Molecular markers related to stage weight in sheep, their detection methods and applications

Abstract

The present invention provides a molecular marker related to the stage weight of sheep, a detection method and application thereof. The present invention performs PCR amplification and sequence analysis on the sheep GHR gene, and finds that there is an A / G polymorphic site at the 196th position of the sequence shown in SEQ ID NO.1 in the amplified fragment. The polymorphic sites of 375 Hu sheep, 31 Tan sheep and 82 Dorper sheep are further detected using KASPar primers and a least squares model is established. The genotype and the stage weight trait are analyzed, and it is finally determined that the GHR gene fragment amplified by the present invention can be used as a molecular marker related to the stage weight of sheep. The present invention can be used to select Hu sheep with AA homozygous genes to enter the core group as breeding sheep by detecting molecular markers, and the stage weight of sheep is measured, which helps to improve the efficiency of production.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular markers, and in particular relates to a GHR gene fragment as a molecular marker affecting the stage weight of sheep, a detection method and an application thereof. Background Art

[0002] Seed industry is the upstream core industry of animal husbandry and also the "chip" of animal husbandry. Breeding accounts for the highest proportion of the scientific and technological contribution of animal husbandry, reaching more than 40%. Performance measurement is the basis of breeding, and breeding without performance measurement is impractical. In the production practice of mutton sheep, stage weight reflects the ability of sheep to produce meat, so improving stage weight is of great significance to economy and production efficiency. For a long time, stage weight (Body weight, BW) has been an important economic indicator for measuring the production performance of mutton sheep. Studies have shown that stage weight has medium heritability (0.35-0.46), is genetically controlled and can be improved through selection (Zhu Bo, Li Jiao, Wang Congyong, Xu Lingyang, Chen Yan, Gao Xue, Zhang Lupei, Gao Huijiang, Li Junya. Estimation of genetic parameters of growth and development traits of Simmental cattle populations in my country and their genetic progress [J]. Journal of Animal Science and Veterinary Medicine, 2020, 51(08): 1833-1844.). However, there are few reports on candidate genes related to stage weight in sheep.

[0003] Growth hormone receptor (GHR) is a member of the cytokinin / hematopoietin receptor superfamily and consists of 9 introns and 10 exons. The GHR gene was first found in the hepatocytes of rabbits and later detected in cattle, sheep, mice and chickens (Ilkbahar, Ilkbahar, YN, et al., Expression and distribution of messenger ribonucleic acids for growth hormone (GH) receptor and GH-binding protein in mice during pregnancy. 1995, 386-392.). It encodes a specific membrane protein and affects the growth and development of the body by affecting the action of growth hormone (GH) (Tanaka, M., et al., Expression of aberrantly spliced ​​growth hormone receptor mRNA in the sex-linked dwarf chicken, Gifu 20. 1995, 218-223.). Growth hormone can effectively affect the generation and development of body muscle by accelerating the differentiation and development of muscle cells, thereby affecting its stage weight. Stage weight has medium heritability and is affected by many factors, such as basal metabolism, environment, feed efficiency, body activity, feed nutrition, etc. It is not clear whether the GHR gene has a relationship with stage weight in sheep and what the relationship is. Summary of the invention

[0004] In order to overcome the above-mentioned defects of the prior art, the present invention provides a molecular marker related to the stage weight of sheep, a detection method and application thereof. The molecular marker of the present invention is amplified from the sheep GHR gene, and its nucleotide sequence is shown in SEQ ID NO.1. By amplifying the DNA sequence of the sheep GHR gene and sequencing it, the polymorphic sites of the GHR gene are found, the correlation between different genotypes and the stage weight of sheep is analyzed, and a detection method containing polymorphic sites is established, and the molecular marker can be applied to the breeding of new high-yield and high-quality mutton sheep.

[0005] To achieve the above object, the present invention adopts the following technical solutions:

[0006] A molecular marker related to sheep stage weight, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at the 196 bp position represents A or G, and since the above sequence has an A / G mutation at the 196th base, it leads to the A / G polymorphism of the sheep GHR gene at this site.

[0007] The PCR primer pair used to detect the above molecular markers preferably includes an upstream primer and a downstream primer, and the nucleotide sequences of the upstream primer and the downstream primer are as shown in SEQ ID NO.2 and SEQ ID NO.3.

[0008] The KASPar primer pair for detecting the above-mentioned molecular markers includes a primer A1 for detecting AlleleA, a primer A2 for detecting AlleleG and a universal reverse primer. The nucleotide sequence of the primer A1 for detecting AlleleA is shown in SEQ ID NO.4, the nucleotide sequence of the primer A2 for detecting AlleleG is shown in SEQ ID NO.5, and the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.6.

[0009] A detection kit for detecting the above molecular markers, wherein the detection kit comprises a PCR primer pair or a KASPar primer pair for detecting the above molecular markers.

[0010] A method for detecting a molecular marker related to the stage weight of sheep, wherein the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at the 196 bp position represents A or G, and the method comprises using the above primer pair or kit to detect the genomic DNA of Hu sheep, and the specific detection method comprises the following steps:

[0011] a) using the above primer pair, KASPar primer pair or a kit comprising the above primer pair to amplify Hu sheep genomic DNA;

[0012] b) identifying the polymorphic sites of the amplified product obtained in step a).

[0013] Wherein, in step b), the above-mentioned typing and identification methods include but are not limited to direct sequencing method, gene chip method, probe method, and high-resolution melting curve method.

[0014] The KASPar method for detecting molecular markers related to sheep stage weight using the above primer pair comprises the following steps:

[0015] a) extracting genomic DNA from Hu sheep blood as a sample, and performing high-throughput water bath PCR amplification using primer pairs with nucleotide sequences such as SEQ ID NO.4, SEQ ID NO.5 and SEQ ID NO.6;

[0016] b) After amplification, use the BMG PHERAstar instrument to detect the fluorescence signal and view the typing results.

[0017] The molecular markers, primer pairs or kit detection methods described above are used in the detection of sheep stage weight. By detecting the molecular markers of the present invention in the genomic DNA of the sheep to be tested and analyzing the types of polymorphic sites, the stage weight of the sheep can be determined, and sheep with large stage weight can be screened out.

[0018] The detection method of the molecular marker, primer pair or kit as described above is used in sheep breeding. By using the primer pair or kit to amplify and detect the genomic DNA of the sheep, the genotype of the GHR gene of the sample to be tested is determined, so that a high-yield sheep breed can be bred therefrom.

[0019] Finding the mutation sites of genes and discovering the relationship between genes and traits through association analysis is an important means of studying gene function and is also the basis for marker-assisted selection.

[0020] The present invention performs PCR amplification and sequencing on the GHR gene of the Hu sheep, a representative Hu sheep breed, and finds that there is an A / G polymorphic site at the 196th position of the amplified fragment. By detecting the polymorphism of 375 Hu sheep, 31 Tan sheep and 82 Dorper sheep and establishing a least squares model, a molecular marker related to the body weight of sheep at 80-180 days of age is determined. The molecular marker can be used for the selection and breeding of high-yield sheep and the cultivation of new high-yield high-quality mutton sheep breeds, providing an effective genetic engineering means for the genetic improvement of the body weight of sheep at different stages, and has great practical application value. The present invention detects molecular markers by designing KASPar primers. KASP is the abbreviation of competitive allele-specific PCR (Kompetitive AlleleSpecific PCR). This technology does not need to synthesize specific fluorescent probes for each SNP site, but is based on its own unique ARM PCR principle, so that all site detections are ultimately amplified using universal fluorescent primers, which greatly reduces the cost of reagents while retaining the accuracy of the Taqman probe gold standard, providing a simple, accurate and low-cost operating method for the detection of molecular markers of the present invention.

[0021] The beneficial effects of the present invention are:

[0022] The present invention provides a molecular marker related to the growth traits of Hu sheep, specifically the A / G polymorphic site at position 196 of the SEQ ID NO.1 fragment, providing an effective detection means for the selection and breeding of fast-growing sheep. The present invention can be used to select AA homozygous sheep as breeding sheep through the detection of molecular markers and the polymorphic sites that cause the selection and breeding, shorten the breeding cycle, improve the growth traits of sheep, and help improve the economic benefits of the sheep breeding industry. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] Figure 1 This is a gel electrophoresis diagram of the sheep GHR gene fragment used as a molecular marker.

[0024] Figure 2 This is the sequencing result of the sheep GHR gene mutation site in the present invention.

[0025] Figure 3 This is the KASPar SNP typing result of the g.170196A>G mutation site of the sheep GHR gene in the present invention. DETAILED DESCRIPTION

[0026] The following examples are used to further illustrate the present invention, but should not be construed as limiting the present invention. Without departing from the spirit and substance of the present invention, modifications or substitutions made to the present invention all belong to the scope of the present invention.

[0027] Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art. Unless otherwise specified, all reagents used in the present method are of analytical grade or above.

[0028] Example 1 Amplification of GHR gene

[0029] Using Hu sheep GHR gene DNA (GenBank accession number: NC_040267.1) as a template, a pair of primers were designed using Oligo7.0 software: upstream primer MF and downstream primer MR. The primer sequences are as follows:

[0030] Upstream primer MF (SEQ ID NO.2): 5'-GAGCACCACTCCGTTACTCG-3'

[0031] Downstream primer MR (SEQ ID NO.3): 5'-TTCCCCAAAATTCTCAGTCCA-3'

[0032] (2) Amplification and sequencing of the GHR gene

[0033] The PCR reaction system used was a 35 μL system, including 2×PCR Master Mix 17.5 μL, upstream primer MF (10 μmol / L) 1 μL, downstream primer MR (10 μmol / L) 1 μL, ddH 2 O 14μL, DNA template 1.5μL. The DNA template is genomic DNA extracted from sheep whole blood cells.

[0034] PCR amplification reaction conditions: 94°C pre-denaturation for 3 min, 94°C denaturation for 30 s, 56°C annealing for 30 s, 72°C extension for 30 s, 35 cycles, and finally 72°C extension for 10 min.

[0035] The PCR amplification reaction products were detected by 1.5% agarose gel electrophoresis. Figure 1 As shown, lane M: DL 2000 Marker, lanes 1-10: GHR gene amplification results. The results show that a 429 bp specific amplified fragment was obtained. The amplified PCR fragment was sequenced, and the peak graph obtained by sequencing was subjected to double peak detection to identify the mutation site. The results are shown in Figure 2 As shown, double peaks appear in the amplified fragment, and the specific nucleotide sequence of the sequenced fragment is shown in SEQ ID NO.1, wherein there is a polymorphic site in the fragment, specifically, R at the 196 bp site is A or G, that is, the amplified GHR gene fragment (SEQ ID NO.1) has an A / G polymorphism at the 196 bp site, which is located at g.170196 of the GHR gene (see Figure 2 ).

[0036] Wherein, SEQ ID NO.1 is as follows:

[0037] GAGCACCACTCCGTTACTCGGGGATCCTGGTTGAAATTTCCCCAGTCAGTGCACAGGCCATGGGTACCCCTGGAGGCTTCCTCTCGGGGCTTGGCCCTCACCTGTTCTTACAGGGAATGTTTGCTCACTGCCAAAATAGTAGTCTTTATATCTAAACTTATTCTACTTCTCTCCGAAAGGTAAATTTGAAAAACARTATACCTTTAGTTAAGAGA ATTAATCTTTCATCATTTAAATAGCTCTTTACAGCAGCTACTTCAGTTTTAAAGACAATTTGATGCACATAAATAGCTATAAGCCCCTGGAACTCTTTATGCTTGCATTTTAAATTTATTGGACCCAACTTCTGCCAGTAATTCTAGAATTTTCTTTAACCTGTCGTCTTCAAGAAATATATTCCTGTAAATCTGGACTGAGAATTTTGGGGAA.

[0038] DNA sequence homology search and identification:

[0039] The DNA sequence obtained after sequencing was compared with the known physiological function genes published in the GenBank database by BLAST (Basic Local Alignment Search Tool) software on the website of the National Center for Biotechnology Information (NCBI, http: / / www.ncbi.nlm.nih.gov) to identify and obtain the functional information of the DNA sequence. The search results showed that the sequence measured had a partial sequence homology of 99% with the Hu sheep GHR gene DNA (GenBank accession number: NC_040267.1).

[0040] Example 2 Establishment of genotyping detection method

[0041] 1. Primer sequence design

[0042] A KASPar primer pair was designed for the A / G polymorphic site shown in the amplified fragment SEQ ID NO.1 in Example 1, so as to be used for specific detection of the polymorphic site. The nucleotide sequence of the designed KASPar primer pair is:

[0043] Forward primer A1 for detecting AlleleA (SEQ ID NO.4):

[0044] 5'-GAAGGTGACCAAGTTCATGCTTCTCTCCGAAAGGTAAATTTGAAAAACAA-3';

[0045] Forward primer A2 for detecting AlleleG (SEQ ID NO.5):

[0046] 5'-GAAGGTCGGAGTCAACGGATTTCTCCGAAAGGTAAATTTGAAAAACAG-3';

[0047] Universal reverse primer C (such as SEQ ID NO. 6): 5'-GTCTTTAAAACTGAAGTAGCTGCTGTAAAG-3'.

[0048] The above primers were synthesized by Beijing Shenggong Bioengineering Co., Ltd. Each primer in the KASPar primer pair was diluted to 10 μmol / L and mixed in a volume ratio of 12:12:30 for forward primer A1: forward primer A2: universal reverse primer C for later use.

[0049] 2. DNA quality control

[0050] The genomic DNA can be extracted from the whole blood of sheep using a DNA extraction kit. The quality of the extracted genomic DNA is tested by 1% agarose electrophoresis and Nanodrop2100. The qualified DNA is required to reach:

[0051] Agarose electrophoresis showed a single DNA band with no obvious diffusion; Nanodrop2100 detected A260 / 280 between 1.8-2.0 (DNA sample without protein contamination); A260 / 230 between 1.8-2.0 (DNA sample with low salt ion concentration); no obvious light absorption at 270nm (DNA sample without phenol contamination). Based on the KASP detection technology of LGC, UK, and the genome size, the amount of DNA used was calculated to be 10-20ng / sample, and the DNA concentration was diluted to 10-20ng / μL for standby use.

[0052] 3. Genotyping test

[0053] First, use the K-pette dispensing workstation to add 1.5 μL of the diluted test DNA template (10-20 ng / μL) and the blank control (No template control, NTC, using sterile water) into a 384-well reaction plate, and dry at 60°C for 30 min (drying oven, LGC Company) to convert the DNA into dry powder for use.

[0054] Each primer in the above KASPar primer pair was diluted to 10 μmol / L, and mixed at a volume ratio of 12:12:30 for forward primer A1: forward primer A2: universal reverse primer C as a primer mixture for standby use.

[0055] Then, under the Kraken operating system, 1× Master mix (1536 microplate, Part No. KBS-1016-011) and primer mixture were added to each reaction well using the Meridian sample loading workstation. After the Mix was dispensed, the microplate was immediately placed on the Kube heat sealer and the Fusion laser sealer for sealing, and the high-throughput water bath PCR amplification was performed using the Hydrocycler. The PCR reaction was performed in the high-throughput water bath system Hydrocycler, and the specific procedure was as follows:

[0056] Pre-denaturation at 94°C for 15 minutes;

[0057] 94℃, 20 seconds (denaturation) - 61℃-55℃, 1 minute (renaturation & extension), 10 cycles of touch down sequence amplification, 0.6℃ lowering for each cycle;

[0058] Amplification was continued for 26 cycles from 94°C, 20 seconds (denaturation) to 55°C, 60 seconds.

[0059] After amplification, the BMG PHERAstar instrument was used to detect the fluorescence signal and check the typing. The specific results are as follows Figure 3 As shown. Each dot in the figure represents a sample of material to be tested, where the red dot near the left side indicates that the site is a homozygous genotype "GG"; the green dot near the middle indicates that the site is a heterozygous genotype "AG" or "GA"; the blue dot near the right side indicates that the site is a homozygous genotype "AA"; the black dot indicates NTC ( Figure 3 ), which is the water control.

[0060] 4. Application of the molecular markers of the present invention in the association analysis of Hu sheep growth traits

[0061] A total of 375, 31 Tan sheep and 82 Dorper sheep were tested for polymorphism, their genotypes were determined, and the least squares model described below was established to conduct association analysis between genotype and stage weight.

[0062] Y ijkl =μ+Genotype i +P j +M l +ε ijkl

[0063] Among them, Y ijkl is the observed value of stage weight, μ is the overall mean, Genotype i is the genotype effect, P j is the batch effect, M l is the variety effect, ε ijkl is a random error, assuming that ε ijkl They are independent of each other and obey the N(0,σ2) distribution.

[0064] The measuring time of stage body weight in the present invention is 80d, 100d, 120d, 140d, 160d and 180d.

[0065] The genotype test results showed that among the 488 individuals, there were 105 individuals with AA genotype, 116 individuals with GA genotype, 252 individuals with GG genotype, and 15 individuals were not successfully typed. The results of the genotype-trait association analysis are shown in Table 1, where BW in the table represents the stage body weight in kg. BW80d represents the body weight at 80 days of age; BW100d represents the body weight at 100 days of age, and so on.

[0066] Table 1 Association analysis between sheep GHR gene polymorphism and stage body weight

[0067]

[0068] Note: Data in the same row with different letters in the subscripts indicate significant differences (P<0.05), and data with the same letters in the subscripts indicate no significant differences (P>0.05).

[0069] The results showed that as the measurement period was prolonged, the GHR g.170196A>G mutation site was significantly correlated with the stage weight of sheep. The stage weight of individuals with AA genotype was significantly higher than that of individuals with GA and GG types (P<0.05). It can be seen that the AA genotype is the dominant genotype and the A allele is the dominant allele. This shows that the GHR g.170196A>G mutation site can be used as a potential molecular marker affecting the stage weight of sheep (P<0.05). Selecting the AA genotype for seed preservation during breeding, using the AA genotype as a breeding sheep during breeding, and hybridizing with other sheep can effectively improve the production efficiency of offspring sheep. Sequence Listing <110> Lanzhou University <120> Molecular markers related to stage weight in sheep, their detection methods and applications <160> 6 <170> SIPOSequenceListing 1.0 <210> 1 <211> 429 <212> DNA <213> Artificial Sequence <400> 1 gagcaccact ccgttatactcg gggatcctgg ttgaaatttc cccagtcagt gcacaggcca 60 tgggtacccc tggaggcttc ctctcggggc ttggccctca cctgttctta cagggaatgt 120 ttgctcactg ccaaaatagt agtctttata tctaaactta ttctacttct ctccgaaagg 180 taaatttgaa aaacartata cctttagtta agagaattaa tctttcatca tttaaatagc 240 tctttacagc agctacttca gttttaaaga caatttgatg cacataaata gctataagcc 300 cctggaactc tttatgcttg cattttaaat ttattggacc caacttctgc cagtaattct 360 agaattttct ttaacctgtc gtcttcaaga aatatattcc tgtaaatctg gactgagaat 420 tttggggaa 429 <210> 2 <211> 20 <212> DNA <213> Artificial Sequence <400> 2 gagcaccact ccgttactcg 20 <210> 3 <211> 21 <212> DNA <213> Artificial Sequence <400> 3 ttccccaaaa ttctcagtcc a 21 <210> 4 <211> 50 <212> DNA <213> Artificial Sequence <400> 4 gaaggtgacc aagttcatgc ttctctccga aaggtaaatt tgaaaaacaa 50 <210> 5 <211> 48 <212> DNA <213> Artificial Sequence <400> 5 gaaggtcgga gtcaacggat ttctccgaaa ggtaaatttg aaaaacag 48 <210> 6 <211> 30 <212> DNA <213> Artificial Sequence <400> 6 gtctttaaaa ctgaagtagc tgctgtaaag 30

Claims

1. Application of a molecular marker related to sheep stage weight in sheep breeding, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at the 196th bp position represents A or G, and the mutation leads to the A / G polymorphism of the molecular marker. The breeding is for breeding high-yielding sheep, wherein the body weight of individuals with AA genotype at 80-180 days of age is significantly higher than that of individuals with GA and GG genotypes.

2. Application of a PCR primer pair for detecting molecular markers associated with stage weight of sheep in sheep breeding, characterized in that: The PCR primer pair includes an upstream primer and a downstream primer, the nucleotide sequences of the upstream primer and the downstream primer are as shown in SEQ ID NO.2 and SEQ ID NO.3, the nucleotide sequence of the molecular marker is as shown in SEQ ID NO.1, wherein R at the 196th bp represents A or G, and the mutation leads to the A / G polymorphism of the molecular marker, and the breeding is for breeding high-yield sheep, wherein the body weight of individuals with AA genotype at 80-180 days of age is significantly higher than that of individuals with GA and GG genotypes.

3. Application of KASPar primer pairs for detecting molecular markers related to stage weight of sheep in sheep breeding, characterized in that: The KASPar primer pair includes a primer A1 for detecting AlleleA, a primer A2 for detecting AlleleG and a universal reverse primer, the nucleotide sequence of the primer A1 for detecting AlleleA is shown in SEQ ID NO.4, the nucleotide sequence of the primer A2 for detecting AlleleG is shown in SEQ ID NO.5, the nucleotide sequence of the universal reverse primer is shown in SEQ ID NO.6, the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at the 196th bp represents A or G, and the mutation leads to the A / G polymorphism of the molecular marker, and the breeding is for breeding high-yield sheep, wherein the body weight of individuals with AA genotype at 80-180 days of age is significantly higher than that of individuals with GA and GG genotypes.

4. Use of a detection kit for detecting molecular markers related to stage weight of sheep in sheep breeding, characterized in that: The detection kit comprises a PCR primer pair with a nucleotide sequence as shown in SEQ ID NO.2-3 or a KASPar primer pair with a nucleotide sequence as shown in SEQ ID NO.4-6, and the nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at the 196th bp represents A or G, and the mutation leads to the A / G polymorphism of the molecular marker. The breeding is for breeding high-yield sheep, wherein the body weight of individuals with AA genotype at 80-180 days of age is significantly higher than that of individuals with GA and GG genotypes.

5. Application of a method for detecting molecular markers related to stage weight of sheep in sheep breeding, comprising the following steps: a) amplifying sheep genomic DNA using a PCR primer pair having a nucleotide sequence as shown in SEQ ID NO. 2-3 or a KASPar primer pair having a nucleotide sequence as shown in SEQ ID NO. 4-6, or using a detection kit containing the aforementioned primer pair; b) performing typing identification on the polymorphic site where R represents A or G at the 196 bp position of the amplified product obtained in step a) as shown in SEQ ID NO.1, wherein the breeding is for breeding high-yield sheep, wherein: The body weight of individuals with AA genotype during 80-180 days of age was significantly higher than that of individuals with GA and GG genotypes.

6. The use according to claim 5, characterized in that: The typing and identification method in step b) is direct sequencing, gene chip, fluorescent probe or high-resolution melting curve method.

7. The use according to claim 5, characterized in that: The KASPar primer pair described in claim 3 is used for PCR amplification, and after the amplification is completed, the typing result is determined by detecting the fluorescent signal.

8. Use of a molecular marker associated with sheep stage weight, or a primer pair for detecting a molecular marker associated with sheep stage weight, or a detection kit containing a primer pair for detecting a molecular marker associated with sheep stage weight, or a method for detecting a molecular marker associated with sheep stage weight in detecting traits associated with sheep stage weight, characterized in that: The nucleotide sequence of the molecular marker is shown in SEQ ID NO.1, wherein R at the 196 bp position represents A or G, and the mutation leads to the A / G polymorphism of the molecular marker, wherein the body weight of individuals with AA genotype at 80-180 days of age is significantly higher than that of individuals with GA and GG genotypes; The nucleotide sequences of the primer pairs are shown in SEQ ID NO. 2-3 or in SEQ ID NO. 4-6.

Images