An Aeromonas strain and its application in immune regulation

Abstract

This invention discloses a method for constructing a sterile zebrafish model. The sterile zebrafish obtained through this method can be used to screen for intestinal microorganisms with active functions in hematopoiesis and immunity. The screened active intestinal microorganisms can be used to regulate the functions of the hematopoietic and immune systems; specifically, they can be used to regulate the intestinal and hematopoietic functions of patients with autism. This invention specifically discloses an Aero. veronii strain named b1-3 and its applications.

Description

Technical Field

[0001] The invention belongs to the technical field of biomedicine and relates to an Aeromonas strain and application thereof in immune regulation. Background Art

[0002] Animals are ecosystems composed of the body and its microbiota. There is increasing evidence that healthy microbiota has an important impact on the normal development of its host. 14 The microorganisms in the intestines cover more than 5,000 species. Studies have shown that the composition of intestinal flora is related to immunity, allergic diseases, intestinal inflammation, tumors, diabetes, cardiovascular disease and dyslipidemia, and the specific interaction mechanism still needs to be further studied.

[0003] The establishment and application of germ-free animal models provide a more powerful way to study the relationship between microbiota and host development. By comparing germ-free animals, germ-limited animals (animals inoculated with specific bacteria) and conventionally raised animals, the effects of specific bacteria on host development, physiological function, immunity, etc. can be evaluated. The germ-free animal model has become an important tool for studying the effects of microbiota on host function.

[0004] Compared with the traditional germ-free mouse model, zebrafish have the advantages of being small in size, easier to obtain in large quantities, convenient for rapid large-scale culture, and highly similar to mammals at the molecular, cellular, and tissue levels. From the perspective of drug development, it is of potential application significance to find bacteria that have a regulatory effect on immunity in order to improve the body's abnormally low or hyperactive immunity by regulating the intestinal flora. Summary of the invention

[0005] In order to solve the above technical problems, the first aspect of the present invention provides a method for constructing a sterile zebrafish model, which is characterized by comprising the following steps: 1) mating adult male and female zebrafish and collecting fertilized eggs; 2) culturing the fertilized eggs in an embryo culture medium containing antibiotics; 3) soaking the embryos in a disinfectant and / or a bleaching solution; 4) testing the sterility of the embryos.

[0006] Furthermore, the antibiotics are selected from ampicillin, kanamycin and amphotericin B; the disinfectants are PVP-I and sodium hypochlorite (NaClO).

[0007] Furthermore, the dosage of ampicillin is 100 ng / mL, the dosage of kanamycin is 5 mg / mL, and the dosage of amphotericin B is 250 ng / mL.

[0008] Furthermore, the embryo culture medium is ABEM.

[0009] Furthermore, the PVP-I is used at a concentration of 0.1%, and the soaking time is about two minutes; the sodium hypochlorite bleaching solution has a concentration of 0.003%, and the soaking time is about 20 minutes.

[0010] The second aspect of the present invention provides the use of the germ-free zebrafish model obtained by the construction method described in the first aspect of the present invention in drug screening.

[0011] Furthermore, the drug is an intestinal microorganism that can regulate the functions of the hematopoietic system and the immune system.

[0012] Furthermore, the intestinal microorganisms can regulate the hematopoietic system and / or immune system function of zebrafish, humans, and other animals.

[0013] Furthermore, the drug can regulate intestinal and hematopoietic dysfunction in autistic patients.

[0014] The third aspect of the present invention provides a drug screening method, characterized in that it includes colonizing wild zebrafish intestinal flora in germ-free zebrafish to screen intestinal microorganisms that have regulatory effects on the hematopoietic system and the immune system.

[0015] Furthermore, the germ-free zebrafish is obtained by the method described in the first aspect of the present invention.

[0016] The fourth aspect of the present invention provides intestinal microorganisms obtained by screening by the screening method described in the third aspect of the present invention.

[0017] The fifth aspect of the present invention provides an Aeromonas veronii (Aero. Veronii) strain, named b1-3, which was deposited on February 28, 2022 at the General Microbiology Center of the China Culture Collection Administration, Institute of Microbiology, Chinese Academy of Sciences, No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing, with a deposit number of CGMCC No. 24443.

[0018] The sixth aspect of the present invention provides the use of the intestinal microorganisms described in the fourth aspect of the present invention or the Aero.Veronii strain b1-3 described in the fifth aspect of the present invention in the preparation of drugs for regulating the hematopoietic system and immune system functions; preferably, the preparation of drugs for regulating the hematopoietic system and immune system of autistic patients.

[0019] The beneficial effects of the present invention are:

[0020] 1) The method for constructing a sterile zebrafish model provided by the present invention is more convenient, faster, and easy for large-scale screening compared to the mouse model construction method. It is more systematic than the cell culture method, and the results can better reflect the real situation of the complex environment of the body.

[0021] 2) By using the germ-free zebrafish model constructed by the present invention and combining it with the in situ hybridization method, the expression quantity of hematopoietic stem cells and immune cells such as lymphocytes, neutrophils, and macrophages can be examined, so as to achieve the purpose of large-scale screening of intestinal microorganisms that are active on the hematopoietic system and immune system; the germ-free model of the present invention is conducive to further studying the mechanism of the effect of intestinal flora on the development of the hematopoietic system and immune regulation of the body from the molecular mechanism level.

[0022] 3) The present invention screened out the strain Aeromonas veronii b1-3 that has a regulatory effect on hematopoietic stem cells and immunity. It can be colonized into the intestine of zebrafish embryos to improve the intestinal microenvironment, thereby reducing the abnormally increased immune and inflammatory state of autistic zebrafish, and ultimately restoring the abnormalities of hematopoietic stem cells and immune cells in the autistic fish. It has potential application value in improving the intestinal and hematopoietic dysfunction of autistic patients. BRIEF DESCRIPTION OF THE DRAWINGS

[0023] In order to more clearly illustrate the specific implementation methods of the present invention or the technical solutions in the prior art, the drawings required for use in the specific implementation methods or the description of the prior art will be briefly introduced below. Obviously, the drawings described below are some implementation methods of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0024] Figure 1 The expression of hematopoietic stem cells (cmyb), lymphocytes (rag1), neutrophils (mpx), and granulocytes (L-plastin) in zebrafish under conventional (CV) and germ-free feeding (GF) environments.

[0025] Figure 1 A shows the difference in cmyb expression. Figure 1 B shows the differences in expression of rag1, mpx, and L-plastin.

[0026] Figure 2 The number of myeloid progenitor cells in conventionally fed (CV), germ-free (GF), and germ-free (CONV, conventionalized) embryos.

[0027] Figure 3 Effects of different intestinal strains on hematopoietic stem cells in germ-free zebrafish embryos.

[0028] Figure 4 Effects of Aeromonas 1 strain on neutrophils in germ-free zebrafish embryos.

[0029] Figure 5Whole genome sequencing results of Aeromonas veronii strain b1-3.

[0030] Figure 6 In situ hybridization technology was used to detect the effect of intestinal flora treatment on the level of hematopoietic stem cells (cmyb) in chd8- / - zebrafish and wild-type zebrafish.

[0031] Figure 7 In situ hybridization technology was used to detect the effect of intestinal flora treatment on the level of neutrophils (mpx) in chd8- / - zebrafish and wild-type zebrafish.

[0032] Figure 8 Effects of Aero.veronii strain b1-3 on hematopoietic stem cell levels in a zebrafish model of autism.

[0033] Fig. 9 Effects of Aero.veronii strain b1-3 on neutrophil levels in a zebrafish model of autism.

[0034] Fig.10 Effect of Aero.veronii strain b1-3 on the level of pro-inflammatory cytokine tumor necrosis factor (TNFα) in a zebrafish model of autism. DETAILED DESCRIPTION

[0035] The present invention is further described below. The implementation cases introduced in this description are only exemplary and do not limit the scope of the present invention. It should be understood by those skilled in the art that without departing from the principles and methods of the present invention, the details and forms of the technical solution of the present invention may be partially modified or replaced, but such modification or replacement is within the scope of protection of the present invention.

[0036] If no specific experimental steps or conditions are specified in the examples, the conventional experimental steps or conditions described in the literature in the field can be used. If no manufacturer is specified for the reagents or instruments used, they are all conventional reagent products that can be obtained commercially.

[0037] The term "dpf" used in the present invention refers to days after fertilization. For example, "3dpf" refers to three days after fertilization, and "5dpf" refers to five days after fertilization.

[0038] Example 1 Construction of germ-free zebrafish model and its functional detection

[0039] 1.1 Construction of germ-free zebrafish model

[0040] The method for constructing the germ-free zebrafish embryo model is as follows: mature zebrafish are placed in a spawning tank at a ratio of 2:1 between female and male, and the partition is removed the next morning to allow the adult male and female zebrafish to mate and lay eggs. Fertilized eggs are collected 1 hour later and transferred to embryo culture medium containing antibiotics (ampicillin (100 μg / mL), kanamycin (5 μg / mL) and amphotericin B (250 ng / mL)) (see below for the specific configuration method), and placed in a 28.5°C incubator for culture. Healthy embryos are selected every 2 hours and placed in a new culture dish containing antibiotic embryo culture medium, and transferred to a biosafety cabinet after incubation for 4-6 hours. The embryos were washed three times with sterile embryo culture medium, immersed in 0.1% PVP-I solution (Adamas, 42099A) for 2 min, washed three times with sterile embryo culture medium, immersed in 0.003% bleach solution (Aladdin, S101636) for 20 min, and washed again three times with sterile embryo culture medium. Healthy embryos were selected and transferred to tissue culture bottles containing 20 ml of sterile embryo culture medium, with 20 embryos in each bottle, and cultured in an incubator at 28.5°C.

[0041] Embryos 3 days after fertilization (3dpf) were mechanically deshelled by pipetting, and 500μl of culture medium was added to LB liquid medium and cultured overnight at 28.5℃ to test the sterility of the embryos.

[0042] Stock solution A: 250 mL deionized water (ddH2O), 20 g NaCl (Sinopharm, 10019318), 1 g KCl (Sinopharm, 10016308);

[0043] Stock solution B: 100 mL ddH2O, 0.358 g anhydrous Na2HPO4 (Sinopharm, 20040690), 0.6 g KH2PO4 (Titan Greagent, G82821B);

[0044] Stock solution C: 250 mL ddH2O, 4.68 g CaCl2·2H2O (Adamas, 10224A);

[0045] Stock solution D: 250 mL ddH2O, 6.15 g MgSO4·7H2O (Sinopharm, M110776);

[0046] Stock solution E: 250 mL ddH2O, 8.75 g NaHCO3 (Sinopharm, 10018990)

[0047] Preparation of embryo culture medium working solution: Add 50mL of stock solution A, 5mL of stock solution B, 50mL of stock solution C, 50mL of stock solution D, and 50mL of stock solution E to 5L of ddH2O, and adjust the pH to 7.2 with hydrochloric acid (National Pharmaceutical Group, 53100277). Filter the prepared embryo culture medium with a 0.22μm sterile filter to obtain sterile embryo culture medium.

[0048] Preparation of embryo culture medium containing antibiotics:

[0049] To 500 mL of embryo culture medium, add 500 mL of 100 mg / mL ampicillin (Sinopharm, XW00695342) stock solution (final concentration 100 mg / mL), 50 mL of 50 mg / mL kanamycin (Aladdin, K103024) stock solution (final concentration 5 mg / mL), and 15.6 mL of 8 mg / mL amphotericin B (Aladdin, A105482) stock solution (final concentration 250 ng / mL) prepared with dimethyl sulfoxide (Adamas, 75927N).

[0050] 1.2 In situ hybridization to detect hematopoietic stem cells and immune cells in germ-free zebrafish

[0051] Embryos at 3dpf, 5dpf and 6dpf were fixed with 4% paraformaldehyde (PFA) (Adamas, 46556B). The fixed embryos were bleached and dehydrated, and then hybridized by in situ hybridization (Thisse and Thisse, Nat Protoc 3(1):59-69, 2008) to c-myb (myeloid progenitor cells, which can reflect the number of hematopoietic stem cells) (Mahony, Fish et al. Blood 128(10):1336-1345, 2016), rag1 (lymphoid progenitor cells) (Xue, Liu et al. Cell Rep 27(5):1567-1578.e1565, 2019), L-plastin (granulocytes) (Mahony, Fish et al. Blood 128(10):1336-1345, 2016), mpx (neutrophils) (Cai, Wang et al. al.Cance Science, 112(9):3884-3894, 2021) was used as a marker molecule to compare the number of different blood cells in embryos raised conventionally (CV) and germ-free (GF). Figure 1 A and Figure 1As shown in B, it can be seen that after sterile treatment, the number of hematopoietic stem cells (cmyb), lymphocytes (rag1), neutrophils (mpx), and granulocytes (L-plastin, neutrophils and macrophages) of embryos (GF) lacking intestinal symbiotic microorganisms are significantly lower than those of normally cultured zebrafish embryos.

[0052] Example 2 Intestinal microbial repopulation of germ-free zebrafish

[0053] The culture medium of 3dpf sterile zebrafish embryos (culture medium without sterilization treatment) obtained according to the method described in Example 1 was added to allow the sterile embryos to regain the intestinal microorganisms of the normal development stage. The 5dpf embryos were fixed, and c-myb (myeloid progenitor bacteria) was used as a marker molecule to compare the number of myeloid precursor cells in conventionally raised (CV), sterile raised (GF) and sterile re-inoculated with bacteria (CONV, conventionalized), which can reflect the importance of intestinal microorganisms to hematopoietic stem cells. The results are as follows Figure 2 As shown, it can be seen that the number of hematopoietic stem cells in sterile embryos can be restored after re-inoculating them with the intestinal commensal flora.

[0054] Example 3 Isolation and screening of intestinal flora of zebrafish

[0055] Adult wild-type zebrafish were anesthetized in a solution containing 0.016% tricaine (TicAid, T0941). The complete intestinal tissue of the zebrafish was removed under a microscope under sterile conditions. The intestinal tissue was fully ground with a glass grinding rod. The broken tissue was resuspended in 500 μl sterile saline and diluted 10-fold to 10 -6 . 100 μl of each dilution was spread on a LB agar medium (Sangong Biotechnology, B530111) culture plate, and the culture plate was cultured at 28.5℃ for about 48 hours. Single colonies of different morphology on the culture plate were picked, and after colony amplification, 20% glycerol (Adamas, 66258C) was frozen at -20℃ for analysis. After full-length sequencing of the 16s rRNA gene, the NCBI database was compared, and duplicate strains were removed, and a total of 31 strains of 10 bacterial genera were obtained. The 10 bacterial genera are Acinetobacter, Aeromonas, Exiguobacterium, Klebsiella, Microbacterium, Mycobacterium, Plesiomona, Pseudomonas, Shewanella, and Staphylococcus.

[0056] Example 4 Verification of the effect of specific strains in zebrafish intestine

[0057] Add 10 4 cfu / ml of a specific strain of bacteria culture, PFA fixation of 5dpf embryos, bleaching and dehydration of the sample, in situ hybridization with c-myb as the marker molecule to detect the effect of the specific strain on the development of hematopoietic stem cells. Through the above model method, we screened the bacteria isolated from the zebrafish intestine. From the results, we can see that some strains have a promoting effect on the sterile zebrafish embryos, while some strains have no promoting effect ( Figure 3 ).

[0058] In addition, 5dpf embryo samples were analyzed by in situ hybridization using mpx as a marker. The results showed that although Aeromonas 1 had no promoting effect on hematopoietic stem cells, it increased the expression of neutrophils ( Figure 4 ). The whole genome of Aero.1 was sequenced for more in-depth strain identification and functional gene analysis ( Figure 5 ). According to the whole genome sequencing results, Aero.1 is Aero.Veronii, strain number b1-3. Aero.Veronii b1-3 strain has been deposited in the General Microbiology Center of China Microbiological Culture Collection Administration Committee, Institute of Microbiology, Chinese Academy of Sciences, No. 3, No. 1 Beichen West Road, Chaoyang District, Beijing on February 28, 2022, with a deposit number of CGMCC No.24443. Example 5 Effect of normal zebrafish intestinal flora on autism zebrafish model after sterilization (chd8 - / - )

[0059] 5.1chd8 - / - Construction and sterile treatment of autism zebrafish model

[0060] The zebrafish chd8 gene knockout strain was constructed using CRISPR / Cas9 technology. The sgRNA sequence was: 5'-GGTGTGTCTGCTTCAGGATG AGG-3', located in exon 12 of the chd8 gene. The sequence was ligated into the pDR274 (Addgene plasmid #42250) plasmid to obtain the plasmid pDR274-chd8-sgRNA, which was then linearized with HindIII-HF (NEB, R3104S) and MAXIscript TMT7 transcriptase (Ambion, AM1312) was used to transcribe chd8 sgRNA. The chd8 sgRNA and Cas9 mRNA were injected into zebrafish embryos in a single-cell state. When the embryos grew to 2 to 3 months old, part of the tail fin tissue was cut, and DNA was extracted using the T7E1 kit (NEB, M0302S) to identify and screen mutant zebrafish (Babon, McKenzie et al. Methods Mol Biol 152: 187-199, 2000). Further sequencing and identification revealed a 5 bp deletion mutation (5'-gactatgtatatgtggtgtgtctgcttcagG ATGAG GAACCTTTCAATCCAGATTA TGTGGAAGTTGATCGTATTTTGGACGAGTCACATAGTGTTGATAAA GACAACGGGGAGgtagg-3', the underlined bases are the deleted bases).

[0061] Sterile chd8 - / - The method for establishing the zebrafish embryo model is the same as the method for establishing the wild-type germ-free zebrafish embryo model in Example 1.1.

[0062] 5.2 Intestinal flora treatment of autism zebrafish model

[0063] In situ hybridization was used to detect the effects of intestinal flora treatment on chd8 - / - The effects of cytotoxicity on the levels of hematopoietic stem cells (cmyb) and neutrophils (mpx) in zebrafish and wild-type zebrafish were shown in Figures 6 and Figure 7 ), under normal environment, chd8 mutation (chd8 - / - Compared with the wild-type (WT) fish line, the number of hematopoietic stem cells (cmyb) in the chd8 zebrafish line was reduced, and the number of neutrophils (mpx) was significantly increased. After sterilization, the microbiota from the wild-type zebrafish culture medium was re-inoculated, which could make the chd8 - / - The number of hematopoietic stem cells in mutant embryos increased and the number of neutrophils decreased, approaching the normal state.

[0064] Example 6 Functional study of Aero. Veronii b1-3 on autism zebrafish model

[0065] Aero.1 (Aero.veronii strain b1-3) was added to the culture medium of 3dpf autistic zebrafish embryos with chd8 gene mutation. At 5dpf, in situ hybridization was used to detect the number of hematopoietic stem cells in the tail (CHT) of zebrafish. The results showed that Aero.veronii strain b1-3 could increase the expression of chd8- / - The number of hematopoietic stem cells ( Figure 8 ).

[0066] Please use q-PCR to detect the expression level of neutrophil gene (mpx, primer F: 5'-TCCAAAGCTATGTGGGATGTGA-3', primer R: 5'-GTCGTCCGGCAAAACTGAA-3') in the whole body of embryos at 7dpf. The results show that under normal circumstances, due to the high inflammatory state of the body caused by the disease, the neutrophil level in autistic zebrafish embryos is abnormally increased compared with wild-type zebrafish. Sterile treatment of chd8 - / - embryos can reduce the expression level of mpx and relieve inflammation. - / - After the Aero.veronii strain b1-3 was added, the number of neutrophils in the whole body was also reduced, making chd8 - / - The abnormally hyperactive immune state in the mutant model was alleviated ( Fig. 9 ).

[0067] Example 7 Effect of Aero. Veronii strain b1-3 on the level of pro-inflammatory factor tumor necrosis factor (TNFα) in autism model zebrafish

[0068] At 7dpf, the hematopoietic stem cells of zebrafish migrate to their kidneys (similar to the bone marrow of mammals). Therefore, RT-qPCR was used to detect the expression level of the TNFα gene in the kidneys at 7dpf (primer F: 5'-GCGCTTTTCTGAATCCTACG-3', primer R: 5'-TGCCCAGTCTGTCTCCTTCT-3') (He, Zhang et al. Blood 125(7): 1098-1106, 2015) to reflect the expression level of this factor in its hematopoietic stem cells.

[0069] Depend on Fig.10 It can be seen that given normal chd8 - / - After adding Aero.veronii strain b1-3 to the culture medium, the expression level of tumor necrosis factor in the kidney was reduced, and chd8 - / - The abnormally hyperactive immune state in the mutant model was alleviated.

[0070] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent structural change made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. An Aeromonas veronii strain, named b1-3, has been deposited in the General Microbiological Center of China Microbiological Culture Collection Administration with a deposit number of CGMCC No.24443.

Images