The GNBP1 gene of Gram-negative bacteria recognition protein of Coptotermes nigropteroides and its application

Abstract

The invention discloses a targeted silencing black-winged termite Gram-negative bacteria recognition protein GNBP1 dsRNA of the gene and its application in termite control. Among them, black-winged termite GNBP1 The nucleotide sequence of the gene is SEQ ID NO: 1. This patent establishes a method for feeding black-winged termites GNBP1 RNA interference system, found that the black-winged termite GNBP1 dsRNA has a high lethality rate against termites. GNBP1 The combination of dsRNA and biocontrol bacteria can significantly improve the control effect of biocontrol bacteria. GNBP1 We designed dsRNA and established a feeding method for the black-winged termite GNBP1 RNA interference system, and concluded that feeding had a significant gene silencing effect in black-winged termites. GNBP1 Provided technical support for RNAi technology application.

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to a protein for recognizing gram-negative bacteria of black-winged termites GNBP1 Genes and their applications. Background Art

[0002] Termites are one of the most famous pests in the world. They are social insects with strong reproductive and survival abilities. They mainly harm buildings, agricultural and forestry crops, reservoir dams, cable bridges, transportation facilities, etc. They also often damage non-cellulose materials. Odontotermes formosanus Shiraki is a higher termite and a type of soil termite. It spends most of its time underground. It mainly uses worker ants to harm the bark, shallow wood layer, and roots. It causes large ant trails to form outside the damaged tree trunk, and the growth declines. When it invades the wood, the trunk withers; especially for seedlings, it is very easy to cause death. When feeding damage, it forms mud blankets and mud lines. In severe cases, the mud blanket surrounds the entire trunk to form a mud sheath, which is very characteristic. Black-winged soil termites are the main pests of reservoirs and river dams, and can often cause dam leakage, landslides and breaches (Li Dong et al., 2001; Cai Banghua et al., 1965; Xu Zhenhai, 2004; Xu Zhide et al., 2007). Because the nests of black-winged soil termites are very hidden, the damage they cause is not easy to be discovered. When they are discovered, the damage is already very huge. In addition, black-winged termites have a diverse diet and a wide range of damage, and can harm more than 100 species of plants including camphor, fir, magnolia, and maple (Huang Qiuying et al.; 2005).

[0003] At present, the control of black-winged termites still mainly relies on traditional chemical pesticides, but problems such as pesticide residues are becoming increasingly serious, posing a potential threat to human and animal health and the ecological environment. Therefore, it is imperative to discover new biological control methods and explore new strategies for the control of black-winged termites. RNA interference (RNAi) refers to the phenomenon in which double-stranded RNA (ds RNA) induces homologous mRNA degradation in eukaryotic organisms, silencing target gene expression. In the study of insect gene function, gene interference is generally carried out by introducing exogenous dsRNA or small interfering RNA (si RNA). RNAi can achieve sustainable control of pest populations by selectively interfering with the expression of key insect genes, and is highly anticipated in the field of pest control. Gram-negative binding proteins GNBPs, also known as β-1, 3-glucan recognition proteins (βGRPs), are members of the same family. They were first discovered and named in silkworms. They are mainly responsible for fungal recognition (Beaulaton et al., 1979) and play an important role in subsequent immune signal transduction and initiating antimicrobial peptide gene expression. Silencing this gene can reduce the ability of termites to resist infection by pathogenic microorganisms and eventually lead to their death. Therefore, it is expected that dsRNA can be designed for the GNBP gene through RNA interference technology for the control of black-winged termites. Summary of the invention

[0004] The object of the present invention is to provide a method for GNBP1 The application of dsRNA of genes in termite control. Among them, black-winged termites GNBP1 The gene was first discovered by the applicant. Based on the gene, dsRNA is designed and introduced into termites, which can effectively prevent and control black-winged termites.

[0005] Specifically, the present invention proposes a black-winged termite Gram-negative bacteria recognition protein GNBP1 Gene, the GNBP1 The nucleotide sequence of the gene is shown in SEQ ID NO: 1. The corresponding amino acid sequence is shown in SEQ ID NO: 2.

[0006] The present invention further proposes GNBP1 The application of genes in termite control.

[0007] At the same time, the present invention proposes a method for preventing and controlling termites. GNBP1 The dsRNA is transcribed from the nucleotide sequence shown in SEQ ID NO:1.

[0008] The present invention also provides the encoding right above GNBP1 dsRNA DNA.

[0009] Furthermore, the present invention provides a recombinant expression vector comprising the above-mentioned DNA encoding dsRNA.

[0010] The present invention also provides a host bacterium for transforming the recombinant expression vector.

[0011] In another aspect, the present invention provides a method for controlling termites, comprising the following steps: GNBP1 The dsRNA is fed to termites, and the dsRNA is transcribed from the nucleotide sequence shown in SEQ ID NO: 1.

[0012] As another method of controlling termites, you can use GNBP1 The dsRNA and Serratia marcescens SM1 are fed to termites together, wherein the dsRNA is transcribed from the nucleotide sequence shown in SEQ ID NO: 1.

[0013] Beneficial effect: The present invention is based on immune recognition protein GNBP1 The dsRNA was designed by gene, and the feeding method was established to kill black-winged termites GNBP1 RNA interference system, and concluded that feeding had a significant gene silencing effect in black-winged termites. GNBP1 The application of RNAi technology provides a theoretical basis. At the same time, by using the HT115 strain to construct a dsRNA expression system, the interference cost is reduced. The present invention successfully interferes with the immune recognition protein using this system. GNBP1 Gene expression and found GNBP1 The gene-silenced black-winged termites were significantly more sensitive to the SM1 strain of Serratia marcescens. GNBP1 When dsRNA and SM1 were used together, the mortality rate of termites was significantly increased, indicating that it can improve the control effect of biocontrol bacteria; it was also found that when used alone GNBP1 dsRNA can also control black-winged termites, and its effect is comparable to that of SM1 alone. GNBP1 It provides a theoretical basis for the application of dsRNA in termite control. BRIEF DESCRIPTION OF THE DRAWINGS

[0014] Figure 1 This is the electrophoresis diagram of total RNA of Coptotermes nigropteroides;

[0015] Figure 2 for GNBP1 The cloned sequence and deduced amino acid sequence of

[0016] Figure 3 Treating black-winged termites with Serratia marcescens GNBP1 Expression level;

[0017] Figure 4 For L4440-ds GNBP1 and L4440-ds GFP The electrophoresis results of the recombinant plasmid, where 1 is L4440-ds GFP , 2 is L4440-ds GNBP1 ;

[0018] Figure 5 is the result of dsRNA digestion electrophoresis, where 1 is ds GFP , 2 is ds GNBP1 ;

[0019] Figure 6 Relative expression levels of target genes sampled at different times after dsRNA feeding, where: Note: Different lowercase letters indicate significant differences among treatments; ABCD are 3, 6, 12, and 24 h, respectively;

[0020] Figure 7 is the survival analysis after 6 h of dsRNA treatment, where ABCDEF are 11, 16, 21, 26, 31, and 36 h, respectively; G is the survival analysis graph, and the dotted line is the time of SM1 treatment. DETAILED DESCRIPTION

[0021] The experimental methods used in the following examples are conventional methods unless otherwise specified, and the materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0022] Experimental materials and methods involved in the examples:

[0023] (1) Test insects: Black-winged termites were collected from Jurong City, Jiangsu Province. After the ant nests were collected, they were placed in an insect incubator at 27°C in the dark for breeding.

[0024] (2) Cultivation of Serratia marcescens SM1

[0025] Culture medium: Bacterial basal medium (g / L): peptone 10 g, beef extract 20 g, NaCl 2 g, K2HPO4 2 g, agar 18 g pH 7.2~7.4.

[0026] Bacterial seed medium (g / L): peptone 10 g, yeast extract 20 g, NaCl 2 g, K2HPO4 2 g.

[0027] Bacterial fermentation medium (g / L): peptone 10 g, soybean oil 30 g, NaCl 2 g, K2HPO4 2 g.

[0028] The isolated Serratia marcescens strain SM1 was transferred to the bacterial basal medium and cultured in the dark at 27 °C for 24 h. After streaking, a single colony was obtained. A single colony was taken out and placed in a sterilized 250 mL conical flask containing 50 mL seed culture medium. It was cultured in a constant temperature shaker at 30 °C and 200 r / min for 12 hours for seed liquid culture. Then 70 ml of the cultured seed liquid was added to 250 ml of fermentation medium, and cultured in a shaking incubator at a speed of 200 r / min at 30 °C for 36 hours. After culture, it was taken out for use.

[0029] (3) Determination of the concentration of Serratia marcescens SM1 fermentation broth

[0030] Within a certain range, as the number of bacteria in the fermentation broth of Serratia marcescens SM1 increases, its OD 600 The value of also increases. The present invention is further described in detail below in conjunction with specific examples, which will help to understand the present invention, but the protection scope of the present invention is not limited to the following examples.

[0031] Example 1 GNBP1 Gene cloning

[0032] (1) Primer design: Based on transcriptome data GNBP1 The primers were designed using Primer5 software:

[0033] GNBP1 F:ACTTCAGCGGCCATTCG;

[0034] GNBP1 R: TTTATGCTGCTATCAGTGCTTC.

[0035] (2) cDNA amplification and TA cloning:

[0036] The total RNA of termites was extracted by Trizol method.

[0037] The total RNA extraction results of black-winged termites (such as Figure 1 ). The nucleic acid detector detects the OD of RNA 260 / OD 280 The ratio is 1.855, which is between 1.8 and 2.0, indicating that the RNA quality is acceptable and the next step of the experiment can be carried out.

[0038] Total RNA was used as a template and reverse transcription was performed according to the instructions of First Strand cDNA Synthesis Kit of TaKaRa Company to synthesize cDNA. The reverse transcription system is shown in Table 1.

[0039] Table 1

[0040]

[0041] Using cDNA as template and primers GNBP1 F. GNBP1 R, amplified, and obtained a 1527 bp fragment, the sequence of which is shown in SEQ ID NO.1. The full-length sequence contains an open reading frame of 1159 bp, encoding a 378 amino acid polypeptide, such as Figure 2 The PCR amplification reaction system is shown in Table 2. The PCR amplification reaction conditions are: 94 °C pre-denaturation for 3 min; 94 °C denaturation for 30 s, 64.5 °C annealing for 30 s, 72 °C extension for 30 s, for a total of 35 cycles; 72 °C final extension for 10 min. The PCR amplification products were detected by 1% agarose gel electrophoresis and photographed under a gel imaging system. The correct PCR products were purified and recovered by gel recovery kit. The TA cloning conditions are shown in Table 3. The gel recovery products were connected with pClone007 at room temperature for 1-5 min, and the connection products were transformed into E.coli DH5α competent cells. The transformation of the connection products:

[0042] (1) Take out the E. coli DH5α competent cells from the −80°C refrigerator and dissolve them in ice water;

[0043] (2) Use a pipette to add 10 uL of the ligation product to 100 uL of E.coli DH5α competent cells and place on ice for 30 minutes;

[0044] (3) Heat shock in a 42°C water bath for 45 seconds, then immediately place in ice water for 2 minutes;

[0045] (4) Add SOC or LB liquid culture medium and culture at 37°C and 200 rpm for 1 h;

[0046] (5) Spread 200 μL of bacterial solution on LB solid medium containing Amp penicillin (final concentration 50 μg / mL) and culture inverted in a 37°C incubator overnight.

[0047] The transformation product was cultured in LB (Amp + ) solid medium for 12-16 h. The positive clones were selected and identified by bacterial liquid PCR. The recombinant plasmid containing the correct insertion fragment was named pClone007-GNBP1 , sent to the company for sequencing.

[0048] Table 2

[0049]

[0050] Table 3

[0051]

[0052] Example 2 Effect of Serratia marcescens SM1 on black-winged termites GNBP1 Inducible expression of

[0053] Toxic experiment: First, filter paper was placed on the bottom of each 9 cm culture dish and moistened with water. Then, 20 black-winged termite workers with good vitality and development were placed in the culture dish. The fermentation medium of Serratia marcescens SM1 was used as a control. Each concentration (2.139×10 11 cells / ml, 2.139×10 10 cells / ml, 2.139×10 9 The bacterial solution of 100 cells / ml was dripped on the black-winged termites with a 0.12μL micropipette, and each group was repeated three times. After dripping, it was placed in a dark environment at 25℃ for observation and sampling. The samples were collected at 3, 6, 12, and 24 hours, and stored at -80℃.

[0054] like Figure 3 As shown in the fluorescence quantitative experiment, it was found that the concentration of 2.139×10 9 After treating black-winged termites with SM1 at a concentration of cells / ml, GNBP1 At 3 h, 6 h, 12 h and 24 h of treatment, the expression of β-catenin was significantly upregulated. 10 After treating black-winged termites with SM1 at a concentration of cells / ml, GNBP1 At 3 h, 6 h, 12 h and 24 h of treatment, the expression of 11 After treating black-winged termites with SM1 at a concentration of cells / ml, GNBP1 The expression level was up-regulated only at 3 h, and was significantly down-regulated at 6 h, 12 h and 24 h.

[0055] Example 3 Termites GNBP1 Synthesis and induction of gene expression by dsRNA

[0056] (1) Termites GNBP1 Primer design for dsRNA of genes.

[0057] Prediction by online software GNBP1There are potential RNAi target sites at 186 bp to 622 bp. GNBP1 The primers were designed using Primer5 software:

[0058] ds GNBP1 F: ATTT GCGGCCGCACAGCATCAGGAGGTGGC;

[0059] ds GNBP1 R: CCC AAGCTTTCGTCCGTCCATTTCATTT,

[0060] And introduce restriction sites NotⅠ and HindⅢ in the upstream and downstream (bold letters are restriction sites, italic letters are protected bases). GFP The primers are:

[0061] ds GFP F: ATCG GAGCTCAGTTGAACGGATCCATCTTCA;

[0062] ds GFP R: CCC AAGCTTAGAACTTTTCACTGGA,

[0063] And the restriction sites (SacI) and HindⅢ were introduced upstream and downstream. All primers were synthesized by Tianjin Qingke Biotechnology Co., Ltd.

[0064] (2) Termites GNBP1 Synthesis of dsRNA of genes.

[0065] Using sequencing to GNBP1 Full-length plasmid pClone007- GNBP1 As a template, the upstream and downstream primers designed for synthesizing dsRNA were used. GNBP1 F and ds GNBP1 R was used for PCR amplification; the PCR amplification reaction conditions were: 94 ℃ pre-denaturation for 3 min; 94 ℃ denaturation for 30 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 30 s, for a total of 35 cycles; 72 ℃ final extension for 10 min. The PCR amplification products were detected by 1% agarose gel electrophoresis and photographed under a gel imaging system. The correct PCR products were purified and recovered using a gel recovery kit.

[0066] (3) Construction of dsRNA expression vector.

[0067] Using the GFP protein nucleic acid sequence available in the laboratory as a template, a 500 bp fragment was cloned. The target fragment and the L4440 vector were digested and linked, and L4440-ds was successfully constructed. GNBP1 and L4440-ds GFP Recombinant plasmid. L4440-ds GNBP1 and L4440-ds GFP The results of recombinant plasmid electrophoresis are as follows Figure 4 shown.

[0068] Specifically, L4440-ds GNBP1 As an example, the above PCR product was double-digested with NotⅠ and HindⅢ to recover the target fragment; at the same time, the expression vector L4440 was double-digested with these two enzymes to recover the target vector. The target fragment double-digestion system and the vector double-digestion system are shown in Table 4 and Table 5, respectively. The target fragment and the target vector were connected at 16℃ for 16 h under the action of T4 DNA ligase. The ligation product was transformed into E. coli DH5α competent cells and cultured in LB (ampicillin) solid medium for 12 h. After selecting the positive clones and identifying them by enzyme digestion, the recombinant plasmid containing the correct inserted fragment was named L4440-ds GNBP1 , sent to the company for sequencing.

[0069] Table 4

[0070]

[0071] Table 5

[0072]

[0073] (4) Induced expression and extraction of dsRNA.

[0074] Containing L4440-ds GNBP1 and L4440-ds GFP The recombinant plasmid was expressed by induced dsRNA in HT115 strain, and the total RNA after induced expression was digested with DNaseⅠ and RNase A. The electrophoresis results showed that the bacterial DNA and RNA were degraded, and the target bands were 596 bp and 500 bp, which were consistent with ds GNBP1 With ds GFP The expected size is consistent, and the interference vector is successfully constructed ( Figure 5 ).

[0075] L4440-ds GNBP1 For example, the sequenced L4440-ds GNBP1 The recombinant plasmid was transformed into HT115 (DE3) competent bacteria and spread on a plate containing ampicillin (50 μg∙mL -1) and tetracycline (12.5 μg∙mL -1 ) double antibody on LB solid medium, invert and culture overnight at 37 °C. Pick a single clone and inoculate it in a medium containing ampicillin (50 μg∙mL -1 ) and tetracycline (12.5 μg∙mL -1 ) in LB liquid medium with double antibodies, 37 ℃, 220 r∙min -1 The culture was shaken until the bacterial solution OD 600 When the concentration was about 0.5-0.6, IPTG (final concentration 0.8 mM) was added and the mixture was incubated at 37 °C and 220 r∙min. -1 Continue to shake and culture for 3 h, then use TaKaRa RNAisoPlus to extract dsRNA. Use RNAse H and DNAse I to digest dsRNA. Use Eppendorf BioSpectrometer basic for quantification to a final concentration of 1 μg / μL. Store in a -80℃ ultra-low temperature freezer for later use.

[0076] Example 4 After RNAi GNBP1 Detection of expression level.

[0077] First, GNBP1 The dsRNA was mixed with Nile Blue, and then 800 ul was dripped onto the filter paper at the bottom of a 7 cm culture dish. GNBP1 The control group was ds GFP and 20% Nile Blue aqueous solution. 20 termites were added to each culture dish, and each group was repeated 3 times. The samples were placed in a dark environment at 25 ℃ for observation and collection. The samples were collected at 3, 6, 12, and 24 hours, and the termites whose intestines turned blue were collected and stored at -80 ℃.

[0078] A fluorescence quantitative PCR (qRT-PCR) experiment was performed on the gene to test the changes in gene expression under different time and concentration treatments. The fluorescence quantitative primers are as follows (RPS18 and GAPDH are internal reference genes):

[0079] q- GNBP1 F:ACTCATTCAGCTTCCGCTATG

[0080] q- GNBP1 R:CATGTCCCGTACTCGTTGTATC

[0081] q- RPS18 F:ATGGCAAACCCCCGTCAGTA

[0082] q- RPS18R:CATACCACGATGCGCACGAA

[0083] q- GAPDH F:TCGTATTGGCCGTCTTGTGC

[0084] q- GAPDH R:AGCGACCATGGGTGGAATCAT;

[0085] The fluorescence quantitative PCR reaction system is as follows:

[0086]

[0087] Reaction procedure:

[0088] 95℃ 30 s

[0089] {95℃ 5 s, 60℃ 34 s} 30 cycles

[0090] {95℃ 15 s, 60℃ 1 min, 95℃ 15 s}

[0091] The experiment was designed with 3 biological replicates and 4 technical replicates for each biological replicate. After obtaining the Ct values ​​of the target gene and the reference gene, 2 -ΔΔt Methods The relative expression of target gene mRNA was calculated and the obtained data were analyzed for significant differences using InStat software.

[0092] To detect GNBP1 The expression of the target gene was changed at different sampling intervals after dsRNA feeding. The cDNA samples of the control group and the treatment group were tested by real-time fluorescence quantitative PCR. The results showed that the interference efficiency was 42.46%, 82.13%, 50.28% and 47.98% at 3 h, 6 h, 12 h and 24 h after dsRNA injection, respectively. The sampling interference efficiency was the highest at 6 h, and the relative expression of the target gene was significantly lower than that of the other two groups ( Figure 6 ).

[0093] Because at 6 hours, black-winged termites GNBP1 The interference efficiency is the highest, so we chose 6 hours for RNAi treatment.

[0094] Example 5 Changes in the sensitivity of Coptotermes to Serratia marcescens SM1 after RNAi.

[0095] First, dsRNA was mixed with Nile Blue, and then 800 μL was dripped onto the filter paper at the bottom of a 7 cm culture dish. GNBP1The control group was ds GFP and 20% Nile Blue aqueous solution. GNBP1 The bioassay was started when the expression level was downregulated to the highest level. 20 termites were added to each culture dish, and each group was repeated 3 times. GFP Processing, ds GFP After interference, use SM1 to process, ds GNBP1 Processing and ds GNBP1 After interference, the samples were treated with SM1 and subjected to biological test. The samples were placed in a dark environment at 25°C for observation and data recording.

[0096] Feeding ds to black-winged termites GNBP1 After 6 h, we conducted the SM1 infection experiment. We found that the survival rate of black-winged termites after RNAi was significantly reduced compared with those without RNAi. We selected 11, 16, 21, 26, 31, and 36 h for data analysis and found that at 11 h, the survival rate of ds treated with SM1 was significantly reduced. GNBP1 The mortality rate of the SM1 treatment group was significantly higher than that of the other treatment groups, reaching 60.0%, and there was no significant difference between the other groups; at 16 h, the mortality rate of the SM1 treatment group was 60.0%, and the mortality rate of the SM1 treatment group was 60.0%. GNBP1 The mortality rate of the group was the highest and significantly different from that of the other treatment groups, reaching 88.3%. GNBP1 Treatment group and SM1 treatment GFP The mortality rates of the SM1-treated and SM2-treated groups were 36.6% and 31.6%, respectively, with no significant difference between the two groups. GNBP1 The mortality rate of the group was the highest and significantly different from that of the other treatment groups, reaching 98.3%. GNBP1 The mortality rate of the treatment group was 61.6%, which was lower than that of the control group (fermentation liquid group and GFP group), but compared with SM1 treatment GFP There was no significant difference between the two groups, indicating that ds GNBP1 There was also an obvious lethal effect; at 26 h, ds GNBP1 The mortality rate of the group has reached 100%, ds GNBP1 The mortality rate of the treated group was 73%. There was no significant difference in mortality between the two groups. The mortality rate of the SM1 treated group was 51.6%. GFP The mortality rate of the group was 53.3%. The results showed that ds GNBP1 treatment group, SM1 treatment group, SM1 treatment group GFP There were no significant differences among the three groups, but they were all significantly different from the control group (fermentation liquid group and GFP group), indicating that ds GNBP1 There was also a significant lethal effect, and the effect was comparable to that of SM1; at 31 h and 36 h, dsGNBP1 treatment group, SM1 treatment group, SM1 treatment group GFP Group, SM1 treated ds GNBP1 The mortality rates of the two groups were all greater than 80.0%, and were significantly lower than those of the control groups (fermentation liquid group and GFP We found that ds GNBP1 The best effect was achieved when used together with SM1, with a mortality rate of 98% at 21 hours; ds GNBP1 The effect of using ds alone was not significantly different from that of using SM1 alone, and the mortality rate was close to 100% at around 36 h, indicating that ds GNBP1 It can also act as an insecticide when used alone as a medicine.

[0097] It can also be clearly seen from the survival curve that the ds GNBP1 The survival rate of the group was significantly lower than that of the control group (fermentation liquid group and GFP Group), all termites were dead at 21 h; ds GNBP1 treatment group, SM1 treatment group, SM1 treatment group GFP The survival rate of the control group (fermentation liquid group and GFP group) was also significantly lower than that of the control group (fermentation liquid group and GFP group). At 30 h, the survival rate had dropped to about 20.0% ( Figure 7 ).

[0098] In summary, this patent is the first to use the technology of bacterial amplification of dsRNA to synthesize black-winged termites. GNBP1 dsRNA, established a feeding method for the black-winged termite GNBP1 RNA interference system, and concluded that feeding had a significant gene silencing effect in black-winged termites. GNBP1 The application of RNAi technology provides technical support. This system successfully interferes with immune recognition proteins GNBP1 Gene expression and found GNBP1 The gene-silenced black-winged termites were significantly more sensitive to the SM1 strain of Serratia marcescens. GNBP1 When dsRNA and SM1 were used together, the mortality rate of termites was significantly increased, indicating that it can improve the control effect of biocontrol bacteria; it was also found that when used alone GNBP1 dsRNA can also control black-winged termites, and its effect is comparable to that of SM1 alone. GNBP1 The application of dsRNA in termite control provides a theoretical basis. The present invention lays a theoretical foundation for the development of immunosuppressants that are safe for humans and animals, and provides a new theory for biological control of pests, ultimately providing new strategies and new ways of pest control for my country's green agricultural production and sustainable development.

[0099] The present invention provides a control idea and method for black-winged soil termites. There are many methods and ways to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies. Sequence Listing <110> Nanjing Forestry University <120> The GNBP1 gene of Gram-negative bacteria recognition protein of Coptotermes nigropteroides and its application <160> 14 <170> SIPOSequenceListing 1.0 <210> 1 <211> 1137 <212> DNA <213> GNBP1 gene nucleotide sequence (Artificial Sequence) <400> 1 atgaaatcgg ttgtactgct cctgtgcgca gcgactggcg catattcact ctgcaactcc 60 acaatcacca ccgccagtgg ctccaaggcg cctgcctcca tttgtagcgg agatctggtg 120 tttcatgaag agttcgagac gttcgatttt cagacgtgga gtcacgagaa aacagcatca 180 ggaggtggca attgggagtt cgaagtgtac ctgaacaacc gttcgaacag ctacgtccgg 240 gatagcaaac tgttcatcag gccgacacta actgcagaca agttcggaga gaggttcctg 300 tctgccggaa cactcagact gtacggagga tctcctgctg atacgtgcac aaatccgtcg 360 gactggggat gtgagagaag ggggacgcat gtaaatctgc tgaatccaat cacatctgca aggattcgaa ctgtggactc attcagcttc cgctatggtc aagttgaagt gcgggcaaaa 480 ctgccggctg gggattggct ctggccagcg atctggctgc tgcctcgata caacgagtac 540 gggacatggc cagcttcagg agagatagc ctctccgagg gtcgcggga cactaacctg accttgaacg gtaaaaatat cggcactgaa atctcttcgt ccacactgca cttcggccct tattggcccc tcaacggata tgagaaggca cattttcaaa gacggttaga accggaacag agcttcgatc aagatttcca caggttccaa atgaaatgga cggacgaata ctttcagttc gctgttgatg atgtagagac agggcgaata tctccaccag acggtggatt ttgggaattt 840 ggaaattttg attcaataaa tagctctt gataatccat ggatatatgg aacaaagatg gcaccatttg acaaagagtt ctacttcgtc atcaacttgg cagtcggtgg agtcaacgga 960 ttcttcccag acaatgcaga gaatccaggc ggtaaccct ggagcaacaa ttcacctcag gcttcaacag acttctggaa tggtcgacat caatggctgc ctacctggaa tcttgacgtc aataggggag aaggagctgc tttgcaggtg gactatatta aggtctgggc catttaa 1137 <210> 2 <211> 378 <212> PRT <213> GNBP1 amino acid sequence (Artificial Sequence) <400> 2 Met Lys Ser Val Val Leu Leu Leu Cys Ala Ala Thr Gly Ala Tyr Ser 1 5 10 15 Leu Cys Asn Ser Thr Ile Thr Thr Ala Ser Gly Ser Lys Ala Pro Ala 20 25 30 Ser Ile Cys Ser Gly Asp Leu Val Phe His Glu Glu Phe Glu Thr Phe 35 40 45 Asp Phe Gln Thr Trp Ser His Glu Lys Thr Ala Ser Gly Gly Gly Asn 50 55 60 Trp Glu Phe Glu Val Tyr Leu Asn Asn Arg Ser Asn Ser Tyr Val Arg 65 70 75 80 Asp Ser Lys Leu Phe Ile Arg Pro Thr Leu Thr Ala Asp Lys Phe Gly 85 90 95 Glu Arg Phe Leu Ser Ala Gly Thr Leu Arg Leu Tyr Gly Gly Ser Pro 100 105 110 Ala Asp Thr Cys Thr Asn Pro Ser Asp Trp Gly Cys Glu Arg Arg Gly 115 120 125 Thr His Val Asn Leu Leu Asn Pro Ile Thr Ser Ala Arg Ile Arg Thr 130 135 140 Val Asp Ser Phe Ser Phe Arg Tyr Gly Gln Val Glu Val Arg Ala Lys 145 150 155 160 Leu Pro Ala Gly Asp Trp Leu Trp Pro Ala Ile Trp Leu Leu Pro Arg 165 170 175 Tyr Asn Glu Tyr Gly Thr Trp Pro Ala Ser Gly Glu Ile Asp Leu Ser 180 185 190 Glu Gly Arg Gly Asn Thr Asn Leu Thr Leu Asn Gly Lys Asn Ile Gly 195 200 205 Thr Glu Ile Ser Ser Ser Thr Leu His Phe Gly Pro Tyr Trp Pro Leu 210 215 220 Asn Gly Tyr Glu Lys Ala His Phe Gln Arg Arg Leu Glu Pro Glu Gln 225 230 235 240 Ser Phe Asp Gln Asp Phe His Arg Phe Gln Met Lys Trp Thr Asp Glu 245 250 255 Tyr Phe Gln Phe Ala Val Asp Asp Val Glu Thr Gly Arg Ile Ser Pro 260 265 270 Pro Asp Gly Gly Phe Trp Glu Phe Gly Asn Phe Asp Ser Ile Asn Lys 275 280 285 Thr Leu Asp Asn Pro Trp Ile Tyr Gly Thr Lys Met Ala Pro Phe Asp 290 295 300 Lys Glu Phe Tyr Phe Val Ile Asn Leu Ala Val Gly Gly Val Asn Gly 305 310 315 320 Phe Phe Pro Asp Asn Ala Glu Asn Pro Gly Gly Lys Pro Trp Ser Asn 325 330 335 Asn Ser Pro Gln Ala Ser Thr Asp Phe Trp Asn Gly Arg His Gln Trp 340 345 350 Leu Pro Thr Trp Asn Leu Asp Val Asn Arg Gly Glu Gly Ala Ala Leu 355 360 365 Gln Val Asp Tyr Ile Lys Val Trp Ala Ile 370 375 <210> 3 <211> 17 <212> DNA <213> GNBP1F(Artificial Sequence) <400> 3 acttcagcgg ccattcg 17 <210> 4 <211> 22 <212> DNA <213> GNBP1R(Artificial Sequence) <400> 4 tttatgctgc tatcagtgct tc 22 <210> 5 <211> 30 <212> DNA <213> dsGNBP1F(Artificial Sequence) <400> 5 atttgcggcc gcacagcatc aggaggtggc <210> 6 <211> 28 <212> DNA <213> dsGNBP1R(Artificial Sequence) <400> 6 cccaagcttt cgtccgtcca tttcattt <210> 7 <211> 31 <212> DNA <213> dsGFP F(Artificial Sequence) <400> 7 atcggagctc agttgaacgg atccatcttc a <210> 8 <211> 25 <212> DNA <213> dsGFP R(Artificial Sequence) <400> 8 cccaagctta gaacttttca ctgga <210> 9 <211> 21 <212> DNA <213> q-GNBP1 F(Artificial Sequence) <400> 9 actcattcag cttccgctat g <210> 10 <211> 22 <212> DNA <213> q-GNBP1 R(Artificial Sequence) <400> 10 catgtcccgt actcgttgta tc <210> 11 <211> 20 <212> DNA <213> q-RPS18F(Artificial Sequence) <400> 11 atggcaaacc cccgtcagta 20 <210> 12 <211> 20 <212> DNA <213> q-RPS18R(Artificial Sequence) <400> 12 cataccacga tgcgcacgaa 20 <210> 13 <211> 20 <212> DNA <213> q-GAPDHF(Artificial Sequence) <400> 13 tcgtattggc cgtcttgtgc 20 <210> 14 <211> 21 <212> DNA <213> q-GAPDHR(Artificial Sequence) <400> 14 agcgaccatg ggtggaatca t 21

Claims

1. A Gram-negative bacteria recognition protein for controlling black-winged termites GNBP1 A dsRNA of a gene, characterized in that Said GNBP1 The nucleotide sequence of the gene is shown in SEQ ID NO: 1; the dsRNA is GNBP1 Full-length plasmid pClone007- GNBP1 As a template, the upstream primer ds GNBP1 F and downstream primer ds GNBP1 R is amplified by PCR to obtain the target fragment, wherein, Upstream primer ds GNBP1 F is: ATTT GCGGCCGCACAGCATCAGGAGGTGGC; Downstream primer ds GNBP1 R is: CCC AAGCTTTCGTCCGTCCATTTCATTT.

2. A recombinant expression vector, characterized in that: It expresses the dsRNA of claim 1.

3. A host bacterium, characterized in that The recombinant expression vector described in claim 2 is transformed therein.

4. A method for preventing and controlling black-winged termites, characterized in that: The following steps are involved: Feed termites with the dsRNA of claim 1.

5. A method for preventing and controlling black-winged termites, characterized in that: The dsRNA of claim 1 and Serratia marcescens SM1 are co-fed to termites.

Images