Establishment of IC-ELISA method, kit and application for porcine osteopontin detection

Abstract

The present invention discloses a method for establishing porcine osteopontin IC-ELISA detection, a kit and an application thereof, and belongs to the technical field of immunology. The osteopontin enzyme-linked immunosorbent assay kit and method provided by the present invention can detect the content of osteopontin in semen; the specificity is good, the sensitivity is high, the accuracy of the test results is good, and the repeatability is good; the sample processing is simple, the test operation is simple, and the kit is provided in the form of a working solution, which can be used to screen large-scale boar populations in pig farms.

Description

Technical Field

[0001] The invention belongs to the technical field of immunology, and specifically relates to an establishment method, a kit and application of porcine osteopontin IC-ELISA detection. Background Art

[0002] In intensive and modern breeding farms, artificial insemination technology has been widely used, but the main problem with artificial insemination at present is how to obtain high-quality semen. Therefore, screening boars with high reproductive performance is of great significance to improving the sow conception rate and improving the production efficiency of pig farms.

[0003] With the rapid development of proteomics in recent years, thousands of proteins have been identified in semen, and many candidate protein markers related to male fertility have been found, which will facilitate the animal husbandry industry in selecting excellent breeding stock and improve production levels.

[0004] Osteopontin is the first extracellular matrix protein identified in bovine bone tissue. It is a highly phosphorylated glycoprotein located at the end of the long arm of chromosome 8. It contains 6 exons and 5 introns. The CDS region is 912bp long and encodes 304 amino acids. There are 7 repeated dinucleotide fragments in the promoter region, which are composed of approximately 314 amino acids. After shearing and translation, the molecular weight is between 44 and 75kDa, and there are differences between different species.

[0005] Osteopontin is a seminal protein and is expressed in most mammalian reproductive organs, such as the testis, epididymis, fallopian tube, uterus, etc. It is basically involved in the entire reproductive process of fertilization, embryo implantation and placenta formation. The localization of osteopontin in pig testis was detected by immunohistochemistry, and it was found that it was expressed in primary spermatocytes, secondary spermatocytes and spermatids, indicating that it may be involved in the process of spermatogenesis. Adding osteopontin to frozen semen and oocytes in vitro can improve the fertilization rate, cleavage rate and embryonic development of cattle and pigs. Osteopontin can also improve endometrial receptivity by binding to integrins, and act as an adhesion factor, which is a crucial factor for embryo implantation.

[0006] For identification in large-scale farms, the method is usually required to be accurate and fast, and to be able to process multiple samples at the same time. ELISA has the advantages of high sensitivity and low minimum detection limit, which can meet the requirements of large-scale testing in production at the same time. Summary of the invention

[0007] In order to overcome the defects of the prior art, the first object of the present invention is to provide a method for establishing IC-ELISA detection of porcine osteopontin.

[0008] The second object of the present invention is to provide a kit for IC-ELISA detection of porcine osteopontin.

[0009] The third object of the present invention is to provide a porcine osteopontin IC-ELISA detection method.

[0010] The fourth object of the present invention is to provide the application of the above-mentioned kit for IC-ELISA detection of porcine osteopontin.

[0011] In order to achieve the above-mentioned object of the invention, the present invention adopts the following technical solutions:

[0012] A method for establishing IC-ELISA detection of porcine osteopontin comprises the following steps:

[0013] S1: Preparation of osteopontin;

[0014] S2: Preparation of monoclonal antibody against osteopontin;

[0015] S3: Establishment and evaluation of enzyme-linked immunosorbent assay:

[0016] By using the chessboard titration method, different concentrations of antigen were coated in the horizontal gradient, and different concentrations of antibody were added in the vertical gradient. The coating concentration and antibody dilution multiple with an OD value between 1.0 and 1.5 were selected for the next step, and the optimal coating concentration was determined based on different combinations of Amax, IC50, and Amax / IC50;

[0017] Under the above optimal conditions, different coating times were set, and the optimal coating time was determined according to Amax / IC50 and IC50 at different times;

[0018] Under the above optimal conditions, different blocking times were selected, and the Amax / IC50 and IC50 at different blocking times were compared to determine the optimal blocking time;

[0019] Under the above optimal conditions, different dilution multiples of primary antibodies were selected for incubation and different incubation times were selected, and the Amax / IC50 and IC50 of the primary antibodies at different dilution multiples and different incubation times were compared to determine the optimal primary antibody dilution multiple and primary antibody incubation time;

[0020] Under the above optimal conditions, select secondary antibodies with different dilution multiples for incubation and select different incubation times, and compare Amax / IC50 and IC50 of secondary antibodies with different dilution multiples and different incubation times to determine the optimal secondary antibody dilution multiple and secondary antibody incubation time;

[0021] Under the above optimal conditions, different color development times were selected, and the Amax / IC50 and IC50 of different color development times were compared to determine the optimal color development time;

[0022] Under the above optimal conditions, standard protein solutions with different concentration gradients were used to draw a standard curve, and the data were eliminated according to the experimental results until a linear relationship appeared. The experimental results had to meet R2>0.99 and CV%<15% to be included in the linear range.

[0023] As a further improvement of the present invention, the specific steps of preparing osteopontin in step S1 are as follows:

[0024] P1: Based on the PET-32a(+) plasmid, the OPN gene sequence shown in SEQ ID NO.1 was inserted into the restriction sites NdeI and EcoRI to obtain the recombinant plasmid OPN-Pet-32a;

[0025] P2: The recombinant plasmid OPN-Pet-32a was transformed into Escherichia coli BL21 (DE3), cultured until the OD value was 0.4-0.6, 0.1 M IPTG was added to induce expression, and the cells were broken and the supernatant was collected;

[0026] P3: The target protein was purified using a nickel column, and the sodium chloride concentration in the eluent was 300 mM, thereby obtaining the porcine osteopontin.

[0027] As a further improvement of the present invention, the specific steps of preparing the osteopontin monoclonal antibody described in step S2 are to prepare the antibody with reference to patent CN201911323477.2 and using the hybridoma cell line Cy2 with a deposit number of CCTCC NO: C2009293.

[0028] A kit for detecting porcine osteopontin IC-ELISA comprises the following components: osteopontin prepared in step S1, coating solution, blocking solution, osteopontin monoclonal antibody prepared in step S2, secondary antibody, color developing solution TMB and stop solution H2SO4.

[0029] As a further improvement of the present invention, the coating solution is a 0.1 mol / L carbonate buffer solution at pH 9.6, and each 250 mL system is prepared as follows: 0.375 g Na2CO3 and 0.732 g NaHCO3 are added to 250 mL distilled water.

[0030] As a further improvement of the present invention, the blocking solution is 1% BSA-PBST, and each 100 mL system is prepared as follows: 1 g BSA is dissolved in 100 ml PBST.

[0031] As a further improvement of the present invention, the secondary antibody is HRP-labeled goat anti-mouse IgG purchased from Bio-Tech.

[0032] The above-mentioned porcine osteopontin IC-ELISA detection kit is used for detecting the content of porcine osteopontin OPN in the sample to be tested for non-diagnostic purposes.

[0033] As a further improvement of the present invention, the sample to be tested includes but is not limited to in vitro pig tissue, pig oocyte and / or pig semen.

[0034] A porcine osteopontin IC-ELISA detection method comprises the following steps:

[0035] Coating: Dilute osteopontin with coating solution at a dilution factor of 1:20,000, add to the ELISA plate, and coat at 4°C for 12 hours;

[0036] Blocking: Wash the coated ELISA plate, add blocking solution, and block at 37℃ for 2h; wash the blocked plate, dry it, and set aside;

[0037] Competitive reaction: add the sample to be tested to the sealed ELISA plate and shake to mix; add osteopontin monoclonal antibody at a dilution of 1:100,000, keep at 37°C for 45 minutes, and wash the plate after the reaction is completed;

[0038] Enzyme-labeled secondary antibody: Then add the secondary antibody at a dilution of 1:2000, incubate at 37°C for 30 min, and wash the plate after the reaction is complete;

[0039] Color development: Add TMB colorimetric solution, incubate at 37°C for 10 min, and add 2M H2SO4 to terminate the reaction;

[0040] Detection: OD450 and OD630 were measured by an ELISA instrument, and the concentration of osteopontin in the sample to be tested was obtained through the standard curve, thereby achieving quantitative detection of osteopontin in the sample to be tested; wherein: the linear equation of the standard curve is y = -0.3158x + 1.294, R 2 =0.9956, the minimum detection limit is 0.027μg / ml.

[0041] As a further improvement of the present invention, the content of porcine osteopontin in the sample to be tested is in the range of 0.625-32 μg / ml.

[0042] Compared with the prior art, the present invention has the following advantages and effects:

[0043] The osteopontin ELISA kit provided by the present invention can detect the content of osteopontin in semen; it has good specificity, high sensitivity, good accuracy of detection results, and good repeatability; the sample processing is simple, the detection operation is simple, and the kit is provided in the form of working solution, which can be used to screen large-scale breeding boar groups in pig farms. BRIEF DESCRIPTION OF THE DRAWINGS

[0044] Figure 1 Take a picture of the OPN gene RT-PCR amplification results;

[0045] Figure 2 This is a photo of the positive bacterial solution identification result of PET-32a(+)-OPN recombinant plasmid;

[0046] Figure 3 This is a photo of the SDS-PAGE identification result of PET-32a(+)-OPN prokaryotic expression protein;

[0047] Figure 4 This is the result of western blot identification of PET-32a(+)-OPN prokaryotic expression protein;

[0048] Figure 5 This is the peptide matching result diagram of porcine OPN protein;

[0049] Figure 6 This is a graph showing the results of the IC-ELISA experimental condition optimization study; A is the determination of the optimal coating concentration, B is the determination of the optimal primary antibody dilution condition, C is the determination of the optimal enzyme-labeled secondary antibody dilution condition, D is the determination of the optimal coating time, E is the determination of the optimal blocking time, F is the determination of the optimal competitive reaction time, and G is the determination of the optimal enzyme-labeled secondary antibody reaction time;

[0050] Figure 7 The stability test result of IC-ELISA detection method is shown in the figure; A is the coated antigen ELISA plate, B is the standard antigen, C is the monoclonal antibody, and D is the activity of the enzyme-labeled secondary antibody after being stored at 37°C for 7 days;

[0051] Figure 8 This is the IC-ELISA inhibition competition curve diagram; wherein A is the inhibition competition curve and B is the standard curve. DETAILED DESCRIPTION

[0052] The present invention is further described in detail below in conjunction with examples and drawings, but the embodiments of the present invention are not limited thereto.

[0053] The experimental methods for which specific conditions are not specified in the examples are generally performed according to conventional conditions, such as the conditions described in Molecular Cloning Laboratory Manual (3rd edition, written by J. Sambrook et al., translated by Huang Peitang et al., Science Press, 2002), or according to the conditions recommended by the manufacturer.

[0054] Example 1: Preparation of target antigen

[0055] 1. Materials and Methods

[0056] 1.1 Strains and plasmids

[0057] Plasmid pMD18-T and prokaryotic expression plasmid pET32a(+) were purchased from Takara Biotechnology Co., Ltd.; cloning host bacteria E. coli DH5a and expression host bacteria E. coli BL21(DE3) were purchased from Qingke Biotechnology Co., Ltd.

[0058] 1.2 Main Reagents

[0059] The animal tissue RNA extraction kit was purchased from Omega Company; the reverse transcription kit, high-fidelity enzyme PrimerSTARMax DNA Polymerase, 2×Taq Master Mix, DNA Maker DL2000, ampicillin, EB, and TAE were purchased from Dingguo Company; agarose powder was purchased from Qingke Biotechnology Company; Tianjingsha RNAase, gel recovery kit, and plasmid endotoxin-free extraction kit were purchased from Tiangen Biochemical Co., Ltd.

[0060] 2. Experimental Methods

[0061] 2.1 Construction of prokaryotic expression vector of porcine osteopontin

[0062] 2.1.1 Codon Optimization of OPN

[0063] According to the gene sequence provided by NCBI (GenBank accession number: NM_214023.1), the sequence encoding OPN was optimized by online software, using the codons preferred by E. coli without changing the encoded amino acids, reducing the GC content. The optimized sequence was synthesized by Qingke Biotechnology and constructed on the pMD18-T vector. The resulting recombinant plasmid was named pMD18-T-OPN.

[0064] 2.1.2 Primer design

[0065] In order to connect the target sequence OPN to PET-32a(+), the restriction sites were selected as NdeI and EcoRI, and PCR amplification primers were designed and synthesized by Shanghai Bioengineering.

[0066] OPN-Ndel-F:5'-GGAATTC CATATG ATGCTGCCCGTGAAGCAGACA-3′;

[0067] OPN-EcoRI-6His-R:5'-CCG GAATTC TTAGTGGTGATGGTGGTGGTGGTTGATCTCGCTGCTGGCGC-3';

[0068] Note: The underlined part is the restriction site.

[0069] 2.1.3 Subcloning of the target gene OPN

[0070] The constructed pMD18-T-OPN plasmid was used as a template, and the primers OPN-Ndel-F and OPN-EcoRI-6His-R were used to amplify the OPN fragment with restriction sites, and PCR amplification was performed using a high-fidelity enzyme. The PCR reaction system was: 1 μl of upstream primer, 1 μl of downstream primer, 25 μl of 2×Phanta Max Master Mix (Dye Plus), 1 μl of plasmid template, and 21 μl of ddH2O. The PCR reaction program was: 95℃ pre-denaturation for 3 min, 95℃ denaturation for 15 s, 65℃ annealing for 15 s, 72℃ extension for 30 s, 35 cycles, 72℃ final extension for 5 min, and storage at 4℃.

[0071] 2.1.4 Double restriction digestion and ligation of OPN fragment and PET-32a(+) plasmid

[0072] After the PCR product was recovered using gel recovery reagent, the purified OPN fragment and PET-32a(+) plasmid were double-digested with NdeI and EcoRI enzymes. The reaction conditions were: incubation at 37°C for 1 hour.

[0073] Gel electrophoresis was performed for identification and gel excision and recovery. The OPN fragment and the vector fragment were connected overnight at 16°C using Solution I to construct the recombinant plasmid OPN-Pet-32a. The recombinant plasmid OPN-Pet-32a was obtained by transformation, identification and plasmid extraction.

[0074] 2.1.5 Inducible expression and identification of porcine osteopontin OPN prokaryotic expression vector

[0075] 2.1.5.1 OPN prokaryotic protein induced expression

[0076] The extracted plasmid was transformed into the expression bacteria BL21 (DE3), the positive colonies were expanded and cultured, and the ratio of the aspirated bacterial solution to the LA liquid medium was 1:1000 at 37℃ / 220rpm overnight activation. 500μL of the overnight cultured bacterial solution was aspirated into 50mL liquid culture medium, and cultured at 37℃ / 220rpm until the OD value was 0.4-0.6, and 0.1M IPTG was added for induction, and identification was performed after 12h. The induced bacterial solution was 12000rpm / 10min, the supernatant was discarded, and after rinsing with PBS 3 times, ultrasonically disrupted. The disruption procedure was (300W, 10s each time, 10s interval, 50 cycles) The disrupted bacterial solution was centrifuged at 4℃ / 12000rpm for 10min, the supernatant and precipitate were collected, and the precipitate was dissolved with 8M urea.

[0077] 2.1.5.2 Identification of OPN expressed protein

[0078] The induced expressed protein was identified by SDS-PAGE, Western blot and flight mass spectrometry, and the final concentration of the remaining protein solution was determined by BCA method, and then the protein was aliquoted, freeze-dried and concentrated for later use.

[0079] 2.1.5.3 Purification of OPN expressed protein

[0080] For the bacterial solution with correct expression, expand the expression, centrifuge at 8000rpm for 5min to collect the bacterial precipitate; add 200mL his Binding Buffer to the bacterial precipitate to resuspend the bacterial precipitate; divide it equally into 6 50mL centrifuge tubes; ultrasonically disrupt: power 300W, time 5s, interval 5s, 20min, ice bath throughout the process. Centrifuge at 10000rpm for 15min to obtain the supernatant. Filter the supernatant with a 0.45μm filter to obtain the clarified bacterial supernatant. Take two 5mL Ni excel prepacked columns, elute the column with 20 column volumes of His eluting buffer; balance the column with 20 column volumes of His binding buffer; load the sample at a flow rate of 5mL / min and collect the penetration liquid; balance the column with 10 column volumes of His binding buffer until A280 (UV) and conductivity tend to balance; collect the equilibrium liquid; elute the impurities with 5% eluting buffer; collect; elute the impurities with 10% eluting buffer; collect; elute the impurities with 15% eluting buffer; collect; elute with 100% eluting buffer and collect. Detect the collected liquid by 12% SDS-PAGE electrophoresis.

[0081] 2.2 Preparation of monoclonal antibodies

[0082] Referring to the laboratory's previous patent CN201911323477.2, the antibody was prepared using the hybridoma cell line Cy2 with a deposit number of CCTCC NO: C2009293.

[0083] 2.3 Establishment and application of porcine osteopontin IC-ELISA method

[0084] 2.3.1 IC--ELISA basic steps

[0085] Coating: Dilute the original coating solution (prepared as follows: add 0.375g Na2CO3 and 0.732g NaHCO3 to 250mL distilled water) to the appropriate concentration, add 100μL / well to each well of the ELISA plate, and coat overnight at 4℃;

[0086] Blocking: Wash the coated ELISA plate 3 times, add 300 μL / well of blocking solution (prepared as follows: 1g BSA dissolved in 100ml PBST), and place in a 37°C incubator for 2 hours; wash and dry the blocked plate, and use a vacuum machine to dry it for later use;

[0087] Competition reaction: dilute the standard to a suitable concentration with diluent, add 50 μL / well to the fixed ELISA plate, and shake to mix; then add 50 μL / well of the antibody at a suitable concentration to the plate, place it in a 37°C incubator for 1 hour, and wash the plate 5 times in a plate washer after the reaction is completed;

[0088] Enzyme-labeled secondary antibody: 100 μL / well of enzyme-labeled secondary antibody (Biyuntian HRP-labeled goat anti-mouse IgG), placed in a 37°C incubator for 30 min, and after the reaction, placed in a plate washer and washed 5 times;

[0089] Color development: Add 100 μL / well of TMB color development solution, place in a 37°C incubator for 10 min, and add 100 μL / well of 2M H2SO4 to terminate the reaction;

[0090] Determination: OD450 and OD630 were measured using a microplate reader.

[0091] 2.3.2 Determination of the optimal coating concentration

[0092] By the chessboard titration method, different concentrations of protein were coated in the horizontal gradient, and different concentrations of antibody were added in the vertical gradient. The determination was carried out according to step 2.3.1, and the coating concentration and antibody dilution multiple with an OD value between 1.0-1.5 were selected to proceed to the next step. The optimal coating concentration was determined according to different combinations of Amax, IC50, and Amax / IC50.

[0093] 2.3.3 Determination of the optimal coating time

[0094] Under the above optimal conditions, set different coating times, measure according to step 2.3.1, and compare Amax / IC50 and IC50 at different times to determine the optimal coating time.

[0095] 2.3.4 Determination of the optimal closure time

[0096] Under the above optimal conditions, select different blocking times and measure according to step 2.3.1. Compare the Amax / IC50 and IC50 of different blockers and blocking times to determine the optimal blocker and blocking time.

[0097] 2.3.5 Determination of the optimal primary antibody dilution and incubation time

[0098] Under the above optimal conditions, select primary antibodies with different dilution multiples for incubation and select different incubation times. Determine according to step 2.3.1, and compare the Amax / IC50 and IC50 of primary antibodies with different dilution multiples and different incubation times to determine the optimal primary antibody dilution multiple and primary antibody incubation time.

[0099] 2.3.6 Determination of the optimal secondary antibody dilution and incubation time

[0100] Under the above optimal conditions, select secondary antibodies with different dilution multiples for incubation and select different incubation times. Determine according to step 2.3.1, and compare the Amax / IC50 and IC50 of secondary antibodies with different dilution multiples and different incubation times to determine the optimal secondary antibody dilution multiple and secondary antibody incubation time.

[0101] 2.3.7 Determination of the optimal color development time

[0102] Under the above optimal conditions, select different color development times, measure according to step 2.3.1, and compare Amax / IC50 and IC50 of different color development times to determine the optimal color development time.

[0103] 2.4 Evaluation of IC-ELISA method for detecting porcine osteopontin

[0104] 2.4.1 Establishment of linear range and standard curve of IC-ELISA detection method

[0105] The linear range is an important basis for evaluating the effectiveness of the kit and is also the basis for establishing the standard curve. The experiment selected 12 concentration levels, and the data were eliminated according to the experimental results until a linear relationship appeared. The experimental results must meet R2>0.99 and CV%<15% to be included in the linear range. Origin9.1 software was used for four-parameter fitting to obtain the inhibition curve.

[0106] 2.4.2 Determination of the precision of IC-ELISA detection method

[0107] Precision is an important indicator to measure the intra-batch and inter-batch variation of detection reagents. The coefficient of variation is used to express the intra-batch and inter-batch errors by repeating the test for 4 times on the test kits prepared from the same batch and different batches.

[0108] 2.4.3 Accuracy test of IC-ELISA detection method

[0109] Using the accuracy of the recovery test kit, osteopontin of known concentration was diluted into low, medium and high concentrations and added to the sample. The added amount was controlled within the linear range, and each concentration was measured 3 times to calculate the recovery rate.

[0110] 2.4.4 Stability test of IC-ELISA assay

[0111] Each component was verified by a 37°C accelerated storage experiment. According to the "Preparation and Application of Medical Test Diagnostic Reagents", one day of biological reagent at 37°C is equivalent to one and a half months at 4-10°C. The storage time of the assembled test kit was observed.

[0112] 2.5 Pig semen protein sample detection

[0113] Three breeds, Duroc, Landrace and Large White, were selected for sperm and seminal albumin testing.

[0114] 3. Experimental results

[0115] 3.1 Construction of recombinant plasmid PET-OPN

[0116] 3.1.1 PCR amplification of the target gene OPN

[0117] The OPN fragment was amplified from pMD18-T-OPN using specific primers OPN-Ndel-F and OPN-EcoRI-6his-R, with a size of 861 bp ( Figure 1 ).

[0118] The OPN fragment sequence is shown below (SEQ ID NO.1):

[0119] CTGCCCGTGAAGCAGACAAACAGCGGGAGCAGCGAGGAGAAGCTGCTGAGCAACAAGTACACCGATGCCGTGGCCACACTGCTGAAGCCCGATCCCAGCCAGAAGCAGACCTTCCTGGCCCCCCAGAACACCATTAGCTCCGAGGAGACAGATGATTTCAAGCAGGAGACCCTGCCCAGCAAGAGCAACGAGTCCCCCGAGCAGACCGACGACGTGGATGATGATGATGACGAGGACCACGTCGACTCCAGGGACACCGACAGCGAGGAGGCCGATCACGCCGACGATGCCGATAGGTCCGACGAGAGCCACCACAGCGATGAGTCCGATGAGCTGGTGACAGACTTCCCCACAGACACCCCCGCCACCGACGTGACCCCCGCCGTGCCCACCGGCGACCCCAACGATGGCCGGGGGGATAGCGTGGTGTACGGGCTGCGGTCCAAGTCCAAGAAGTTTAGGCGGAGCGAGGCCCAGCAGCTGGACGCCACCGAGGAGGACCTGACCAGCCACGTGGAGAGCGAGGAGACCGACGGCACCCCCAAGGCCATCCTGGTGGCCCAGAGGCTGCACGTGGCCTCCGACCTGGATTCCCAGGAGAAGGACAGCCAGGAGACATCCCAGCCCGATGATAGGAGCGTGGAGACCAGGAGCCAGGAGCAGAGCAAGGAGTACACAATCAAGACCTACGACGGCAGCAACGAGCACAGCAACGTGATTGAGTCCCAGGAGAACCCCAAGGTGAGCCAGGAGTTCCACTCCCACGAGGATAAGCTGGTCCCCGATAGCAAGAGCGAGGAGGATAAGCACCTGAAGCTGAGGGTGAGCCACGAGCTGGAGAGCGCCAGCAGCGAGATCAAC。

[0120] 3.1.2 Double digestion, ligation and sequencing identification of the OPN target fragment and the expression plasmid pET-32a(+)

[0121] After the target fragment is purified and recovered, it is double-digested with the expression plasmid PET-32a(+) through the NdeI and EcoRI restriction sites, and then the product is purified, recovered, and connected; the target fragment is connected to PET-32a(+), and the connection product is transformed into DH5α and plated on a plate with ampicillin resistance; 7 colonies are randomly selected every other day for PCR identification ( Figure 2 ), the results showed that the target fragment OPN and PET-32a(+) plasmid were successfully connected. After sequencing analysis, it was found that OPN was successfully inserted into the multiple cloning site of PET-32a(+), the triplet code reading frame was correct, and there was no base mutation, indicating that the insertion sequence was correct and the recombinant plasmid was successfully constructed.

[0122] 3.2 Inducible expression and identification of PET-OPN in E. coli

[0123] 3.2.1 Transformation of recombinant plasmid PET-OPN into expression strain BL21(DE3)

[0124] The plasmid with the correct sequence was transformed into the expression strain BL21 (DE3) and plated overnight; 4 monoclonal colonies were randomly selected for PCR identification, and bands appeared at 861 bp, indicating that the PET-OPN plasmid was successfully transformed into the expression strain BL21 (DE3)

[0125] 3.2.2 Analysis and identification of the solubility of PET-OPN protein in E. coli

[0126] After inducing the expression of the host bacteria BL21 (DE3) containing the recombinant plasmid PET-OPN with IPTG, the supernatant and precipitate were separated by ultrasonication. SDS-PAGE revealed that the expression level of PET-OPN in the supernatant was higher ( Figure 3 ), and further Western blot analysis confirmed that PET-OPN was expressed in the supernatant, but not in the inclusion bodies ( Figure 4 ), indicating that the PET-OPN expressed protein exists in the supernatant and can be used for subsequent experiments.

[0127] 3.2.3 PET-OPN protein purification and concentration determination

[0128] The target protein was expressed in large quantities and purified by nickel column. The target protein could be completely bound to the column. After gradient elution, the target protein and impurities were well separated. Among them, the target protein was mainly eluted at 30% (300mM NaCl concentration). The concentration of the purified protein was 2.5mg / ml as determined by BCA.

[0129] 3.2.4 Mass spectrometry identification of porcine OPN protein

[0130] The mass spectrometry results were compared with the porcine amino acid sequences at NCBI ( Figure 5 ), the coverage of expressed peptides was 77%, indicating that the expressed protein was highly reliable.

[0131] 3.3 Optimization of IC-ELISA experimental conditions

[0132] 3.3.1 Determination of the optimal coating concentration

[0133] The results are as follows Figure 6 As shown in A, IC50 decreases with the decrease of coating concentration, while AMAX / IC50 increases first and then decreases with the decrease of coating concentration. When the coating protein dilution factor is 1:20000, the protein concentration is 0.125μg / mL, at which time AMAX / IC50 is the largest, so this concentration is selected as the optimal coating protein concentration.

[0134] 3.3.2 Determination of the optimal primary antibody dilution conditions

[0135] The results are as follows Figure 6 As shown in B, with the increase of antibody dilution ratio, IC50 shows a downward trend and then tends to be flat, but AMAX / IC50 shows a trend of first increasing and then decreasing. When the primary antibody dilution ratio is 1:100000 and the antibody concentration is 0.05μg / mL, AMAX / IC50 is the largest, so 1:100000 is selected as the optimal antibody dilution ratio.

[0136] 3.3.3 Determination of the optimal enzyme-labeled secondary antibody dilution conditions

[0137] like Figure 6 As shown in C, with the increase of enzyme-labeled secondary antibody dilution ratio, IC50 shows a downward trend and then tends to be flat, but AMAX / IC50 shows a trend of first increasing and then decreasing. When the enzyme-labeled secondary antibody dilution ratio is 1:2000, AMAX / IC50 is the largest, so 1:2000 is selected as the best enzyme-labeled secondary antibody dilution ratio.

[0138] 3.3.4 Determination of the optimal coating time

[0139] The results are as follows Figure 6 As shown in D, IC50 was the smallest and AMAX / IC50 was the largest at 12 h 4 °C, so 12 h 4 °C was selected as the optimal coating condition for the ELISA plate.

[0140] 3.3.5 Determination of the optimal closure time

[0141] The results are as follows Figure 6 As shown in E, IC50 decreases continuously with time and reaches the lowest at 3 hours, while AMAX / IC50 increases first and then decreases, reaching the maximum at 2 hours. Therefore, 2 hours is selected as the optimal blocking time.

[0142] 3.3.6 Determination of the Optimal Competitive Response Time

[0143] The results are as follows Figure 6 As shown in F, as the competition reaction time increases, IC50 continues to rise while AMAX / IC50 continues to decrease. When the competition reaction time is 45 minutes, AMAX / IC50 is the largest, so 45 minutes is selected as the optimal competition reaction time.

[0144] 3.3.7 Determination of the optimal enzyme-labeled secondary antibody reaction time

[0145] The results are as follows Figure 6 As shown in G, as the reaction time of the enzyme-labeled secondary antibody increases, IC50 continues to rise while AMAX / IC50 continues to decrease. When the secondary antibody reaction time is 30 minutes, AMAX / IC50 is the largest, so 30 minutes is selected as the optimal enzyme-labeled secondary antibody reaction time.

[0146] 3.4 Evaluation of IC-ELISA method for detecting porcine osteopontin

[0147] 3.4.1 IC-ELISA assay stability test

[0148] The experimental results are as follows Figure 7 As shown in the figure, after the reagents containing the standard, primary antibody, secondary antibody and ELISA plate were stored at 37°C for 7 days, it was found that the performance had not changed, indicating that the kit had good stability.

[0149] 3.4.2 Determination of the linear range and standard curve of IC-ELISA detection method

[0150] Establish IC-ELISA inhibition competition curve of OPN protein. Figure 8 As shown, in the range of 0.625-32 μg / ml, the curve shows a good linear relationship, and its linear equation is y=-0.3158x+1.294, R 2 =0.9956, IC50 is 3.14μg / mL, and the minimum detection limit is 0.027μg / ml. In the linear range, 0μg / ml, 0.625μg / ml, 1.25μg / ml, 2.5μg / ml, 5μg / ml, 10μg / ml, 20μg / ml, and 30μg / ml were selected as the standard curve detection range.

[0151] 3.4.3 Determination of the precision of IC-ELISA detection method

[0152] Precision is an important indicator to measure the intra-batch and inter-batch variation of the detection reagent. In the optimized detection reagent, the intra-batch coefficient of variation of each concentration is between 1.84% and 6.38%, with an average value of 3.53%, and the inter-batch coefficient of variation of each concentration is between 0.44% and 7.67%, with an average value of 1.72% (Table 1). Both the intra-batch and inter-batch coefficients of variation are less than 15%, indicating that the established IC-ELISA detection method has good repeatability.

[0153] Table 1. Inter-assay and intra-assay errors of IC-ELISA standard curves

[0154]

[0155] 3.4.4 Accuracy test

[0156] Osteopontin was diluted into low, medium and high concentrations and added to the samples. The added amount was controlled within the linear range of IC-ELISA. Each concentration was measured three times. The recovery rate was 92.13-102.5% and the coefficient of variation was 7.52-11.21% (Table 2).

[0157] Table 2. IC-ELISA recovery test of osteopontin in seminal plasma

[0158]

[0159] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the described embodiments. Any other changes, modifications, substitutions, combinations, and simplifications made without departing from the spirit and principles of the present invention shall be equivalent replacement methods and shall be included in the protection scope of the present invention. Sequence Listing <110> South China Agricultural University <120> Establishment of IC-ELISA method, kit and application for porcine osteopontin detection <160> 3 <170> SIPOSequenceListing 1.0 <210> 1 <211> 861 <212> DNA <213> Artificial Sequence <220> <223> OPN fragment sequence <400> 1 ctgcccgtga agcagacaaa cagcgggagc agcgaggaga agctgctgag cacaagtac 60 accgatgccg tggccact gctgaagccc gatcccagcc agaagcagac cttcctggcc 120 ccccagaaca ccattagctc cgaggagaca gatgatttca agcaggagac cctgcccagc 180 aagagcaacg agtcccccga gcagaccgac gacgtgtg atgatgatga cgaggaccac 240 gtcgactcca gggacaccga cagcgaggag gccgatcacg ccgacgatgc cgataggtcc 300 gacgagagcc accacagcga tgagtccgat gagctggtga cagactccc cacagacacc 360 cccgccaccg acgtgacccc cgccgtgccc accggcgacc ccaacgatgg ccgggggat 420 agcgtggtgt acggggctgcg gtccaagtcc aagagttta ggcggagcga ggcccagcag 480 ctggacgcca ccgaggagga cctgaccagc cacgtggaga gcgaggagac cgacggcacc 540 cccaaggcca tcctgtggc ccagaggctg cacgtggcct ccgacctgga ttcccaggag 600 aaggacagcc aggagacatc ccagcccgat gatggagcg tggagaccag gagccaggag 660 spagghagg agtacacaat spagacctac spagggghaggca spacecraft spacgtgatt 720 gagtcccagg agacccca ggtgagccag gagttccact cccacgagga tagctggtc 780 cccgatagca agagcgagga ggataagcac ctgaagctga gggtgagcca cgagctggag agcgccagca c 861. to cry <210> 2 <211> 34 <212> DNA <213> Artificial Sequence <220> <223> OPN-Ndel-F <400> 2 ggaattccat atgatgctgc ccgtgaagca gaca <210> 3 <211> 50 <212> DNA <213> Artificial Sequence <220> <223> OPN-EcoRI-6His-R <400> 3 ccggaattct tagtggtgat ggtggtggtg gttgatctcg ctgctggcgc

Claims

1. A method for establishing IC-ELISA detection of porcine osteopontin, characterized in that: The steps include: S1: Preparation of osteopontin: Based on the PET-32a(+) plasmid, the OPN gene sequence shown in SEQ ID NO.1 was inserted into the restriction sites NdeI and EcoRI to obtain the recombinant plasmid OPN-Pet-32a; The recombinant plasmid OPN-Pet-32a was transformed into Escherichia coli BL21 (DE3), cultured until the OD value was 0.4-0.6, 0.1 M IPTG was added to induce expression, and the cells were broken and the supernatant was collected; The target protein is purified by a nickel column, and the sodium chloride concentration in the eluent is 300 mM, thereby obtaining the osteopontin; S2: Preparation of monoclonal antibody against osteopontin: The antibody was prepared using the hybridoma cell line Cy2 with a deposit number of CCTCC NO: C2009293; S3: Establishment and evaluation of enzyme-linked immunosorbent assay: By using the chessboard titration method, different concentrations of antigen were coated in the horizontal gradient, and different concentrations of antibody were added in the vertical gradient. The coating concentration and antibody dilution multiple with an OD value between 1.0 and 1.5 were selected for the next step, and the optimal coating concentration was determined based on different combinations of Amax, IC50, and Amax / IC50; Under the above optimal coating concentration conditions, different coating times were set, and the optimal coating time was determined according to Amax / IC50 and IC50 at different times; Under the above optimal coating time conditions, different blocking times were selected, and the Amax / IC50 and IC50 at different blocking times were compared to determine the optimal blocking time; Under the above optimal blocking time conditions, select primary antibodies with different dilution multiples for incubation and select different incubation times, and compare the Amax / IC50 and IC50 of primary antibodies with different dilution multiples and different incubation times to determine the optimal primary antibody dilution multiple and primary antibody incubation time; Under the above-mentioned optimal primary antibody dilution multiple and primary antibody incubation time conditions, select secondary antibodies with different dilution multiples for incubation and select different incubation times, and compare Amax / IC50 and IC50 of secondary antibodies with different dilution multiples and different incubation times to determine the optimal secondary antibody dilution multiple and secondary antibody incubation time; Under the above-mentioned optimal secondary antibody dilution multiple and secondary antibody incubation time conditions, different color development times were selected, and the Amax / IC50 and IC50 of different color development times were compared to determine the optimal color development time; Under the above-mentioned optimal color development time conditions, standard protein solutions with different concentration gradients were used to draw a standard curve. The data were eliminated according to the experimental results until a linear relationship appeared. The experimental results that met R2>0.99 and CV%<15% were included in the linear range.

2. A kit for detecting porcine osteopontin IC-ELISA, characterized in that: The method comprises the following components: osteopontin prepared in step S1 of claim 1, coating solution, blocking solution, osteopontin monoclonal antibody prepared in step S2 of claim 1, secondary antibody, color developing solution TMB and stop solution H2SO4.

3. The kit for detecting porcine osteopontin IC-ELISA according to claim 2, characterized in that: The coating solution is a 0.1 mol / L carbonate buffer solution at pH 9.6, and each 250 mL system is prepared as follows: 0.375 g Na2CO3 and 0.732 g NaHCO3 are added to 250 mL distilled water; The blocking solution is 1% BSA-PBST, and each 100 mL system is prepared as follows: 1 g BSA is dissolved in 100 ml PBST.

4. The kit for detecting porcine osteopontin IC-ELISA according to claim 2, characterized in that: The secondary antibody is HRP-labeled goat anti-mouse IgG from Bio-Time.

5. A detection method using the IC-ELISA detection kit for porcine osteopontin according to any one of claims 2 to 4, characterized in that: Used for non-diagnostic purposes to detect the content of porcine osteopontin OPN in the sample to be tested.

6. The detection method according to claim 5, characterized in that: The sample to be tested is in vitro pig tissue, pig oocyte and / or pig semen.

7. A porcine osteopontin IC-ELISA detection method established based on the method for establishing porcine osteopontin IC-ELISA detection described in claim 1, characterized in that: The steps include: Coating: Dilute osteopontin with coating solution at a dilution ratio of 1:20,000, add to the ELISA plate, and coat at 4°C for 12 hours; Blocking: Wash the coated ELISA plate, add blocking solution, and block at 37℃ for 2 h; wash the blocked plate, dry it, and set aside; Competitive reaction: add the sample to be tested to the sealed ELISA plate and shake to mix; add osteopontin monoclonal antibody at a dilution of 1:100,000, keep at 37°C for 45 minutes, and wash the plate after the reaction is completed; Enzyme-labeled secondary antibody: Then add the secondary antibody at a dilution of 1:2000, incubate at 37°C for 30 min, and wash the plate after the reaction is complete; Color development: Add TMB colorimetric solution, incubate at 37°C for 10 min, and add 2M H2SO4 to terminate the reaction; Detection: OD450 and OD630 were measured by microplate reader, and the concentration of osteopontin in the sample to be tested was obtained through the standard curve, so as to achieve quantitative detection of osteopontin in the sample to be tested; wherein: the linear equation of the standard curve is y = -0.3158x +1.294, R²= 0.9956, and the minimum detection limit is 0.027 μg / ml.

8. The porcine osteopontin IC-ELISA detection method according to claim 7, characterized in that: The content of porcine osteopontin in the tested samples is in the range of 0.625-32 μg / ml.

Images