing-For_3 / Luci-Rev-BsaI; Con 4: Luci-For-BsaI / Luci-splicing-Rev_4, IVS2-BsaI-For / IVS2-BsaI-Rev_1, and Luci-splicing-For_4 / Luci-Rev-BsaI; Con 5: Luci-For-BsaI / Luci-splicing-Rev_1, IVS2-BsaI-For / IVS2-BsaI-Rev_1, and Luci-splicing-For_5 / Luci-Rev-BsaI; Con Con6: Luci-For-BsaI / Luci-splicing-Rev_1, IVS2-BsaI-For / IVS2-BsaI-Rev_1 and Luci-splicing-For61 / Luci-Rev-BsaI; Con7: Luci-For-BsaI / Luci-splicing-Rev_1, IVS2-BsaI-For / IVS2-BsaI-Rev_1 and Luci-splicing-For71 / Luci-Rev-BsaI. All constructs were verified by DNA sequencing.

[0127] Table 1. Splice sites of splicing constructs (Con 1-7). Intron / exon boundaries are marked by ||.

[0128] Constructs 5′ splice site 3′ splice site Con 1 AGG||GTGAGT TCTTATCTTCCTCCCACAG||C Con 2 AAA||GTAAGC TCTTATCTTCCTCCCACAG||C Con 3 GCA||GTAAGT TCTTATCTTCCTCCCACAG||C Con 4 GAG||GTGTGG TCTTATCTTCCTCCCACAG||C Con 5 AGG||GTGAGT ctttacttctatgactgtAG||C Con 6 AGG||GTGAGT gtgactgtgtgtatgcacAG||C Con 7 AGG||GTGAGT attgtgatcgcagccaatAG||C

[0129] Transfection: One day before transfection, 3.5x10^4 HEK 293 cells were seeded in a 96-well flat-bottom plate. Plasmid DNA (500ng) was added to a tube or a 96-well U-bottom plate. Separately, TransIT-293 reagent (Mirus; 1.4uL) was added to 50μL Opti-mem I medium (Life Technologies) and allowed to stand for 5 minutes at room temperature (RT). Then, 50uL of this diluted transfection reagent was added to the DNA, mixed and incubated at room temperature ("RT") for 20min. Finally, 7μL of this solution was added to the cell wells in the 96-well plate.

[0130] Firefly luciferase analysis of cultured cells: 24 hours after the medium was replaced, the plate was removed from the incubator and equilibrated to RT on the bench for several minutes, then aspirated. Glo-lysis buffer (Promega, 100 μL, RT) was added and the plate was kept at RT for at least 5 minutes. The well contents were then mixed by grinding with 50 μL, and 20 μL of each sample was mixed with 20 μL bright-glo reagent (Promega) diluted to 10% in glo-lysis buffer. 96 wells were spaced apart on an opaque white 384-well plate. After incubation at RT for 5 min, luminescence was measured using a Tecan machine with a 500 millisecond reading time. Luciferase activity was expressed as mean relative light units (RLU) ± standard deviation.

[0131] result

[0132] To establish a splicing-based gene regulation platform, we first tested the effects of (i) inserting introns into the coding sequence (CDS) of a gene of interest (in this case, the firefly luciferase gene) on gene expression ( Figure 1a ) and (ii) the effect of different 5'ss and 3'ss on gene expression. Truncated human β-globin intron 2 (IVS2Δ) with different 5'ss and 3'ss at each end was inserted into the coding sequence of the firefly luciferase gene to test the splicing efficiency. Construct Con 8 does not have the IVS2Δ intron, while Con 1 (SEQ ID No.: 1) has IVS2Δ with the original IVS2 5' and 3'ss sequences. Constructs Con 2 to Con7 (SEQ ID No.: 2-7) have IVS2Δ with different 5' and 3'ss sequences as listed in Table 1. Figure 1bAs shown in , insertion of IVS2Δ with the native IVS2 splice site into the luciferase gene did not affect gene expression (compare Con 1 to Con 8). However, replacing the IVS2 splice site in IVS2Δ with splice site sequences of different strengths significantly impaired luciferase expression. Figure 1b As shown in, Con 2 and Con 3 with 5'ss changes had expression levels similar to Con 1 and Con 8, and then the 5'ss change in Con 4 and the 3'ss change in Con 5 to Con 7 did not significantly reduce luciferase expression (compare Con 4 to Con 7 with Con 8). Therefore, the difference in splice sites affects target gene expression. Con 1 was used for further development.

[0133] Example 2. Effects of intron-exon-intron cassettes and cis-elements on splicing in regulating target gene expression.

[0134] Experimental Procedure

[0135] Putative exonic splicing enhancer (ESE) sequences were predicted using ESEfinder 3.0. Wild-type human dihydrofolate reductase (DHFR) exon 2 with intronic flanking sequences having native 5'ss (DHFR-wt; (Table 2); SEQ ID NO.: 47), native 5'ss with four nucleotides mutated to C (DHFR-wt5ssC; (Table 2); SEQ ID NO.: 48), 5'ss sequences from Con 1 (DHFR-Con15ss; Table 2 SEQ ID NO.: 49) or Con4 (DHFR-Con45ss, SEQ ID NO.: 50) were synthesized (IDT). To test the role of ESE and exonic splicing suppressor (ESS) sequences within DHFR exon 2, different DHFR exon 2 mutants were synthesized (listed in Table 2).

[0136] All of these different DHFR exon 2 sequences were cloned into the approximate center of the IVS2Δ intron in the Con1 construct using the Golden Gate cloning strategy (NEB).

[0137] The constructs were verified by DNA sequencing (Genewiz).The DNA was transfected in HEK 293 cells and luciferase activity was analyzed as described in Example 1.

[0138] Table 2. DHFR exon 2 containing modified splicing regulatory sequences. The underlined sequences represent modified splicing regulatory sequences within DHFR exon 2.

[0139]

[0140] result

[0141] Wild-type human DHFR exon 2 and adjacent intronic sequences (SEQ ID NO.: 8) were inserted into the approximate center of the IVS2Δ intron in the Con 1 construct. This configuration creates a platform where exogenous exons in intronic sequences of target genes can act as alternative exons, allowing regulation of target gene expression by modulating alternative exon splicing. In this configuration ( Figure 2a ), splicing events can occur between the 5' portion of the target gene and the DHFR exon and between the DHFR exon and the 3' portion of the target gene, so that the DHFR exon is incorporated into the target gene mRNA. Since the selective DHFR exon contains an in-frame premature stop codon when the DHFR exon is incorporated into the mRNA, luciferase gene expression is reduced. However, when the 5'ss of the selective DHFR exon (i.e., the splice donor site at the 5' end of the 3' intron) is mutated or inaccessible, thereby preventing splicing at this site, the DHFR exon is excluded from the mRNA, and the mRNA is efficiently translated and the target gene protein is expressed ( Figure 2a ).

[0142] We first tested DHFR exon 2 with unaltered native cis elements and various other forms of splicing in which the 5'ss sequence was enhanced or attenuated. Insertion of the DHFR exon (SEQ ID NO.: 8) with native 5'ss and 3'ss into the intron sequence in Con 1 to form DHFR_wt significantly reduced luciferase expression compared to Con 1 without the alternative DHFR exon. Expression from the DHFR_wt construct was 116-fold lower than that of Con 1 ( Figure 2b ).

[0143] When the 5′ss of the DHFR exon was mutated to a non-functional sequence (DHFR_wt5ssC; SEQ ID NO.: 48), DHFR exon incorporation was blocked and luciferase expression was restored to the level of Con 1 ( Figure 2a II, 2b, 2c).

[0144] When the 5'ss of the DHFR exon was replaced with a stronger 5'ss (in this case, the 5'ss from Con 1) (DHFR_Con1 5ss; SEQ ID NO.: 49), incorporation of the DHFR exon was increased, resulting in a 545-fold decrease in luciferase gene expression compared to Con 1 ( Figure 2bHowever, when the weak 5'ss from Con 4 was used (DHFR_Con4 5ss; SEQ ID NO.: 50), the DHFR exon was not incorporated and luciferase expression increased ( Figure 2b ).

[0145] Exonic splicing enhancer (ESE) or suppressor (ESS) elements play a key role in splicing, and their function is often context-dependent. The role of putative splicing regulatory sequences located within the DHFR exon was tested. When the putative splicing enhancer SRp40 binding site located within the DHFR exon was mutated (Table 2, DHFR_mtSRp40; SEQ ID NO.: 51), DHFR exon inclusion was significantly enhanced, resulting in a 2982-fold decrease in luciferase expression compared to Con1 ( Figure 2c , DHFR_wt and DHFR mtSRp40).

[0146] When another splicing enhancer SC35 binding site within the DHFR exon (predicted by ESE finder) was mutated to a stronger SC35 binding sequence (Table 2, DHFR_StrSC35; SEQ ID NO.: 52), DHFR exon inclusion was enhanced, thereby reducing luciferase expression by 139-fold compared with Con1 ( Figure 2c This is compared to the construct containing the native DHFR exon (DHFR_wt Figure 2b ) a slightly greater decrease was observed.

[0147] When the splicing enhancer SC35 binding site was mutated to a splicing repressor (hnRNP A1 binding site) (Table 2, DHFR_wtSC35hnRNPA1; SEQ ID NO.: 53), the efficiency of DHFR exon incorporation was low, resulting in increased luciferase expression ( Figure 2c , DHFR_wt and DHFR_wtSC35hnRNPA1).

[0148] An intron-exon-intron cassette has been created in which the expression of a target gene (luciferase in this case) can be turned on or off depending on the inclusion or exclusion of an alternative exon (in this case, an alternative DHFR exon containing an in-frame stop codon). Splicing that results in inclusion of the alternative exon decreases gene expression, while gene expression increases when splicing excludes the alternative exon. The strength or weakness of the 5'ss of the alternative exon and sequences within the exon that regulate splicing alter the target expression level via their effect on the inclusion or exclusion of exogenous exons.

[0149] Example 3. Effect of hairpin formation at the 5' splice site of alternative exons on regulating target gene expression.

[0150] Experimental Procedure

[0151] A sequence containing DHFR exon 2 with native 3' and 5' ss sequences embedded in a hairpin structure was synthesized (IDT) and cloned into the indicated vectors using a Golden Gate cloning strategy (NEB). The constructs were transfected into HEK293 cells and analyzed for luciferase activity as described in Example 1.

[0152] result

[0153] We tested whether embedding the 5'ss of the DHFR exon into a hairpin stem structure would affect splicing and inclusion of alternative DHFR exons and, therefore, alter target gene expression (described in Figure 3a middle).

[0154] Inclusion of an alternative DHFR exon with the Con1 5' splice site sequence (DHFR_Con15ss; SEQ ID NO.: 49) abolished luciferase expression compared to Con 1 ( Figure 3c , DHFR_Con15ss). A 15 base pair (bp) hairpin structure embedded in the entire sequence of 5′ss was engineered into DHFR_Con 15ss to form DHFR_Con 15ss_HP15 (SEQ ID NO.: 54) ( Figure 3a ). The presence of the 15 bp hairpin completely restored luciferase expression to Con 1 levels, indicating that the hairpin has eliminated accessibility to the 5'ss and, thereby, the inclusion of the alternative DHFR exon. ( Figure 3c , Con 1, DHFR_Con15ss and DHFR_Con15ss_HP15)

[0155] In contrast, the 15 bp hairpin with a “disrupted stem” ( Figure 3b , Con15ss_15HPx; SEQ ID NO.: 55) could not restore luciferase expression ( Figure 3c , DHFR_Con15ss_HP15x), indicating that the intact stem is an important component of RNA secondary structure in regulating the accessibility of the 5′ splice site and thereby determining the inclusion or exclusion of alternative exons.

[0156] The same experiment was performed using a construct containing a DHFR exon with a mutant SRp40 binding site with increased splicing efficiency (DHFR_wtmtSRp40, see Example 2). Insertion of the 5'ss hairpin restored luciferase expression, whereas disruption of the hairpin blocked luciferase expression ( Figure 3c , DHFR_wtmtSRp40, DHFR_wtmtSRp40_HP15 and DHFR_wtmtSRp40_HP15x).

[0157] Therefore, embedding the 5'ss of the alternative exon into a hairpin structure can restore target gene expression by blocking the accessibility of the 5'ss and thereby preventing the incorporation of the alternative exon into mRNA and allowing target gene protein expression, forming a gene expression platform in which target gene protein expression can be regulated by altering the accessibility of the 5'ss of the exogenous alternative exon through the secondary RNA structure.

[0158] The construct DHFR_wtmtSRp40 (SEQ ID NO.: 58) (hereinafter referred to as "mtDHFR") was used for further riboswitch development.

[0159] Example 4. Use of theophylline aptamers to regulate target gene expression through alternative splicing.

[0160] Experimental Procedure

[0161] The DHFR-receptor vector was constructed to facilitate the cloning of aptamer sequences attached to hairpin stems with different lengths. The theophylline aptamer sequence used was: ggcgatacCAGCCGAAAGGCCCTTGgcagcgtc (SEQ ID NO: 9). Theophylline aptamer oligonucleotides ("oligos") with a 4-nucleotide overhang at the 5' end were synthesized (IDT), annealed and ligated to the BsaI-digested DHFR-receptor vector. HEK 293 cells were transfected with a luciferase reporter gene construct with a regulatory cassette containing theophylline aptamer as described in Example 1. Four hours after transfection, the culture medium was aspirated and new culture medium with or without 3 mM theophylline was added, and luciferase was analyzed 20 to 24 hours after theophylline treatment. The fold induction is expressed as the quotient of the luciferase activity obtained in the presence of the aptamer ligand divided by the value obtained in the absence of the aptamer ligand. Luciferase activity levels are expressed as a percentage of the luciferase activity level produced by the Con1 construct without the IVS2Δ intron in the CDS of the luciferase gene (referred to as maximal expression).

[0162] result

[0163] In order to regulate the accessibility of the 5' splice site of the alternative exon containing the stop codon, and thereby regulate the target gene protein expression, the aptamer sequence is attached to the stem of the hairpin structure embedded in the intron portion of the DHFR 5'ss and its complementary sequence. In this configuration, the insertion of the aptamer sequence disrupts the formation of the hairpin stem, making the DHFR 5'ss accessible, thereby causing the inclusion of the alternative DHFR exon and preventing the target gene protein expression ( Figure 4a ). When aptamer / ligand binding occurs, e.g. Figure 4b As depicted in , the conformational change of the aptamer triggered by ligand binding brings the DHFR 5′ss and its complementary sequence together to obtain a stable stem formation, thereby burying the DHFR 5′ss and leading to DHFR exon exclusion and target gene protein expression.

[0164] By directly linking the lower stem of theophylline aptamer to the hairpin stem ( Figure 4c , DHFR_Theol) to test theophylline aptamer. If the stem is too long, it can form a stable structure in the absence of aptamer / ligand binding, and if the stem is too short, it may not form a stable stem even in the presence of ligand. Therefore, it is necessary to optimize the length of the stem so that a stable secondary structure is only formed when aptamer / ligand binds. In order to determine the optimal stem length that allows the stem to form in the presence, rather than the absence, of the ligand, a number of constructs were prepared in which theophylline aptamer was cloned into mtDHFR (described in Example 2, Table 2), and the stem was continuously shortened. Figure 4c Four constructs resulting from this serial truncation are shown.

[0165] Figure 4d Luciferase expression from this deletion series of constructs in the presence and absence of theophylline is shown. In constructs Theo 1 to Theo 12, where the stem length was reduced from 20 bp to 9 bp, the stem length was sufficient to form a stable secondary structure even in the absence of aptamer / ligand binding. Thus, luciferase expression at levels similar to Con1 was observed in both the absence and presence of theophylline.

[0166] In the case of construct DHFR_Theo13, luciferase expression was suppressed in the absence of theophylline. This indicates the availability of mtDHFR exon 5'ss, thereby causing the inclusion of selectivity DHFR exon and the inhibition of gene expression. However, in the presence of theophylline, luciferase expression is turned on, causing 43 times of induction compared to the expression level in the absence of theophylline, and accounting for about 56% of the luciferase level expressed by the Con1 control vector. Therefore, a mammalian on-riboswitch is produced, which turns on the target gene protein expression in the presence of the aptamer ligand theophylline.

[0167] Example 5. Using the xpt guanine aptamer to regulate target gene expression via alternative splicing.

[0168] Experimental Procedure

[0169] The riboswitch was constructed using an Xpt-guanine aptamer with the following sequence: cactcatataatCGCGTGGATATGGCACGCAAGTTTCTACCGGGCACCGTAAATGTCcgactatgggtg (SEQ ID NO.: 10). Oligonucleotides containing the guanine aptamer sequence and a hairpin stem with a 4-nucleotide 5′ overhang were synthesized (IDT), annealed and then ligated to a BsaI-digested DHFR-receptor vector. HEK293 cells were transfected as described in Example 1. At four hours after transfection, the culture medium was aspirated and new culture medium with or without 500 μM guanine was added. Luciferase expression was analyzed 20 to 24 h after guanine treatment as described in Examples 1 and 4. HepG2, AML12, RD and C2C12 (ATCC) were cultured using the protocol recommended by ATCC. The intron-exon-intron cassette containing the xpt-G17 riboswitch (SEQ ID NO.: 15) was inserted into the leader peptide sequence of the anti-KDR antibody gene and into the StuI site in the mouse erythropoietin gene using the Gibson cloning strategy (NEB). Constructs containing mouse erythropoietin (Epo) or anti-KDR antibodies were transfected into HEK 293 cells. Four hours after transfection, the culture medium was aspirated and new culture medium with or without 500 μM guanine was added. The supernatant was subjected to ELISA analysis for the production of anti-KDR antibodies or the production of mouse Epo (R&D Systems).

[0170] result

[0171] By attaching the xpt-guanine aptamer derived from Bacillus subtilis to the hairpin stem ( Figure 5a , DHFR_G1) to study the use of additional aptamers / ligands to control target gene expression through aptamer-mediated regulation of alternative splicing. Similar to Example 4, 18 constructs ( Figure 5a and 5b DHFR-G1 to G18, also known as the regulatory cassette containing xpt-G1 to G18), to obtain the optimal length of the hairpin stem to which the guanine aptamer is attached, thereby allowing the aptamer / ligand binding to be linked to 5'ss accessibility and exon splicing. Figure 5bIn the case of constructs DHFR-G1 to G13 where stem length is reduced to 12bp from 24bp, luciferase expression is not affected by the insertion of selective DHFR exons and the xpt-guanine aptamer in the presence or absence of the aptamer ligand guanine. This shows that the length of the stem is enough to form a stable structure in the absence of and in the presence of a ligand, thereby preventing selective exons from being included in mRNA. However, in constructs DHFR_G14 to DHFR_G18, luciferase expression is suppressed in the absence of added guanine. When μM guanine is added, luciferase expression from these constructs is induced ( Figure 5b ).

[0172] Further rigorous validation of constructs G11 to G18 after guanine treatment again confirmed significant regulation of luciferase expression ( Figure 5c ). The construct DHFR_G17 (SEQ ID NO.: 15) containing xpt-G17 ( Figure 5a ) gave a 2000-fold induction of expression, resulting in approximately 65% ​​of the luciferase level expressed by Con1 (referred to as maximal expression). This high dynamic range of induction is caused by activation of expression compared to the extremely low uninduced baseline level in the absence of ligand. Construct DHFR_G16 ( Figure 5a ) gave approximately 800-fold induction compared to uninduced baseline expression, reaching a level of 83% of maximal expression ( Figure 5c and 5d ). In addition, constructs DHFR_G14 and G15 showed nearly 100% maximal expression with lower fold induction, which was attributed to the higher uninduced baseline expression of luciferase.

[0173] To test the general functionality and applicability of synthetic riboswitches in intron-exon-intron cassettes, we transfected multiple human and mouse cell lines with an xpt-G17-containing construct (DHFR_G17). In these different cell lines, guanine treatment produced a significant induction of gene expression, more than 500-fold in HepG2 cells and lower fold induction in other cell lines ( Figure 5e ). The different fold inductions in different cell lines may reflect differences in transfection efficiency and in the expression patterns of cell type-specific splicing regulators. In addition, a luciferase gene (DHFR_G17) with a regulatory cassette containing the xpt-G17 riboswitch produced similar levels of induction when transferred to an AAV backbone ( Figure 5f ), indicating that the gene regulatory effect is not vector backbone-dependent.

[0174] In addition to regulating the luciferase gene, the xpt-G17-containing cassette was also tested in regulating secreted proteins, anti-KDR antibodies, and erythropoietin (Epo). The xpt-G17-containing cassette was inserted into the coding sequences of the anti-KDR antibody and erythropoietin. Figure 5g and 5h As shown in , guanine treatment produced an 80-fold induction in the anti-KDR antibody preparation and a 140-fold induction in the Epo preparation when compared to production of each molecule by cells in the absence of ligand.

[0175] These results demonstrate the general functionality and applicability of potential therapeutic target genes in regulating protein expression, as well as the application of this gene regulatory cassette in AAV-mediated gene delivery. Thus, we generated synthetic mammalian "on"-riboswitches that are able to turn on target gene protein expression in response to the presence of aptamer-specific ligands in mammalian cells.

[0176] Example 6. Different purine aptamers can be used to regulate target gene expression via alternative splicing.

[0177] Experimental Procedure

[0178] The riboswitches were constructed using the following aptamer sequences listed in Table 3:

[0179] Table 3.

[0180]

[0181] result

[0182] To test additional aptamers in our gene regulation system, we used the same strategy and method as described in the previous example to generate multiple guanine- and adenine-responsive riboswitches by ligating different guanine and adenine aptamers to the intron-mtDHFR-intron cassette ( Figure 6a The tested guanine riboswitch efficiently regulates the expression of the luciferase gene in response to guanine ( Figure 6b In addition, we found that these guanine riboswitches not only respond to guanine ( Figure 6b ) but also in response to guanosine ( Figure 6c ) and 2' deoxyguanosine to regulate the expression of target genes (2'dG)( Figure 6d ).

[0183] Many adenine riboswitches have been generated ( Figure 6a ), and also exhibits gene regulatory functions ( Figure 6e ).

[0184] Differences in regulating gene expression among the tested constructs containing different aptamers may reflect differences in aptamer / ligand binding affinity and aptamer secondary structure, which may affect 5'ss accessibility, selective exon incorporation and thus target gene expression. Intron-exon-intron gene regulatory cassettes can be optimized by altering the aptamer sequence to achieve the desired level of gene regulation.

[0185] Example 7. On / off state of target gene expression regulated by a mammalian guanine riboswitch.

[0186] Experimental Procedure

[0187] The intron-mtDHFR-aptamer-intron cassette was PCR amplified and cloned into the pEGFP-C1 vector using the Golden Gate cloning strategy (NEB). To obtain a cell line that stably expresses EGFP using a riboswitch, HEK-293 cells were electroporated with 20 ng of plasmid DNA. Four to eight hours after electroporation, cell cultures were selected for 2 weeks with 800 μg / ml of G418 to obtain cells that stably express the cassette. Cells were trypsinized and the cell suspension was subjected to flow cytometric analysis of GFP fluorescence intensity using a Guava EasyCyte 8HT machine. The resulting data were analyzed using GuavaSoft 2.2.2.

[0188] result

[0189] To further demonstrate that the expression of a target gene containing our intron-exon-intron regulatory cassette can be regulated by exposure to a ligand specific for the aptamer contained within the riboswitch, an intron-mtDHFR-intron cassette containing the xpt-G17 riboswitch (SEQ ID NO.: 15) was inserted into the EGFP gene and stably transfected into HEK 293 cells. In the presence of guanine, EGFP expression is turned on ( Figure 7a ). Fluorescence was detected as early as 6 hours after guanine treatment and increased over 3 days of guanine treatment, reaching nearly 300-fold induction compared to untreated cells ( Figure 7b ), indicating the "on" state of target gene expression in the presence of aptamer ligands. When guanine is withdrawn from the cell culture medium, EGFP expression decreases, indicating the "off" state of target gene expression in the absence of aptamer-specific ligands ( Figure 7b ). Thus, we have developed a gene regulation platform comprising an intron-exon-intron cassette containing a synthetic riboswitch by which the expression of a target gene is regulated in mammalian cells by the presence or absence of a specific aptamer ligand.

[0190] Example 8. Effect of multiple regulatory boxes on regulating target gene expression.

[0191] Experimental Procedure

[0192] Constructs were prepared using the Golden Gate cloning strategy (NEB). HEK 293 cells were transfected with the indicated constructs and treated with 500 μM guanine or 1 mM guanosine (Sigma) for 4 h post-transfection. Luciferase activity was analyzed as described in Example 5.

[0193] result

[0194] A construct (DHFR_G15; Example 5) with a regulatory cassette containing xpt-G15 (SEQ ID NO.: 46) exhibited a 60-fold induction of luciferase expression in response to guanine treatment compared to uninduced basal expression levels and reached nearly 100% of the luciferase level expressed by Con 1 ( Figure 8a ). This is a useful feature when high levels of regulation of a therapeutic protein are required.

[0195] In contrast, the construct with the xpt-G17 regulatory cassette (DHFR_G17) had a significantly higher fold induction of 2181-fold, which was attributed to lower baseline expression without induction, but significantly lower maximal expression levels after induction compared to Con1 ( Figure 8a ).

[0196] To test whether two copies of the xpt-G15-containing regulatory cassette (xpt-G15 double; SEQ ID NO.: 64) can reduce the basal expression level without compromising the maximum expression level of luciferase after induction, two copies of the xpt-G15-containing regulatory cassette were inserted into the luciferase gene, with each copy located at a different position in the gene sequence. When two copies of the xpt-G15-containing regulatory cassette were present, the baseline expression was not induced to decrease, resulting in significantly higher induction folds (60-fold to 1008-fold) without compromising the maximum expression level ( Figure 8a ).

[0197] The guanine EC50 of the xpt-G15 double cassette (xpt-G15 double; SEQ ID NO.: 64) was 5-fold lower than the guanine EC50 of the construct containing a single copy of the more stringent xpt-G17 cassette (43 μM compared to 206 μM), thereby increasing the sensitivity of the ligand response ( Figure 8a ).

[0198] The strategy of using two copies of a less stringent regulatory cassette to enhance fold induction and maximum induction of gene expression is also applicable to the EGFP gene. Figure 8b and 8c As shown in the results of luciferase regulation ( Figure 8a), the EGFP gene containing a single copy of the xpt-G15 regulatory cassette (EGFP-xpt-G15) produced a higher uninduced baseline EGFP expression level when compared to the construct containing the xpt-G17 regulatory cassette (EGFP-xpt-G17). However, when two copies of the xpt-G15 regulatory cassette were inserted into the EGFP gene at different positions (EGFP-xpt-G15 double), the uninduced baseline expression level was reduced to the uninduced baseline expression level of EGFP-xpt-G17, and the induced EGFP level was even higher than the Con1-EGFP control ( Figure 8c ).

[0199] In addition, one copy of the xpt-G17-containing cassette and one copy of the Ydhl-A5 adenine riboswitch-containing cassette were inserted into the luciferase gene. Luciferase expression was induced by the addition of adenine alone (25-fold) or guanine alone (120-fold), however, significantly higher levels of induction (up to 2966-fold) were achieved with the combination of adenine and guanine at the highest concentrations used for each ( Figure 8d ). These results confirm the modularity of alternative splicing-based riboswitches in regulating target gene expression.

[0200] To reduce recombination and increase the ease of generating viral vectors containing two or more regulatory cassettes, regulatory cassettes with different intron and exon sequences can be used in a single target gene, and these regulatory cassettes can contain the same or different ligand-responsive aptamers.

[0201] Example 9. Effect of intron size and sequence on regulation of target gene expression via aptamer-mediated alternative splicing.

[0202] Experimental Procedure

[0203] The Con1 construct was used as a template for PCR amplification of intronic fragments with either upstream or downstream intronic deletions. To generate constructs with single intronic deletions, the PCR products were cloned into constructs containing the xpt-G17 riboswitch using the Golden Gate cloning strategy (NEB). To generate constructs with both upstream and downstream intronic deletions, fragments released by EcoRI and BamHI from constructs with a single deletion in the downstream intronic sequence were cloned into EcoRI and BamHI digested constructs with a single deletion in the upstream intronic sequence.

[0204] result

[0205] Introns contain elements that may promote (intronic splicing enhancers, ISEs) or inhibit (intronic splicing suppressors, ISSs) exon splicing. Of all the riboswitches we have generated, xpt-G17 showed the best regulatory capacity in terms of both fold induction and induced gene expression levels. Using the xpt-G17 riboswitch in an intron-exon-intron cassette, we performed a series of modifications in intron sequence and intron length as well as splice sites to further optimize the system.

[0206] First, by inserting a cleavage site in the intronic sequence upstream or downstream of the mtDHFR exon ( Figure 9a , 9b ) were used to test the effects of intronic modification by introducing a single deletion, generating 16 constructs xpt-G17-IR-1 to xpt-G17-IR-16 with xpt-G17 riboswitches (the sequences of 13 of these constructs are given in Table 5, SEQ ID NO: 16-SEQ ID NO: 28). Fig.9c As depicted in , upstream and downstream intron deletions were combined to create larger intron deletions. Figure 9d and 9e As shown in, 16 constructs with two intron deletions (2IR) were prepared, and constructs 2IR-1 to 2IR-10 (SEQ ID NO.: 29-SEQ ID NO.: 38) showed significantly higher fold induction without compromising the induced luciferase expression level, with 2IR-3 having the greatest improvement in fold induction (4744-fold). In addition, we also prepared constructs with a mutated 3′ss upstream of the mtDHFR exon, and also reduced the size of the downstream intron. As Figure 9d and 9e As shown in (constructs DHFR_3ssC_1 to 5), these modifications further improved the relative fold induction, however, in this case a decrease in the induced expression level was observed (from 64% to 32% for 3ssC_3).

[0207] These results suggest that the gene regulatory capacity of the intron-exon-aptamer-intron cassette can be optimized to achieve desired levels of gene regulation by modifying the intron sequences flanking the alternative exons.

[0208] Example 10. Using multiple natural exons and synthetic exons in gene regulatory cassettes.

[0209] Experimental Procedure

[0210] The sequences of mutant human Wilms tumor 1 exon 5 (mutWT1-e5, SEQ ID NO.: 61), SIRT1 exon 6 (SIRT1-e6, SEQ ID NO.: 62), mouse calcium / calmodulin-dependent protein kinase II delta exon 16 or 17 (Camk2d-e16 or e17, SEQ ID NO.: 59, SEQ ID NO.: 60), and synthetic exon ENEEE (SEQ ID NO.: 63) were synthesized (IDT) and cloned into the DHFR-G17 vector using the Gibson cloning kit (NEB) instead of the DHFR exon. Plasmid DNA was transfected into HEK 293 cells, treated with 500 μM guanine, and luciferase assays were performed as described in Example 1. The sequence of each exon with 5′ and 3′ splice sites is shown, and the exon sequence is shown in uppercase letters (Table 5, SEQ ID NO.: 59 to SEQ ID NO.: 63).

[0211] result

[0212] In order to determine that the regulatory function of four intron-exon-aptamer-intron boxes is not limited to specific exon sequences, we replace the mtDHFR exon in the construct (DHFR-xpt-G17) containing guanine xpt-G17 riboswitch with a plurality of different natural and mutant exons and synthetic exons containing known exon splicing enhancer sequences (ESE). As shown in Figure 10, the regulatory box with CamkIId-e16 exon produces almost equivalent multiple induction compared with DHFR-xpt-G17, but the level of basal and induced luciferase expression is lower. The box containing other exons also shows variable levels of basal and induced luciferase expression. Therefore, the alternative splicing gene regulatory box mediated by aptamer is not exon-specific, and is not limited to mDHFR-e2 exon.

[0213] Exons that can generate highly efficient alternative splicing events are suitable for aptamer-mediated gene regulatory cassettes. These results further indicate that the gene regulatory capacity of this intron-exon-aptamer-intron cassette can be optimized by modifying the splicing strength of the sequences in the alternative exons and the surrounding intron sequences, such as the 5'ss and 3'ss sequences of the alternative exons as described herein, and the ESE and ESS sequences in the alternative exons.

[0214] Example 11. Regulation of target gene expression by aptamer-mediated alternative splicing in vivo in mice.

[0215] Experimental Procedure

[0216] Hydrodynamic DNA delivery and drug treatment: 6-7 week old CD-1 female mice were injected with 5 μg or 10 μg of endotoxin-free plasmid DNA (Qiagen Endotoxin-free Kit) diluted in saline via the tail vein at a volume of 10% of body weight for 5 to 10 seconds. The plasmid DNA contained two copies of the luciferase gene containing the xpt-G15 regulatory cassette (xpt-G15 double, SEQ ID NO.: 64; Example 8, Figure 8a Guanosine (Sigma) was freshly suspended in water containing 0.5% methylcellulose / 0.25% Tween 80 (Sigma) and administered orally at 2h and 12h after DNA injection or delivered by intraperitoneal injection (IP) at 5h, 12h, 16h and 24h after DNA delivery.

[0217] Non-invasive live animal bioluminescence imaging: Prior to imaging, mice were anesthetized with 2% isoflurane and injected with 150 gm luciferin per kg volume, and images were acquired at the indicated time points after DNA injection using a Bruker Xtreme system within 2 to 5 minutes after luciferin injection. Luciferase activity was expressed as mean photons / second ± standard deviation. Fold induction was calculated as the quotient of the mean photons / second obtained in mice treated with guanosine divided by the value obtained in mice not treated with guanosine.

[0218] result

[0219] We evaluated the gene regulatory function of the intron-exon-intron regulatory cassette in vivo in mice. Endotoxin-free plasmid DNA containing two copies of the xpt-G15 riboswitch construct in the luciferase gene (xpt-G15 bi) was delivered to the liver of mice by hydrodynamic injection, and guanosine was administered intraperitoneally. We tested two guanosine delivery routes. In one experiment ( Fig.11a and 11b ), mice were orally administered different doses of guanosine at 2h and 12h after DNA delivery and then imaged. Fig.11a As shown in , mice treated with guanosine showed higher luciferase expression at 9 hours after DNA. Luciferase expression increased over time in guanosine-treated mice, reaching the highest level at 48 hours after DNA injection, after which expression decreased.

[0220] In a separate experiment ( Fig.11c and Fig.11d), guanosine was administered intraperitoneally. At 4 hours after DNA injection (PI), and after guanosine treatment, mice in each group showed similar levels of basal luciferase activity (Figure 11). Then, mice were treated with vehicle as a control or treated with guanosine. At 11 hours after DNA injection, luciferase activity increased in all mice, which is consistent with reports that luciferase gene expression peaked in the liver 12 hours after hydrodynamic DNA injection. However, compared with untreated mice, in mice treated with guanosine, there was a significantly higher level of luciferase expression, with 4.7-fold and 16.2-fold induction observed in the case of 100mg / kg and 300mg / kg guanosine, respectively, compared with uninduced baseline expression.

[0221] Thus, the splicing-based gene regulatory cassette was demonstrated to regulate gene expression in animals in vivo in response to administration of a ligand specific for the aptamer contained within the regulatory cassette in a dose-dependent manner.

[0222] Example 12. Delivery of riboswitch constructs to murine retina via adeno-associated virus (AAV) vectors.

[0223] Experimental Procedure

[0224] AAV plasmid constructs: Two riboswitch expression constructs (described in the table below) were adapted via molecular cloning into a format capable of being packaged into an AAV genome.

[0225] Table 4.

[0226]

[0227] The expression construct based on the EGFP transgene (GTX 5-7) was digested with restriction enzymes MfeI and NheI to release an approximately 1400 bp DNA fragment containing the riboswitch inducible element and the EGFP transgene. The pD10 AAV genome plasmid was also digested with MfeI and NheI to release a 4475 bp fragment containing the AAV ITR, CMV promoter, and SV40 polyadenylation signal. The two fragments were connected using T4 DNA ligase to generate a plasmid containing a sequence with the following structure that can be packaged as an AAV2 genome:

[0228] [ITR]-[CMV]-[5'EGFP]-[Riboswitch element]-[3'EGFP]-[SV40]-[ITR]

[0229] All resulting plasmid constructs were verified by DNA sequencing and named according to the following convention: pD10-GTX#.

[0230] AAV vector preparation and titration: Adeno-associated virus (AAV) was produced in vitro by transiently transfecting HEK-293T cells with the three plasmids.

[0231] (i) Viral genome plasmid based on pD10 backbone

[0232] (ii) AAV packaging plasmid containing the AAV2 Rep78 gene and viral capsid genes. Many different serotypes of AAV can be produced by changing the capsid gene sequence, and in this case, the AAV8 capsid is used.

[0233] (iii) Helper plasmid (pHGTI-Adeno1). This plasmid provides a near-minimal set of adenoviral genes required for AAV packaging and assembly.

[0234] These plasmids were transfected into HEK-293T cells at a ratio of 1:1:3, with 150 cm cells per 80-90% confluent cell. 2 A total of 50 μg of plasmid DNA was transfected on the plate. A typical preparation operation consisted of 20 such plates. The transfection reagent used was polyethyleneimine (PEI) with a PEI to DNA ratio of 2.25:1 (w / w). Seventy-two hours after transfection, the cells were physically detached from the plate and precipitated by centrifugation; the resulting cell pellet was resuspended in 20 mL of TRIS density buffer. The pellet was then lysed by repeated freeze / thaw / vortex cycles, and any unpackaged DNA remaining in the lysate was destroyed by nuclease digestion. The lysate was then clarified by dead-end filtration and centrifugation and then diluted to a total volume of 50 mL.

[0235] The clarified lysate was then purified using AVB columns (both from GE Healthcare) on an AKTA Pure instrument running according to a pre-programmed protocol via an affinity-based FPLC program. The final AAV containing the eluate from the FPLC column was concentrated down to a volume of about 200 μL by centrifugation at 5000 x g in a Vivaspin 4 centrifugal concentrator (GE Healthcare) with a 10,000 MW cutoff, 2 mL of PBS-MK (to dilute out the high salt elution buffer), and the eluate was re-concentrated back to about 200 μL using the same concentrator. This material constituted the purified AAV virus and was appropriately aliquoted and stored at -80°C.

[0236] Vector titer was determined using qPCR (targeting the SV40 polyadenylation signal) performed directly on samples of purified vector. The resulting cycle thresholds were compared to a known standard curve and the number of vector genomes per ml was calculated.

[0237] Riboswitch AAV vectors are named according to the following convention: AAV2 / [capsid serotype #]-GTX#

[0238] Murine subretinal injections: Under general anesthesia, mice were injected with a manually guided 10 mm 34 gauge needle mounted on a 5 μL Hamilton syringe, injecting the vector into the subretinal space. The needle tip was guided to the injection site by viewing the retina through an operating microscope. In all eyes receiving vector, two 2 μL injections were performed, one in the upper hemisphere of the eye and the other in the lower hemisphere. After injection, the mass of the resulting retinal detachment and any reflux of the injected material were recorded.

[0239] Fundus fluorescence photography: After subretinal injection, EGFP transgene expression was regularly assessed by fundus photography using a slit lamp (SC-16, Keeler) with a Leica DC500 digital camera. The animals were placed under general anesthesia and their pupils were dilated with 1% topical tropicamide. The corneal refractive power was neutralized by placing a cover slip on the cornea covered with a coupling medium solution (Viscotears). Under bright white light, the instrument was adjusted and the animals were positioned so that the retina was in sharp focus and the optic disc was in the center of the field of view, and then bright field images were acquired using a 200ms exposure time. Transgenic (EGFP) fluorescence was evaluated by filtering the light source (475±25nm) and acquiring two more images at 10 and 30s exposure.

[0240] result

[0241] As shown by DNA sequencing of the ligation product, the riboswitch construct (Table 4) was successfully cloned into a form that can be packaged into an AAV genome. In the resulting construct, pd10-GTX7 and pd10-GTX5 were further prepared into AAV2 / 8 viral vectors. The prepared vectors were confirmed by qPCR to have the following titers:

[0242] AAV2 / 8-GTX7: 1.17x10 13 Vector genomes / mL

[0243] AAV2 / 8-GTX5: 1.73x10 13 Vector genomes / mL

[0244] The two vectors were then injected subretinally and left for 8 days for EGFP transgene expression, after which expression was assessed by fluorescent fundus photography. Fig.12EGFP was demonstrated to be expressed in the retina injected with AAV2 / 8-GTX7. Transgene expression was low, but basal expression of AAV2 / 8-GTX7 would be expected only after induction of alternative splicing via aptamer-mediated in response to ligand (not added).

[0245] Example 13. Regulation of target gene expression by regulatory cassette-mediated alternative splicing in vivo following AAV delivery in the murine retina.

[0246] program

[0247] Quantification of fluorescent fundus photography (EGFP signal): All manipulations and analyses of images were performed using the GNU image manipulation program (GIMP, open source). As described above, three images of each retina were acquired at each imaging point: white light (200ms), 475±25nm (10s), and 475±25nm (30s). The three images were first superimposed in layers, and the region of interest (ROI) was defined to cover the entire retina visible through the pupil using the white light image as a guide. The threshold tool was used for the two 475±25nm (EGFP fluorescence) images to highlight only those pixels whose intensity values ​​exceeded the defined threshold. The threshold was selected based on determining that the EGFP signal was clearly separated from the background and provided an appropriate dynamic range for the analysis. The number of pixels exceeding the threshold within the ROI was recorded for each image. In order to correct for variable pupil dilation that causes changes in the visible retinal area between eyes, the number of pixels exceeding the threshold was divided by the total number of pixels within the ROI.

[0248] Induction: Riboswitch-mediated induction of target gene expression was performed via two routes of administration as described below:

[0249] Intraperitoneal injection (IP): A volume of 100 μL of [75 mg / ml guanosine + water containing 0.5% w / v methylcellulose + 0.25% v / v Tween 80] was injected into the intraperitoneal cavity using a 13 mm 30 gauge needle. This is equivalent to a guanosine dose of 300 mg / kg in an adult mouse weighing 25 g.

[0250] Intravitreal injection (I-Vit.): A 2 μL volume of [1 mM guanosine + PBS-MK containing 2.5% DMSO] was injected intravitreally using a 10 mm 34-gauge needle guided manually. The needle tip was positioned below the lens and just above the optic disc, guided to this position by observing the retina through an operating microscope.

[0251] result

[0252] On Day 00, a total of 9 eyes were injected subretinal as described in Example 12 as follows:

[0253] - 6 eyes using AAV2 / 8-GTX7 (EGFP transgene expression from CMV promoter regulated by G15 riboswitch element)

[0254] - 3 eyes using AAV2 / 8-GTX5 (positive control construct, unregulated EGFP transgene expression from the CMV promoter)

[0255] Fluorescent fundus photography was performed as described in Example 12 on days 02, 08, 09, 10, and 12.

[0256] All eyes received induction via intraperitoneal injection after fluorescent fundus photography on days 08, 09, and 10. All eyes received induction via intravitreal injection on day 11. Fluorescent signals were quantified as described above, and exemplary images are shown in Fig.13a Shown in.

[0257] No induction was performed during the first 8 days after vector injection, as it is known that gene expression caused by AAV2 / 8 takes up to 7 days to reach maximum. Therefore, the expression level on day 8 was used as the pre-induction baseline. Fig.13c and Fig.13a As shown in (L vs. N), after 2 rounds of intraperitoneal induction on day 10 after vector injection, transgene expression had increased approximately 3.5-fold compared to this baseline (P≤0.05, one-way ANOVA, Donald's).

[0258] like Fig.13c and Fig.13a As shown in (L vs. O), at day 12 after vector injection, 24 h after intravitreal induction and 48 h after the last intraperitoneal induction, transgene expression had increased approximately 9-fold compared to baseline (P≤0.001, one-way ANOVA, Donald's). This much greater induction after intravitreal induction suggests (but does not definitively indicate) that this induction route may be more efficient than intraperitoneal injection.

[0259] Fig.13b Higher resolution images showing the difference in EGFP transgene expression before and after induction are shown in .

[0260] Over the same time period and under the same induction regimen, the level of EGFP expression mediated by the unregulated control vector AAV2 / 8-GTX5 did not change significantly (one-way ANOVA, Bonferroni). Fig.13d Due to the large difference in expression levels mediated by GTX7 and GTX5, different exposure times (30 s and 10 s, respectively) and thresholds (50 and 190, respectively) were required for each image set.

[0261] The data clearly demonstrate that transgene expression caused by the G15-based GTX7 construct is regulated via aptamer-mediated alternative splicing in the murine retina. The maximal transgene expression level induced by GTX7 was lower than that mediated by the non-inducible positive control construct GTX5.

[0262] Table 5. Descriptions and related sequences. Unless otherwise indicated, exon sequences are shown in uppercase letters and intron sequences are shown in lowercase letters.

[0263]

[0264]

[0265]

[0266]

[0267]

[0268]

[0269]

[0270]

[0271]

[0272]

[0273]

[0274]

[0275]

[0276] Sequence Listing <110> Meiragtx Limited <120> Regulation of gene expression through aptamer-mediated modulation of alternative splicing <130> 162027.46176 <140> PCT / US2016 / 016234 <141> 2016-02-02 <150> US 62 / 110,919 <151> 2015-02-02 <160> 64 <170> PatentIn Version 3.5 <210> 1 <211> 539 <212> DNA <213> Artificial sequence <220> <223> The Luci-IVSΔ-Luci construct in Con1 contains a deleted human β-globin intron 2 ("IVS2∆") shown in lowercase, while the flanking luciferase sequence is shown in uppercase. <400> 1 gaggttccat ctgccaggta tcagggtgag tctatgggac ccttgatgtt ttctttcccc 60 ttcttttcta tggttaagtt catgtcatag gaaggggaga agtaacaggg tacacatatt 120 gaccaaatca gggtaatttt gcatttgtaa ttttaaaaaa tgctttcttc ttttaatata 180 cttttttgtt tatcttattt ctaatacttt ccctaatctc tttctttcag ggcaataatg 240 atacaatgta tcatgcctct ttgcaccatt ctaaagaata acagtgataa tttctgggtt 300 aaggcaatag caatatttct gcatataaat atttctgcat ataaattgta actgatgtaa 360 gaggtttcat attgctaata gcagctacaa tccagctacc attctgcttt tattttatgg 420 ttgggataag gctggattat tctgagtcca agctaggccc ttttgctaat catgttcata 480 cctcttatct tcctcccaca gcaaggatat gggctcactg agactacatc agctattct 539 <210> 2 <211> 521 <212> DNA <213> Artificial Sequence <220> <223> Luci-IVSΔ-Luci in Construct Con2 <400> 2 gattacaccc gagggggatg ataaagtaag cctatgggac ccttgatgtt ttctttcccc 60 ttcttttcta tggttaagtt catgtcatag gaaggggaga agtaacaggg tacacatatt 120 gaccaaatca gggtaatttt gcatttgtaa ttttaaaaaa tgctttcttc ttttaatata 180 cttttttgtt tatcttattt ctaatacttt ccctaatctc tttctttcag ggcaataatg 240 atacaatgta tcatgcctct ttgcaccatt ctaaagaata acagtgataa tttctgggtt 300 aaggcaatag caatatttct gcatataaat atttctgcat ataaattgta actgatgtaa 360 gaggtttcat attgctaata gcagctacaa tccagctacc attctgcttt tattttatgg 420 ttgggataag gctggattat tctgagtcca agctaggccc ttttgctaat catgttcata 480 cctcttatct tcctcccaca gccgggcgcg gtcggtaaag t 521 <210> 3 <211> 510 <212> DNA <213> Artificial Sequence <220> <223> Luci-IVSΔ-Luci in construct Con3 <400> 3 ttcttcgcca aaagcagtaa gtctatggga cccttgatgt tttctttccc cttcttttct 60 atggttaagt tcatgtcata ggaaggggag aagtaacagg gtacacatat tgaccaaatc 120 agggtaattt tgcatttgta attttaaaaa atgctttctt cttttaatat acttttttgt 180 ttatcttatt tctaatactt tccctaatct ctttctttca gggcaataat gatacaatgt 240 atcatgcctc tttgcaccat tctaaagaat aacagtgata atttctgggt taaggcaata 300 gcaatatttc tgcatataaa tatttctgca tataaattgt aactgatgta agaggtttca 360 tattgctaat agcagctaca atccagctac cattctgctt ttattttatg gttgggataa 420 ggctggatta ttctgagtcc aagctaggcc cttttgctaa tcatgttcat acctcttatc 480 ttcctcccac agctctgatt gacaaatacg 510 <210> 4 <211> 517 <212> DNA <213> Artificial Sequence <220> <223> Luci-IVSΔ-Luci in construct Con4 <400> 4 aagagctgtt tctgaggagg tgtggctatg ggacccttga tgttttcttt ccccttcttt 60 aagagctgtt tctgaggagg tgtggctatg ggacccttga tgttttcttt ccccttcttt 60 tctatggtta agttcatgtc ataggaaggg gagaagtaac agggtacaca tattgaccaa 120 tctatggtta agttcatgtc ataggaaggg gagaagtaac agggtacaca tattgaccaa 120 atcagggtaa ttttgcattt gtaattttaa aaaatgcttt cttcttttaa tatacttttt 180 atcagggtaa ttttgcattt gtaattttaa aaaatgcttt cttcttttaa tatacttttt 180 tgtttatctt atttctaata ctttccctaa tctctttctt tcagggcaat aatgatacaa 240 tgtttatctt atttctaata ctttccctaa tctctttctt tcagggcaat aatgatacaa 240 tgtatcatgc ctctttgcac cattctaaag aataacagtg ataatttctg ggttaaggca 300 tgtatcatgc ctctttgcac cattctaaag aataacagtg ataatttctg ggttaaggca 300 atagcaatat ttctgcatat aaatatttct gcatataaat tgtaactgat gtaagaggtt 360 atagcaatat ttctgcatat aaatatttct gcatataaat tgtaactgat gtaagaggtt 360 tcatattgct aatagcagct acaatccagc taccattctg cttttatttt atggttggga 420 tcatattgct aatagcagct acaatccagc taccattctg cttttatttt atggttggga 420 taaggctgga ttattctgag tccaagctag gcccttttgc taatcatgtt catacctctt 480 taaggctgga ttattctgag tccaagctag gcccttttgc taatcatgtt catacctctt 480 atcttcctcc cacagccttc aggattacaa gattcaa 517 atcttcctcc cacagccttc aggattacaa gattcaa 517 <210> 5<210> 5 <211> 519<211> 519 <212> DNA<212> DNA <213> Artificial sequence<213> Artificial sequence <220><220> <223> Luci-IVSΔ-Luci in construct Con5 <223> Luci-IVSΔ-Luci in construct Con5 <400> 5 <400> 5 catctgccag gtatcagggt gagtctatgg gacccttgat gttttctttc cccttctttt 60 catctgccag gtatcagggt gagtctatgg gacccttgat gttttctttc cccttctttt 60 ctatggttaa gttcatgtca taggaagggg agaagtaaca gggtacacat attgaccaaa 120 tcagggtaat tttgcatttg taattttaaa aaatgctttc ttcttttaat atactttttt 180 gtttatctta tttctaatac tttccctaat ctctttcttt cagggcaata atgatacaat 240 gtatcatgcc tctttgcacc attctaaaga ataacagtga taatttctgg gttaaggcaa 300 tagcaatatt tctgcatata aatatttctg catataaatt gtaactgatg taagaggttt 360 catattgcta atagcagcta caatccagct accattctgc ttttatttta tggttgggat 420 aaggctggat tattctgagt ccaagctagg cccttttgct aatcatgttc atacccttta 480 cttctatgac tgtagcaagg atatgggctc actgagact 519 <210> 6 <211> 521 <212> DNA <213> Artificial sequence <220> <223> Luci-IVSΔ-Luci in construct Con6 <400> 6 tccatctgcc aggtatcagg gtgagtctat gggacccttg atgttttctt tccccttctt 60 ttctatggtt aagttcatgt cataggaagg ggagaagtaa cagggtacac atattgacca 120 aatcagggta attttgcatt tgtaatttta aaaaatgctt tcttctttta atatactttt 180 ttgtttatct tatttctaat actttcccta atctctttct ttcagggcaa taatgataca 240 atgtatcatg cctctttgca ccattctaaa gaataacagt gataatttct gggttaaggc 300 aatagcaata tttctgcata taaatatttc tgcatataaa ttgtaactga tgtaagaggt 360 ttcatattgc taatagcagc tacaatccag ctaccattct gcttttattt tatggttggg 420 ataaggctgg attattctga gtccaagcta ggcccttttg ctaatcatgt tcataccgtg 480 actgtgtgta tgcacagcaa ggatatgggc tcactgagac t 521 <210> 7 <211> 518 <212> DNA <213> Artificial sequence <220> <223> Luci-IVSΔ-Luci in construct Con7 <400> 7 atctgccagg tatcagggtg agtctatggg acccttgatg ttttctttcc ccttcttttc 60 tatggttaag ttcatgtcat aggaagggga gaagtaacag ggtacacata ttgaccaaat 120 cagggtaatt ttgcatttgt aattttaaaa aatgctttct tcttttaata tacttttttg 180 tttatcttat ttctaatact ttccctaatc tctttctttc agggcaataa tgatacaatg 240 tatcatgcct ctttgcacca ttctaaagaa taacagtgat aatttctggg ttaaggcaat 300 agcaatattt ctgcatataa atatttctgc atataaattg taactgatgt aagaggtttc 360 atattgctaa tagcagctac aatccagcta ccattctgct tttattttat ggttgggata 420 aggctggatt attctgagtc caagctaggc ccttttgcta atcatgttca taccattgtg 480 atcgcagcca atagcaagga tatgggctca ctgagact 518 <210> 8 <211> 85 <212> DNA <213> Artificial sequence <220> <223> DHFR exon 2 with flanking intronic sequences <400> 8 gagtaacgct gtttctctaa cttgtaggaa tgaattcaga tatttccaga gaatgaccac 60 aacctcttca gtagaaggta atgtg 85 <210> 9 <211> 33 <212> DNA <213> Artificial sequence <220> <223> Theophylline Aptamer <400> 9 ggcgatacca gccgaaaggc ccttggcagc gtc 33 <210> 10 <211> 69 <212> DNA <213> Artificial sequence <220> <223> Xpt-guanine aptamer <400> 10 cactcatata atcgcgtgga tatggcacgc aagtttctac cgggcaccgt aaatgtccga 60 ctatgggtg 69 <210> 11 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Ydhl-guanine aptamer <400> 11 ttgtataacc tcaataatat ggtttgaggg tgtctaccag gaaccgtaaa atcctgacta 60 caa 63 <210> 12 <211> 63 <212> DNA <213> Artificial sequence <220> <223> Ydhl-adenine aptamer <400> 12 ttgtataacc tcaataatat ggtttgaggg tgtctaccag gaaccgtaaa atcctgatta 60 caa 63 <210> 13 <211> 63 <212> DNA <213> Artificial sequence <220> <223> addA-guanine aptamer <400> 13 tcatataatc ctaatgatat ggtttgggag tttctaccaa gagccttaaa ctcttgacta 60 tga 63 <210> 14 <211> 63 <212> DNA <213> Artificial sequence <220> <223> addA-adenine aptamer <400> 14 tcatataatc ctaatgatat ggtttgggag tttctaccaa gagccttaaa ctcttgatta 60 tga 63 <210> 15 <211> 617 <212> DNA <213> Artificial sequence <220> <223> XPT-G17 Riboswitch <400> 15 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtacac atattgacca aatcagggta attttgcatt 120 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 180 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 240 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 300 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 360 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 420 caatagcaat atttctgcat ataaatattt ctgcatataa attgtaactg atgtaagagg 480 tttcatattg ctaatagcag ctacaatcca gctaccattc tgcttttatt ttatggttgg 540 gataaggctg gattattctg agtccaagct aggccctttt gctaatcatg ttcatacctc 600 ttatcttcct cccacag 617 <210> 16 <211> 557 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-IR-1 <400> 16 gtgagtctat gggacccttg atgttttctt tccctgctca aatcagggta attttgcatt 60 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 120 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 180 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 240 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 300 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 360 caatagcaat atttctgcat ataaatattt ctgcatataa attgtaactg atgtaagagg 420 tttcatattg ctaatagcag ctacaatcca gctaccattc tgcttttatt ttatggttgg 480 gataaggctg gattattctg agtccaagct aggccctttt gctaatcatg ttcatacctc 540 ttatcttcct cccacag 557 <210> 17 <211> 457 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-IR-2 <400> 17 gtgagtctat gggacccttg atgttttctt tccctgctct ttcagggcaa taatgataca 60 atgtatcatg ccgagtaacg ctgtttctct aacttgtagg aatgaattca gatatttcca 120 gagaatgaaa aaaaaatctt cagtagaagg taatgtataa tcgcgtggat atggcacgca 180 agtttctacc gggcaccgta aatgtccgac tacattacgc accattctaa agaataacag 240 tgataatttc tgggttaagg caatagcaat atttctgcat ataaatattt ctgcatataa 300 attgtaactg atgtaagagg tttcatattg ctaatagcag ctacaatcca gctaccattc 360 tgcttttatt ttatggttgg gataaggctg gattattctg agtccaagct aggccctttt 420 gctaatcatg ttcatacctc ttatcttcct cccacag 457 <210> 18 <211> 582 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-IR-3 <400> 18 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 gctcaaatca gggtaatttt gcatttgtaa ttttaaaaaa tgctttcttc ttttaatata 120 cttttttgtt tatcttattt ctaatacttt ccctaatctc tttctttcag ggcaataatg 180 atacaatgta tcatgccgag taacgctgtt tctctaactt gtaggaatga attcagatat 240 ttccagagaa tgaaaaaaaa atcttcagta gaaggtaatg tataatcgcg tggatatggc 300 acgcaagttt ctaccgggca ccgtaaatgt ccgactacat tacgcaccat tctaaagaat 360 aacagtgata atttctgggt taaggcaata gcaatatttc tgcatataaa tatttctgca 420 tataaattgt aactgatgta agaggtttca tattgctaat agcagctaca atccagctac 480 cattctgctt ttattttatg gttgggataa ggctggatta ttctgagtcc aagctaggcc 540 cttttgctaa tcatgttcat acctcttatc ttcctcccac ag 582 <210> 19 <211> 482 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-IR-4 <400> 19 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 gctctttcag ggcaataatg atacaatgta tcatgccgag taacgctgtt tctctaactt 120 gtaggaatga attcagatat ttccagagaa tgaaaaaaaa atcttcagta gaaggtaatg 180 tataatcgcg tggatatggc acgcaagttt ctaccgggca ccgtaaatgt ccgactacat 240 tacgcaccat tctaaagaat aacagtgata atttctgggt taaggcaata gcaatatttc 300 tgcatataaa tatttctgca tataaattgt aactgatgta agaggtttca tattgctaat 360 agcagctaca atccagctac cattctgctt ttattttatg gttgggataa ggctggatta 420 ttctgagtcc aagctaggcc cttttgctaa tcatgttcat acctcttatc ttcctcccac 480 ag 482 <210> 20 <211> 611 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-IR-5 <400> 20 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtactg ctcaaatcag ggtaattttg catttgtaat 120 tttaaaaaat gctttcttct tttaatatac ttttttgttt atcttatttc taatactttc 180 cctaatctct ttctttcagg gcaataatga tacaatgtat catgccgagt aacgctgttt 240 ctctaacttg taggaatgaa ttcagatatt tccagagaat gaaaaaaaaa tcttcagtag 300 aaggtaatgt ataatcgcgt ggatatggca cgcaagtttc taccgggcac cgtaaatgtc 360 cgactacatt acgcaccatt ctaaagaata acagtgataa tttctgggtt aaggcaatag 420 caatatttct gcatataaat atttctgcat ataaattgta actgatgtaa gaggtttcat 480 attgctaata gcagctacaa tccagctacc attctgcttt tattttatgg ttgggataag 540 gctggattat tctgagtcca agctaggccc ttttgctaat catgttcata cctcttatct 600 tcctcccaca g 611 <210> 21 <211> 511 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-IR-6 <400> 21 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtactg ctctttcagg gcaataatga tacaatgtat 120 cataggaagg ggagaagtaa cagggtactg ctctttcagg gcaataatga tacaatgtat 120 catgccgagt aacgctgttt ctctaacttg taggaatgaa ttcagatatt tccagagaat 180 catgccgagt aacgctgttt ctctaacttg taggaatgaa ttcagatatt tccagagaat 180 gaaaaaaaaa tcttcagtag aaggtaatgt ataatcgcgt ggatatggca cgcaagtttc 240 gaaaaaaaaa tcttcagtag aaggtaatgt ataatcgcgt ggatatggca cgcaagtttc 240 taccgggcac cgtaaatgtc cgactacatt acgcaccatt ctaaagaata acagtgataa 300 taccgggcac cgtaaatgtc cgactacatt acgcaccatt ctaaagaata acagtgataa 300 tttctgggtt aaggcaatag caatatttct gcatataaat atttctgcat ataaattgta 360 tttctgggtt aaggcaatag caatatttct gcatataaat atttctgcat ataaattgta 360 actgatgtaa gaggtttcat attgctaata gcagctacaa tccagctacc attctgcttt 420 actgatgtaa gaggtttcat attgctaata gcagctacaa tccagctacc attctgcttt 420 tattttatgg ttgggataag gctggattat tctgagtcca agctaggccc ttttgctaat 480 tattttatgg ttgggataag gctggattat tctgagtcca agctaggccc ttttgctaat 480 catgttcata cctcttatct tcctcccaca g 511 catgttcata cctcttatct tcctcccaca g 511 <210> 22<210> 22 <211> 592<211> 592 <212> DNA<212> DNA <213> 人工序列<213> Artificial sequence <220><220> <223> xpt-G17-IR-7 <223> xpt-G17-IR-7 <400> 22 <400> 22 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagt gctcaaatca gggtaatttt gcatttgtaa ttttaaaaaa tgctttcttc 120 ttttaatata cttttttgtt tatcttattt ctaatacttt ccctaatctc tttctttcag 180 ggcaataatg atacaatgta tcatgccgag taacgctgtt tctctaactt gtaggaatga 240 attcagatat ttccagagaa tgaaaaaaaa atcttcagta gaaggtaatg tataatcgcg 300 tggatatggc acgcaagttt ctaccgggca ccgtaaatgt ccgactacat tacgcaccat 360 tctaaagaat aacagtgata atttctgggt taaggcaata gcaatatttc tgcatataaa 420 tatttctgca tataaattgt aactgatgta agaggtttca tattgctaat agcagctaca 480 atccagctac cattctgctt ttattttatg gttgggataa ggctggatta ttctgagtcc 540 aagctaggcc cttttgctaa tcatgttcat acctcttatc ttcctcccac ag 592 <210> 23 <211> 492 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-IR-8 <400> 23 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagt gctctttcag ggcaataatg atacaatgta tcatgccgag taacgctgtt 120 tctctaactt gtaggaatga attcagatat ttccagagaa tgaaaaaaaa atcttcagta 180 gaaggtaatg tataatcgcg tggatatggc acgcaagttt ctaccgggca ccgtaaatgt 240 ccgactacat tacgcaccat tctaaagaat aacagtgata atttctgggt taaggcaata 300 gcaatatttc tgcatataaa tatttctgca tataaattgt aactgatgta agaggtttca 360 tattgctaat agcagctaca atccagctac cattctgctt ttattttatg gttgggataa 420 ggctggatta ttctgagtcc aagctaggcc cttttgctaa tcatgttcat acctcttatc 480 ttcctcccac ag 492 <210> 24 <211> 502 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-IR-9 <400> 24 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtacac atattgacca aatcagggta attttgcatt 120 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 180 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 240 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 300 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 360 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 420 caatagctgc tgctggatta ttctgagtcc aagctaggcc cttttgctaa tcatgttcat 480 acctcttatc ttcctcccac ag 502 <210> 25 <211> 587 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-IR-10 <400> 25 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtacac atattgacca aatcagggta attttgcatt 120 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 180 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 240 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 300 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 360 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 420 caatagcaat atttctgcat ataaatattt ctgcatataa attgtaactg atgtaagagg 480 tttcatattg ctaatagcag ctacaatcca gctgctgctg gattattctg agtccaagct 540 aggccctttt gctaatcatg ttcatacctc ttatcttcct cccacag 587 <210> 26 <211> 572 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-IR-11 <400> 26 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtacac atattgacca aatcagggta attttgcatt 120 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 180 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 240 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 300 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 360 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 420 caatagctgc tgaggtttca tattgctaat agcagctaca atccagctac cattctgctt 480 ttattttatg gttgggataa ggctggatta ttctgagtcc aagctaggcc cttttgctaa 540 tcatgttcat acctcttatc ttcctcccac ag 572 <210> 27 <211> 537 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-IR-13 <400> 27 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtacac atattgacca aatcagggta attttgcatt 120 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 180 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 240 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 300 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 360 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 420 caatagctgc tctaccattc tgcttttatt ttatggttgg gataaggctg gattattctg 480 agtccaagct aggccctttt gctaatcatg ttcatacctc ttatcttcct cccacag 537 <210> 28 <211> 552 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-IR-15 <400> 28 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtacac atattgacca aatcagggta attttgcatt 120 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 180 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 240 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 300 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 360 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 420 caatagctgc tgcagctaca atccagctac cattctgctt ttattttatg gttgggataa 480 ggctggatta ttctgagtcc aagctaggcc cttttgctaa tcatgttcat acctcttatc 540 ttcctcccac ag 552 <210> 29 <211> 442 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-2IR-1 <400> 29 gtgagtctat gggacccttg atgttttctt tccctgctca aatcagggta attttgcatt 60 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 120 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 180 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 240 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 300 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 360 caatagctgc tgctggatta ttctgagtcc aagctaggcc cttttgctaa tcatgttcat 420 acctcttatc ttcctcccac ag 442 <210> 30 <211> 527 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-2IR-2 <400> 30 gtgagtctat gggacccttg atgttttctt tccctgctca aatcagggta attttgcatt 60 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 120 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 180 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 240 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 300 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 360 caatagcaat atttctgcat ataaatattt ctgcatataa attgtaactg atgtaagagg 420 tttcatattg ctaatagcag ctacaatcca gctgctgctg gattattctg agtccaagct 480 aggccctttt gctaatcatg ttcatacctc ttatcttcct cccacag 527 <210> 31 <211> 512 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-2IR-3 <400> 31 gtgagtctat gggacccttg atgttttctt tccctgctca aatcagggta attttgcatt 60 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 120 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 180 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 240 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 300 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 360 caatagctgc tgaggtttca tattgctaat agcagctaca atccagctac cattctgctt 420 ttattttatg gttgggataa ggctggatta ttctgagtcc aagctaggcc cttttgctaa 480 tcatgttcat acctcttatc ttcctcccac ag 512 <210> 32 <211> 477 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-2IR-4 <400> 32 gtgagtctat gggacccttg atgttttctt tccctgctca aatcagggta attttgcatt 60 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 120 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 180 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 240 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 300 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 360 caatagctgc tctaccattc tgcttttatt ttatggttgg gataaggctg gattattctg 420 agtccaagct aggccctttt gctaatcatg ttcatacctc ttatcttcct cccacag 477 <210> 33 <211> 492 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-2IR-5 <400> 33 gtgagtctat gggacccttg atgttttctt tccctgctca aatcagggta attttgcatt 60 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 120 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 180 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 240 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 300 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 360 caatagctgc tgcagctaca atccagctac cattctgctt ttattttatg gttgggataa 420 ggctggatta ttctgagtcc aagctaggcc cttttgctaa tcatgttcat acctcttatc 480 ttcctcccac ag 492 <210> 34 <211> 467 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-2IR-6 <400> 34 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 gctcaaatca gggtaatttt gcatttgtaa ttttaaaaaa tgctttcttc ttttaatata 120 cttttttgtt tatcttattt ctaatacttt ccctaatctc tttctttcag ggcaataatg 180 atacaatgta tcatgccgag taacgctgtt tctctaactt gtaggaatga attcagatat 240 ttccagagaa tgaaaaaaaa atcttcagta gaaggtaatg tataatcgcg tggatatggc 300 acgcaagttt ctaccgggca ccgtaaatgt ccgactacat tacgcaccat tctaaagaat 360 aacagtgata atttctgggt taaggcaata gctgctgctg gattattctg agtccaagct 420 aggccctttt gctaatcatg ttcatacctc ttatcttcct cccacag 467 <210> 35 <211> 552 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-2IR-7 <400> 35 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 gctcaaatca gggtaatttt gcatttgtaa ttttaaaaaa tgctttcttc ttttaatata 120 cttttttgtt tatcttattt ctaatacttt ccctaatctc tttctttcag ggcaataatg 180 atacaatgta tcatgccgag taacgctgtt tctctaactt gtaggaatga attcagatat 240 ttccagagaa tgaaaaaaaa atcttcagta gaaggtaatg tataatcgcg tggatatggc 300 acgcaagttt ctaccgggca ccgtaaatgt ccgactacat tacgcaccat tctaaagaat 360 aacagtgata atttctgggt taaggcaata gcaatatttc tgcatataaa tatttctgca 420 tataaattgt aactgatgta agaggtttca tattgctaat agcagctaca atccagctgc 480 tgctggatta ttctgagtcc aagctaggcc cttttgctaa tcatgttcat acctcttatc 540 ttcctcccac ag 552 <210> 36 <211> 537 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-2IR-8 <400> 36 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 gctcaaatca gggtaatttt gcatttgtaa ttttaaaaaa tgctttcttc ttttaatata 120 cttttttgtt tatcttattt ctaatacttt ccctaatctc tttctttcag ggcaataatg 180 atacaatgta tcatgccgag taacgctgtt tctctaactt gtaggaatga attcagatat 240 ttccagagaa tgaaaaaaaa atcttcagta gaaggtaatg tataatcgcg tggatatggc 300 acgcaagttt ctaccgggca ccgtaaatgt ccgactacat tacgcaccat tctaaagaat 360 aacagtgata atttctgggt taaggcaata gctgctgagg tttcatattg ctaatagcag 420 ctacaatcca gctaccattc tgcttttatt ttatggttgg gataaggctg gattattctg 480 agtccaagct aggccctttt gctaatcatg ttcatacctc ttatcttcct cccacag 537 <210> 37 <211> 502 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-2IR-9 <400> 37 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 gctcaaatca gggtaatttt gcatttgtaa ttttaaaaaa tgctttcttc ttttaatata 120 cttttttgtt tatcttattt ctaatacttt ccctaatctc tttctttcag ggcaataatg 180 atacaatgta tcatgccgag taacgctgtt tctctaactt gtaggaatga attcagatat 240 ttccagagaa tgaaaaaaaa atcttcagta gaaggtaatg tataatcgcg tggatatggc 300 acgcaagttt ctaccgggca ccgtaaatgt ccgactacat tacgcaccat tctaaagaat 360 aacagtgata atttctgggt taaggcaata gctgctctac cattctgctt ttattttatg 420 gttgggataa ggctggatta ttctgagtcc aagctaggcc cttttgctaa tcatgttcat 480 acctcttatc ttcctcccac ag 502 <210> 38 <211> 517 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-2IR-10 <400> 38 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 gctcaaatca gggtaatttt gcatttgtaa ttttaaaaaa tgctttcttc ttttaatata 120 cttttttgtt tatcttattt ctaatacttt ccctaatctc tttctttcag ggcaataatg 180 atacaatgta tcatgccgag taacgctgtt tctctaactt gtaggaatga attcagatat 240 ttccagagaa tgaaaaaaaa atcttcagta gaaggtaatg tataatcgcg tggatatggc 300 acgcaagttt ctaccgggca ccgtaaatgt ccgactacat tacgcaccat tctaaagaat 360 aacagtgata atttctgggt taaggcaata gctgctgcag ctacaatcca gctaccattc 420 tgcttttatt ttatggttgg gataaggctg gattattctg agtccaagct aggccctttt 480 gctaatcatg ttcatacctc ttatcttcct cccacag 517 <210> 39 <211> 342 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-2IR-11 <400> 39 gtgagtctat gggacccttg atgttttctt tccctgctct ttcagggcaa taatgataca 60 atgtatcatg ccgagtaacg ctgtttctct aacttgtagg aatgaattca gatatttcca 120 gagaatgaaa aaaaaatctt cagtagaagg taatgtataa tcgcgtggat atggcacgca 180 agtttctacc gggcaccgta aatgtccgac tacattacgc accattctaa agaataacag 240 tgataatttc tgggttaagg caatagctgc tgctggatta ttctgagtcc aagctaggcc 300 cttttgctaa tcatgttcat acctcttatc ttcctcccac ag 342 <210> 40 <211> 377 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-2IR-12 <400> 40 gtgagtctat gggacccttg atgttttctt tccctgctct ttcagggcaa taatgataca 60 atgtatcatg ccgagtaacg ctgtttctct aacttgtagg aatgaattca gatatttcca 120 gagaatgaaa aaaaaatctt cagtagaagg taatgtataa tcgcgtggat atggcacgca 180 agtttctacc gggcaccgta aatgtccgac tacattacgc accattctaa agaataacag 240 tgataatttc tgggttaagg caatagctgc tctaccattc tgcttttatt ttatggttgg 300 gataaggctg gattattctg agtccaagct aggccctttt gctaatcatg ttcatacctc 360 ttatcttcct cccacag 377 <210> 41 <211> 367 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-2IR-13 <400> 41 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 gctctttcag ggcaataatg atacaatgta tcatgccgag taacgctgtt tctctaactt 120 gtaggaatga attcagatat ttccagagaa tgaaaaaaaa atcttcagta gaaggtaatg 180 tataatcgcg tggatatggc acgcaagttt ctaccgggca ccgtaaatgt ccgactacat 240 tacgcaccat tctaaagaat aacagtgata atttctgggt taaggcaata gctgctgctg 300 gattattctg agtccaagct aggccctttt gctaatcatg ttcatacctc ttatcttcct 360 cccacag 367 <210> 42 <211> 402 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-2IR-14 <400> 42 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 gctctttcag ggcaataatg atacaatgta tcatgccgag taacgctgtt tctctaactt 120 gtaggaatga attcagatat ttccagagaa tgaaaaaaaa atcttcagta gaaggtaatg 180 tataatcgcg tggatatggc acgcaagttt ctaccgggca ccgtaaatgt ccgactacat 240 tacgcaccat tctaaagaat aacagtgata atttctgggt taaggcaata gctgctctac 300 cattctgctt ttattttatg gttgggataa ggctggatta ttctgagtcc aagctaggcc 360 cttttgctaa tcatgttcat acctcttatc ttcctcccac ag 402 <210> 43 <211> 396 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-2IR-15 <400> 43 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtactg ctctttcagg gcaataatga tacaatgtat 120 catgccgagt aacgctgttt ctctaacttg taggaatgaa ttcagatatt tccagagaat 180 gaaaaaaaaa tcttcagtag aaggtaatgt ataatcgcgt ggatatggca cgcaagtttc 240 taccgggcac cgtaaatgtc cgactacatt acgcaccatt ctaaagaata acagtgataa 300 tttctgggtt aaggcaatag ctgctgctgg attattctga gtccaagcta ggcccttttg 360 ctaatcatgt tcatacctct tatcttcctc ccacag 396 <210> 44 <211> 431 <212> DNA <213> Artificial Sequence <220> <223> xpt-G17-2IR-16 <400> 44 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtactg ctctttcagg gcaataatga tacaatgtat 120 catgccgagt aacgctgttt ctctaacttg taggaatgaa ttcagatatt tccagagaat 180 gaaaaaaaaa tcttcagtag aaggtaatgt ataatcgcgt ggatatggca cgcaagtttc 240 taccgggcac cgtaaatgtc cgactacatt acgcaccatt ctaaagaata acagtgataa 300 tttctgggtt aaggcaatag ctgctctacc attctgcttt tattttatgg ttgggataag 360 gctggattat tctgagtcca agctaggccc ttttgctaat catgttcata cctcttatct 420 tcctcccaca g 431 <210> 45 <211> 617 <212> DNA <213> Artificial sequence <220> <223> xpt-G17-3ssC-1 <400> 45 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtacac atattgacca aatcagggta attttgcatt 120 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 180 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 240 ctgtttctct aacttccccg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 300 cagtagaagg taatgtataa tcgcgtggat atggcacgca agtttctacc gggcaccgta 360 aatgtccgac tacattacgc accattctaa agaataacag tgataatttc tgggttaagg 420 caatagcaat atttctgcat ataaatattt ctgcatataa attgtaactg atgtaagagg 480 tttcatattg ctaatagcag ctacaatcca gctaccattc tgcttttatt ttatggttgg 540 gataaggctg gattattctg agtccaagct aggccctttt gctaatcatg ttcatacctc 600 ttatcttcct cccacag 617 <210> 46 <211> 621 <212> DNA <213> Artificial sequence <220> <223> xpt - G15 riboswitch <400> 46 gtgagtctat gggacccttg atgttttctt tccccttctt ttctatggtt aagttcatgt 60 cataggaagg ggagaagtaa cagggtacac atattgacca aatcagggta attttgcatt 120 tgtaatttta aaaaatgctt tcttctttta atatactttt ttgtttatct tatttctaat 180 actttcccta atctctttct ttcagggcaa taatgataca atgtatcatg ccgagtaacg 240 ctgtttctct aacttgtagg aatgaattca gatatttcca gagaatgaaa aaaaaatctt 300 cagtagaagg taatgtgtat aatcgcgtgg atatggcacg caagtttcta ccgggcaccg 360 taaatgtccg actacacatt acgcaccatt ctaaagaata acagtgataa tttctgggtt 420 aaggcaatag caatatttct gcatataaat atttctgcat ataaattgta actgatgtaa 480 gaggtttcat attgctaata gcagctacaa tccagctacc attctgcttt tattttatgg 540 ttgggataag gctggattat tctgagtcca agctaggccc ttttgctaat catgttcata 600 cctcttatct tcctcccaca g 621 <210> 47 <211> 85 <212> DNA <213> Artificial sequence <220> <223> DHFR wild type 5' single strand <400> 47 gagtaacgct gtttctctaa cttgtaggaa tgaattcaga tatttccaga gaatgaccac 60 aacctcttca gtagaaggta atgtg 85 <210> 48 <211> 85 <212> DNA <213> Artificial sequence <220> <223> DHFR 5' ssC <400> 48 gagtaacgct gtttctctaa cttgtaggaa tgaattcaga tatttccaga gaatgaccac 60 aacctcttca gtagaagccc ctgtg 85 <210> 49 <211> 85 <212> DNA <213> Artificial sequence <220> <223> DHFR-Con1 5' ss <400> 49 gagtaacgct gtttctctaa cttgtaggaa tgaattcaga tatttccaga gaatgaccac 60 aacctcttca gtagagggtg agttg 85 <210> 50 <211> 85 <212> DNA <213> Artificial sequence <220> <223> DHFR-Con4 5' ss <400> 50 gagtaacgct gtttctctaa cttgtaggaa tgaattcaga tatttccaga gaatgaccac 60 aacctcttca gtaggaggtg tggtg 85 <210> 51 <211> 85 <212> DNA <213> Artificial sequence <220> <223> DHFR wild-type mtSRp40 <400> 51 gagtaacgct gtttctctaa cttgtaggaa tgaattcaga tatttccaga gaatgaaaaa 60 aaaatcttca gtagaaggta atgtg 85 <210> 52 <211> 85 <212> DNA <213> Artificial sequence <220> <223> DHFR wild type strong SC35 <400> 52 gagtaacgct gtttctctaa cttgtaggaa tggcccctga tatttccaga gaatgaccac 60 aacctcttca gtagaaggta atgtg <210> 53 <211> 85 <212> DNA <213> The snowstorm <220> <223> DHFR activator SC35hnRNPA1 <400> 53 gagtaacgct gtttctctaa cttgtaggaa tgtagggaga tatttccaga gaatgaccac aacctcttca gtagaaggta atgtg <210> 54 <211> 106 <212> DNA <213> The snowstorm <220> <223> DHFR-Con1 5′ HP15 <400> 54 gagtaacgct gtttctctaa cttgtaggaa tgaattcaga tatttccaga gaatgaccac aacctcttca gtaggggtg agttggcgaa agccaactca ccctct <210> 55 <211> 106 <212> DNA <213> The snowstorm <220> <223> DHFR-Con1 5′ HP15x <400> 55 gagtaacgct gtttctctaa cttgtaggaa tgaattcaga tatttccaga gaatgaccac aacctcttca gtaggggtg agttggcgaa aaacagcata aagtat <210> 56 <211> 106 <212> DNA <213> Artificial sequence <220> <223> DHFR wild-type mtSRp40 HP15 <400> 56 gagtaacgct gtttctctaa cttgtaggaa tgaattcaga tatttccaga gaatgaaaaa 60 aaaatcttca gtagaaggta atgtggcgaa agccacatta ccttct 106 <210> 57 <211> 106 <212> DNA <213> Artificial sequence <220> <223> DHFR wild-type mtSRp40 HP15X <400> 57 gagtaacgct gtttctctaa cttgtaggaa tgaattcaga tatttccaga gaatgaaaaa 60 aaaatcttca gtagaaggta atgtggcgaa aaacagaact gagtat 106 <210> 58 <211> 84 <212> DNA <213> Artificial sequence <220> <223> Mutant DHFR-e2 (mtDHFR) <400> 58 gagtaacgct gtttctctaa cttgtaggaa tgaattcaga tatttccaga gaatgaaaaa 60 aaaatcttca gtagaaggta atgt 84 <210> 59 <211> 77 <212> DNA <213> Artificial sequence <220> <223> Camk2d-e16 <400> 59 gagtaacgct gtttctctaa cttgtagtga gccccaaact actgtaatcc acaaccctga 60 cggaaacaag gtaatgt 77 <210> 60 <211> 83 <212> DNA <213> Artificial sequence <220> <223> Camk2d-e17 <400> 60 gagtaacgct gtttctctaa cttgtaggag tcaactgaga gctcaaacac caccattgag 60 gatgaagacg tgaaaggtaa tgt 83 <210> 61 <211> 85 <212> DNA <213> Artificial sequence <220> <223> mutWT1-e5 <400> 61 gagtaacgct gtttctctaa cttgtagagt tgctgctgag agctccagct cagtgaaatg 60 gacagaaggg cagagcaagt aatgt 85 <210> 62 <211> 151 <212> DNA <213> Artificial sequence <220> <223> SIRT1-e6 <400> 62 tgtggtgtgt tcaagaaaca gaaatacttc tttaataaag catatatatg ttgtttgttt 60 ttaggttcct ttgcaacagc atcttgcctg atttgtaaat acaaagttga ctgtgaagct 120 gtacgaggag atatttttaa tcaggtaatg t 151 <210> 63 <211> 114 <212> DNA <213> Artificial sequence <220> <223> ENEEE synthetic exon <400> 63 gagtaacgct gtttctctaa cttgtagaca atcctcgaac caaacaacca aacaaccaaa 60 caatcctcga accaaacaat cctcgaacca aacaatcctc gaaccaagta atgt 114 <210> 64 <211> 1639 <212> DNA <213> Artificial sequence <220> <223> xpt-G15-dual <400> 64 gccaagaggt tccatctgcc aggtatcagg gtgagtctat gggacccttg atgttttctt 60 tccccttctt ttctatggtt aagttcatgt cataggaagg ggagaagtaa cagggtacac 120 atattgacca aatcagggta attttgcatt tgtaatttta aaaaatgctt tcttctttta 180 atatactttt ttgtttatct tatttctaat actttcccta atctctttct ttcagggcaa 240 taatgataca atgtatcatg ccgagtaacg ctgtttctct aacttgtagg aatgaattca 300 gatatttcca gagaatgaaa aaaaaatctt cagtagaagg taatgtgtat aatcgcgtgg atatggcacg caagtttcta ccgggcaccg taaatgtccg actacacatt acgcaccatt ctaaagaata acagtgataa tttctgggtt aaggcaatag caatattct gcatataaat atttctgcat ataaattgta actgatgtaa gaggtttcat attgctaata gcagctacaa tccagctacc attctgcttt tattttatgg ttgggataag gctggattat tctgagtcca agctaggccc ttttgctaat catgttcata cctcttatct tcctcccaca gcaaggatat 660 gggctcactg agactacatc agctattctg attackacccg agggggatga taaaccggggc 720 gcggtcggta aagttgttcc attttttga gcgaaggttg tggatctgga taccgggaa 780 acgctgggcg ttaatcaaag aggcgaactg tgtgtgagag gtcctatgat tatgtccggt 900. ttgtaaaca atccggaagc gaccaacgcc ttgattgaca aggatggatg gctacattct ggagacatag cttactggga cgaagacgaa cacttcttca tcgttgaccg cctgaagtct ctgattaagt acaaagggtg agtctatggg acccttgatg ttttctttcc ccttcttttc tatggttaag ttcatgtcat aggaagggga gaagtaacag ggtacacata ttgaccaaat 1080 cagggtaatt ttgcatttgt aattttaaaa aatgctttct tcttttaata tacttttttg 1140 tttatcttat ttctaatact ttccctaatc tctttctttc agggcaataa tgatacaatg 1200 tatcatgccg agtaacgctg tttctctaac ttgtaggaat gaattcagat atttccagag 1260 aatgaaaaaa aaatcttcag tagaaggtaa tgtgtataat cgcgtggata tggcacgcaa 1320 gtttctaccg ggcaccgtaa atgtccgact acacattacg caccattcta aagaataaca 1380 gtgataattt ctgggttaag gcaatagcaa tatttctgca tataaatatt tctgcatata 1440 aattgtaact gatgtaagag gtttcatatt gctaatagca gctacaatcc agctaccatt 1500 ctgcttttat tttatggttg ggataaggct ggattattct gagtccaagc taggcccttt 1560 tgctaatcat gttcatacct cttatcttcc tcccacagct atcaggtggc tcccgctgaa 1620 ttggaatcca tcttgctcc 1639

Claims

1. A polynucleotide box for regulating the expression of a target gene, the polynucleotide box comprising: a. Riboswitch; b. an alternatively spliced ​​exon flanked by a 5' intron and a 3' intron, wherein the riboswitch comprises (i) an effector region, the effector region comprising a stem, the stem comprising a 5′ splice site sequence of the 3′ intron; and (ii) an aptamer, wherein the effector region stem is 7 to 20 base pairs in length; wherein the 5′ splice site sequence of the 3′ intron comprises the sequence (i) GTAATG; (ii) GTRAGT, wherein R is A or G; (iii) GTAAGC; or (iv) GTGTGG; and The alternatively spliced ​​exon comprises a stop codon, and the stop codon is in frame with the target gene when the alternatively spliced ​​exon is spliced ​​into the target gene mRNA.

2. The polynucleotide cassette of claim 1, wherein the alternatively spliced ​​exon: a. Derived from: exon 2 of human dihydrofolate reductase gene, exon 5 of human Wilms tumor 1, exon 16 of mouse calcium / calmodulin-dependent protein kinase II delta, or exon 6 of SIRT1; or b. is synthetic.

3. The polynucleotide cassette of claim 1 or 2, wherein the alternatively spliced ​​exon has been modified by one or more of the group consisting of: changing the sequence of an exonic splicing enhancer, changing the sequence of an exonic splicing silencer, adding an exonic splicing enhancer, and adding an exonic splicing silencer.

4. The polynucleotide cassette of claim 1, wherein the alternatively spliced ​​exon comprises an exon sequence of any one of SEQ ID NO: 47, 49, 51, 52, 59, 61, 62, or 63.

5. The polynucleotide cassette of any one of claims 1, 2 or 4, wherein the 5' splice site sequence of the 3' intron comprises the sequence GTAATG.

6. The polynucleotide cassette of claim 1, 2 or 4, wherein the 5' splice site sequence of the 3' intron comprises the sequence (i) GTRAGT, wherein R is A or G; (ii) GTAAGC; or (iii) GTGTGG.

7. The polynucleotide cassette of claim 1, 2 or 4, wherein the 5' splice site sequence of the 3' intron comprises the sequence (i) GTRAGT, wherein R is A or G; or (ii) GTAATG.

8. The polynucleotide cassette of claim 1, 2 or 4, wherein the aptamer binds a small molecule ligand.

9. The polynucleotide cassette of claim 1, 2 or 4, wherein the 5' intron comprises a stop codon in frame with the target gene.

10. The polynucleotide cassette of claim 1, 2 or 4, wherein the 5' and 3' introns: a. derived from an endogenous intron from the target gene; b. exogenous to the target gene; or c. Derived from intron 2 of the human β-globin gene.

11. The polynucleotide cassette of claim 1, 2 or 4, wherein the 5' and 3' introns are each independently 50 to 300 nucleotides in length.

12. The polynucleotide cassette of claim 1, 2 or 4, wherein the 5' and 3' introns are each independently 125 to 240 nucleotides in length.

13. The polynucleotide cassette of claim 1, 2 or 4, wherein the effector region stem is 8 to 11 base pairs in length.

14. The polynucleotide cassette of claim 1, wherein the polynucleotide cassette comprises a sequence selected from the group consisting of SEQ ID NOs: 15, 16, 18, 20, 21, 22, 24-38, 45, and 46, wherein the aptamer sequence TAATCGCGTGGATATGGCACGCAAGTTTCTACCGGGCACCGTAAATGTCCGAC is replaced by a different aptamer sequence.

15. The polynucleotide cassette of claim 14, wherein the polynucleotide cassette comprises the sequence of SEQ ID NO: 15, wherein the aptamer sequence comprising TAATCGCGTGGATATGGCACGCAAGT TTCTACCGGGCACCGTAAATGTCCGAC is replaced by a different aptamer sequence.

16. The polynucleotide cassette of claim 14, wherein the polynucleotide cassette comprises the sequence of SEQ ID NO: 46, wherein the aptamer sequence comprising TAATCGCGTGGATATGGCACGCAAGT TTCTACCGGGCACCGTAAATGTCCGAC is replaced by a different aptamer sequence.

17. A recombinant polynucleotide comprising a target gene, wherein the target gene comprises the polynucleotide cassette of claim 1, 2, 4 or 14.

18. The recombinant polynucleotide of claim 17, wherein the polynucleotide cassette is located in a protein coding sequence of the target gene. A vector comprising the recombinant polynucleotide according to claim 17 .

20. The vector of claim 19, wherein the vector is a viral vector.

21. The vector of claim 20, wherein the viral vector is selected from the group consisting of an adenoviral vector, an adeno-associated viral vector, and a lentiviral vector.

22. The vector of claim 19, wherein the vector is a non-viral vector.

23. Use of the vector of claim 19 in the preparation of a drug for regulating the expression of a target gene by the following method, the method comprising: a. exposing cells to the vector; as well as b. exposing the cell to a small molecule ligand that specifically binds to the aptamer in an amount effective to induce expression of the target gene.

24. Use of the vector of claim 19 in the preparation of a medicament for regulating the expression of a target gene in the eye of a mammal by the following method, the method comprising: a. introducing the carrier into the eye; as well as b. providing a small molecule ligand to the mammal in an amount effective to induce expression of the target gene.

25. The use according to claim 23, wherein when the small molecule ligand is present, the expression of the target gene is more than 5 times or more than 10 times higher than the expression level when the small molecule ligand is not present.

26. The use of claim 23, wherein two or more of the polynucleotide cassettes are inserted into the target gene.

27. The use of claim 26, wherein the two or more polynucleotide cassettes comprise different aptamers that specifically bind to different small molecule ligands, or wherein the two or more polynucleotide cassettes comprise the same aptamer.

28. The use of claim 24, wherein the vector is introduced into the eye by intraocular injection.

Images