Use of p19 protein in regulating virulence of pseudomonas aeruginosa
By expressing the P19 protein or its mutant in Pseudomonas aeruginosa to regulate the synthesis of pyocyanin, the problem of virulence regulation of Pseudomonas aeruginosa has been solved, providing a new means of prevention and control.
Patent Information
- Application Number
- CN202111308996.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2021-11-05
- Publication Date
- 2026-03-24
- Estimated Expiration
- 2041-11-05
AI Technical Summary
Existing technologies lack effective methods to regulate the virulence of Pseudomonas aeruginosa, especially as its resistance increases after antibiotic use, necessitating new prevention and control measures.
By constructing a recombinant expression vector to express the P19 protein of Carnation Italian ringspot virus or its mutant protein in Pseudomonas aeruginosa, the synthesis of pyocyanin was regulated, thus affecting the virulence of the strain.
Expressing the P19 protein increases Pseudomonas aeruginosa synthesis, while expressing the mutant protein reduces synthesis, providing a new method for controlling Pseudomonas aeruginosa and regulating its virulence.
Smart Images

Figure CN116077621B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the field of bioengineering technology. More specifically, it relates to the application of the P19 protein of Carnation Italian Spot Virus in regulating the virulence of Pseudomonas aeruginosa. Background Technology
[0002] Pseudomonas aeruginosa, also known as Pseudomonas aeruginosa, is widely distributed in nature and is one of the most common bacteria in soil. It also exists in various environments, including water, air, and on the skin, respiratory tract, and intestines of healthy individuals. Pseudomonas aeruginosa is an opportunistic pathogen and one of the main pathogens causing hospital-acquired infections. Patients with metabolic diseases, blood disorders, or malignant tumors, as well as those recovering from surgery or certain treatments, are susceptible to infection. Furthermore, the extensive use of antibiotics targeting Pseudomonas aeruginosa has led to drug resistance, necessitating the search for new prevention and control methods.
[0003] The P19 protein is an siRNA-binding protein discovered in the plant virus Carnation Italian Ringspot Virus. Huang et al. constructed a recombinant vector, transferred exogenous dsDNA into Escherichia coli, and then used ribonuclease III in E. coli to convert the dsDNA on the vector into siRNA fragments. They found that the P19 protein can bind to this type of siRNA (Huang L, Jin J, Deighan P, et al. Efficient and specific gene knockdown by small interfering RNAs produced in bacteria[J]. Nature Biotechnology, 2013, 31(4):350-356.). Further research is needed to discover more functions and applications of the P19 protein. Summary of the Invention
[0004] The technical problem to be solved by the present invention is to overcome the defects and deficiencies of the prior art and to provide the application of the P19 protein of Carnation Italian ringspot virus in regulating the virulence of Pseudomonas aeruginosa.
[0005] The first objective of this invention is to provide the application of the P19 protein of Carnation Italian Spot Virus in regulating the virulence of Pseudomonas aeruginosa.
[0006] A second objective of this invention is to provide the use of the P19 mutant protein of Carnation Italian Spot Virus in the prevention and treatment of Pseudomonas aeruginosa or in the preparation of drugs for the prevention and treatment of Pseudomonas aeruginosa.
[0007] The above-mentioned objective of this invention is achieved through the following technical solution:
[0008] This invention reveals that transforming the nucleotide sequence encoding the P19 protein of Carnation Italian Spot Virus into *Pseudomonas aeruginosa* via a recombinant expression vector alters the virulence of *Pseudomonas aeruginosa*. Further analysis shows that expressing the P19 protein in *Pseudomonas aeruginosa* increases the content of pyocyanin, while mutating the P19 protein and then expressing it in *Pseudomonas aeruginosa* decreases the pyocyanin content and inhibits pyocyanin synthesis. This indicates that the synthesis of pyocyanin in *Pseudomonas aeruginosa* can be regulated through the P19 protein.
[0009] Pyrosinin is a phenazine compound secreted by Pseudomonas aeruginosa, possessing a distinctive color and redox capabilities. Pyrosinin is not only an important virulence factor in Pseudomonas aeruginosa, but it can also act as a signaling molecule to regulate gene expression and promote biofilm formation. Furthermore, pyrosinin plays a role in inhibiting antibiotic resistance in Pseudomonas aeruginosa. Therefore, the P19 protein can be used to regulate the synthesis of pyrosinin in Pseudomonas aeruginosa, thereby enabling the prevention and control of Pseudomonas aeruginosa.
[0010] Therefore, this invention application protects the use of the P19 protein of Carnation Italian Ringspot Virus in regulating the virulence of Pseudomonas aeruginosa.
[0011] Specifically, the application of the P19 protein of the Italian ringspot virus in regulating the virulence of Pseudomonas aeruginosa by modulating the synthesis of pyophytin in Pseudomonas aeruginosa.
[0012] Specifically, the amino acid sequence of the P19 protein is shown in SEQ ID NO.1, and the nucleotide sequence encoding the P19 protein is shown in SEQ ID NO.2.
[0013] Specifically, expression of the P19 protein in Pseudomonas aeruginosa increases the synthesis of pyocyanin, while expression of the P19 mutant protein in Pseudomonas aeruginosa decreases the synthesis of pyocyanin.
[0014] Specifically, the expression of P19 protein or P19 mutant protein in Pseudomonas aeruginosa is achieved by constructing a recombinant expression vector and then introducing it into Pseudomonas aeruginosa.
[0015] This invention also applies for protection of the use of the P19 mutant protein of Carnation Italian Spot Virus in the prevention and treatment of Pseudomonas aeruginosa or in the preparation of drugs for the prevention and treatment of Pseudomonas aeruginosa.
[0016] Specifically, the mutation mode of the P19 mutant protein is a point mutation, and the mutation site is the 71st and 72nd amino acid sequence of the P19 protein.
[0017] Specifically, the amino acid sequence of the point-mutated P19 protein is shown in SEQ ID NO.3.
[0018] Specifically, the nucleotide sequence encoding the point mutation P19 protein is shown in SEQ ID NO.4.
[0019] Specifically, the PJN105 expression vector was used to construct the recombinant expression vector.
[0020] Experiments have shown that other expression vectors can achieve the same effect.
[0021] The present invention has the following beneficial effects:
[0022] This invention, through constructing a recombinant expression vector of the Italian ringspot virus P19 protein of *Carnationia aurea* and transforming it into *Pseudomonas aeruginosa*, found that expressing the P19 protein in *Pseudomonas aeruginosa* increases the synthesis of pyocyanin, while expressing the P19 mutant protein in *Pseudomonas aeruginosa* decreases the synthesis of pyocyanin. This indicates that the protein can regulate the synthesis of pyocyanin and affect the virulence of *Pseudomonas aeruginosa*, and thus can be used to prevent and control *Pseudomonas aeruginosa*, providing a new method for the prevention and control of *Pseudomonas aeruginosa*. Attached Figure Description
[0023] Figure 1 A schematic diagram of the design of a recombinant expression vector for regulating the synthesis of pyocyanin by Pseudomonas aeruginosa.
[0024] Figure 2 The results are from PCR detection of E. coli positive transformants.
[0025] Figure 3 The results are from the PCR detection of the recombinant expression vector in Pseudomonas aeruginosa.
[0026] Figure 4 The results show the expression of P19 protein and its mutant protein in Pseudomonas aeruginosa.
[0027] Figure 5 The results show the detection of pyocyanin in P19 protein transformants and P19 mutant protein transformants. Detailed Implementation
[0028] The present invention will be further described below with reference to the accompanying drawings and specific embodiments, but the embodiments do not limit the present invention in any way. Unless otherwise specified, the reagents, methods and equipment used in the present invention are conventional reagents, methods and equipment in this technical field.
[0029] Unless otherwise specified, all reagents and materials used in the following examples are commercially available.
[0030] Example 1: Construction and Screening of Recombinant Expression Vectors
[0031] This invention constructs recombinant expression vectors for the P19 protein of Carnation Italian Ringspot Virus and its mutant protein. The mutation sites of the P19 protein mutant are amino acid positions 71 and 72 of the P19 protein, which alter the function of P19. The amino acid sequence of the P19 protein is shown in SEQ ID NO.1, and the nucleotide sequence encoding the P19 protein is shown in SEQ ID NO.2. The amino acid sequence of the P19 protein mutant is shown in SEQ ID NO.3, and the nucleotide sequence encoding the P19 protein mutant is shown in SEQ ID NO.4.
[0032] The expression vector used in this invention is PJN105, which contains a histidine tag and an arabinose-induced operon. The histidine tag is added to facilitate the subsequent extraction of the P19 protein, while the arabinose operon facilitates the induction of high-level expression of the P19 protein after the addition of arabinose. A schematic diagram of the recombinant expression vector is shown below. Figure 1 As shown, by Figure 1 It can be seen that the recombinant expression vector contains the arabinose operon, the RBS sequence, and the positions of the six histidine antibody tags, as well as the selection of restriction enzyme sites.
[0033] The specific steps are as follows:
[0034] 1. PCR amplification of DNA fragments
[0035] To facilitate the extraction of the P19 protein later, this invention adds six histidine residues (His antibody tag) to the P19 protein and its mutant proteins during the construction of the recombinant expression vector. This invention designs primers to insert the DNA sequence of the six histidine residues after the ATG of the P19 sequence. Since the specific mutation site of the P19 mutant protein is located in the middle part of the gene, this invention designs primers to locate the mutation site, and then introduces the mutation site through PCR amplification to construct the sequence of the P19 mutant protein.
[0036] The designed primers are shown below:
[0037] Primer 1 (PJN-His-p19-F1):
[0038] TACCCGTTTTTTTGGGCTAGCCAGGAGGATATTCATGCACCATCATCAT
[0039] Primer 2 (His-p19-F2):
[0040] ATGCACCATCATCATCATCATGAA
[0041] Primer 3 (PJN-p19-R):
[0042] AGAACTAGTGGATCCCCCGGGTTACTCGCTTTTCTTTTTCGA
[0043] Primer 4 (PJN-His-p19-R2):
[0044] TCGTATCTGAGATATCCCGCAAATACAACTTTCCCGAAAC
[0045] Primer 5 (PJN-p19-F3):
[0046] TGCGGGATATCTCAGATACGACAGGACGGAAGC
[0047] Primer 6 (PJN-F):
[0048] TAATCACGGCAGAAAAGTCC
[0049] Primer 7 (PJN-R):
[0050] CGATTAAGTTGGGTAACGCC
[0051] Primers 2 and 3 are used together to introduce the His tag sequence and the interface sequence on the vector into P19. The interface sequence is used for homologous recombination, and this fragment is designated as fragment 1. The sequence of fragment 1 is shown below. After recovering fragment 1 using the OMEGA DNA Recovery Kit, fragment 2 is amplified using primers 1 and 3 as a template. This amplifies the interface sequence and RBS sequence on the vector into P19, and then recovers the fragment using the OMEGA DNA Recovery Kit. The sequence of fragment 2 is shown below.
[0052] The sequence of fragment 1 is shown below:
[0053] ATG CACCATCATCATCATCATGAACGAGCTATACAAGGAAACGACGCTAGGGAACAAGCTAACAGTGAACGTTGGGATGGAGGATCAGGAGGTACCACTTCTCCCTTCAAACTTCCTGACGAAAGTCCGAGTTGGACTGAGTGGCGGCTACATAACGATGAGACGAATTCGAATCAAGATAATCCCCTTGGTTTCAAGGAAAGCTGGGGTTTCGGGAAAGTTGTATTTAAGAGATATCTCAGATACGACAGGACGGAAGCTTCACTGCACAGAGTCCTTGGATCTTGGACGGGAGATTCGGTTAACTATGCAGCATCTCGATTTTTCGGTTTCGACCAGATCGGATGTACCTATAGTATTCGGTTTCGAGGAGTTAGTATCACCGTTTCTGGAGGGTCGCGAACTCTTCAGCATCTCTGTGAGATGGCAATTCGGTCTAAGCAAGAACTGCTACAGCTTGCCCCAATCGAAGTGGAAAGTAATGTATCAAGAGGATGCCCTGAAGGTACTGAGACCTTCGAAAAAGAAAGCGAGTAAcccgggggatccactagttct
[0054] The underlined part is the His-tag sequence, and the lowercase part is the linker sequence on the vector.
[0055] The sequence of Fragment 2 is shown below:
[0056] tacccgtttttttgggctagc CAGGAGGATATTCATGCACCATCATCATCATGAACGAGCTATACAAGGAAACGACGCTAGGGAACAAGCTAACAGTGAACGTTGGGATGGAGGATCAGGAGGTACCACTTCTCCCTTCAAACTTCCTGACGAAAGTCCGAGTTGGACTG AGTGGCGGCTACATAACGATGAGACGAATTCGAATCAAGATAATCCCCTTGGTTTCAAGGAAAGCTGGGGTTTCGGGAAAGTTGTATTTAAGAGATATCTCAGATACGACAGGACGGAAGCTTCACTGCACAGAGTCCTT GGATCTTGGACGGGAGATTCGGTTAACTATGCAGCATCTCGATTTTTCGGTTTCGACCAGATCGGATGTACCTATAGTATTCGGTTTCGAGGAGTTAGTATCACCGTTTCTGGAGGGTCGCGAACTCTTCAGCATCTCT GTGAGATGGCAATTCGGTCTAAGCAAGAACTGCTACAGCTTGCCCCAATCGAAGTGGAAAGTAATGTATCAAGAGGATGCCCTGAAGGTACTGAGACCTTCGAAAAAGAAAGCGAGTAAcccgggggatccactagttct
[0057] The underlined part is the RBS sequence, and the lowercase part is the interface sequence on the carrier.
[0058] Because this invention introduces gene mutation sites using primers and connects them via homologous recombination, fragment 2 is divided into two parts, separated at the mutation site using primers, and then integrated. Using fragment 2 as a template, fragment 3 is amplified using primers 1 and 4; fragment 4 is amplified using primers 3 and 5, and then fragments 3 and 4 are recovered separately using the OMEGA DNA Recovery Kit.
[0059] The sequence of fragment 3 is shown below:
[0060] TACCCGTTTTTTTGGGCTAGCCAGGAGGATATTCATGCACCATCATCATCATCATGAACGAGCTATACAAGGAAACGACGCTAGGGAACAAGCTAACAGTGAACGTTGGGATGGAGGATCAGGAGGTACCACTTCTCCCTT CAAACTTCCTGACGAAAGTCCGAGTTGGACTGAGTGGCGGCTACATAACGATGAGACGAATTCGAATCAAGATAATCCCCTTGGTTTCAAGGAAAGCTGGGGTTTCGGGAAAGTTGTATTTGCGGGATATCTCAGATACGA
[0061] The sequence of fragment 4 is shown below:
[0062] TGCGGGATATCTCAGATACGACAGGACGGAAGCTTCACTGCACAGAGTCCTTGGATCTTGGACGGGAGATTCGGTTAACTATGCAGCATCTCGATTTTTCGGTTTCGACCAGATCGGATGTACCTATAGTATTCGGTTTCGAGGAGTTAGTATCACCGTTTCTGG AGGGTCGCGAACTCTTCAGCATCTCTGTGAGATGGCAATTCGGTCTAAGCAAGAACTGCTACAGCTTGCCCCAATCGAAGTGGAAAGTAATGTATCAAGAGGATGCCCTGAAGGTACTGAGACCTTCGAAAAAGAAAGCGAGTAACCCGGGGGATCCACTAGTTCT
[0063] 2. Enzyme digestion of PJN105 vector
[0064] Take 3 μg of PJN105 vector and digest it with NEB's NheI and XmaI enzymes. Prepare a 100 μL digestion system according to the instructions. Digest at 37°C for 4 hours. Recover the digested vector fragments using the OMEGA DNA Recovery Kit.
[0065] 3. Seamless cloning and ligation of the enzyme-digested vector and the target fragment.
[0066] Refer to the seamless cloning kit for nearshore proteins ( According to the instructions of the plus One step PCR Cloning Kit, prepare the reaction system in an ice box. Mix the enzyme digestion vector with the target fragment (i.e., fragment 2, as well as fragments 3 and 4 simultaneously with the vector for recombination ligation) and perform the recombination ligation reaction. The reaction system is shown in Table 1 below. React at 50℃ for 30 min to 60 min. After the reaction, it can be directly transformed or temporarily stored at 4℃ or -20℃.
[0067] Table 1
[0068]
[0069] 4. Transformation of reaction products
[0070] Add 10 μL of cloning ligation reaction solution to 100 μL of E. coli DH5α competent cells, tap them a few times, incubate on ice for 30 min, heat shock in a 42℃ water bath for 90 s, and then quickly place them on ice for 5 min; add 500 μL of SOC or LB liquid medium, incubate at 37℃ for 45–60 min; centrifuge at 4000 rpm for 5 min to collect the cells, and spread a certain amount of cells evenly on an agar plate containing gentamicin sulfate at a final concentration of 50 μg / mL and incubate overnight.
[0071] 5. Identification of positive clones
[0072] The E. coli transformants grown on the plates were identified as positive clones using colony PCR. Primers 6 and 7 were used in combination, and the detection was performed using Novoprotein 2×Specific Taq Master Mix (catalog number: E010). The PCR detection results of the E. coli positive transformants are shown below. Figure 2 As shown, by Figure 2 As can be seen, the band size after PCR detection is consistent with the expected size. Furthermore, sequencing analysis revealed that the vector sequence in the obtained positive transformants matched the target DNA sequence. These results indicate that the present invention successfully constructed a recombinant expression vector for the P19 protein and its mutant proteins.
[0073] Example 2: Detection of Pseudomonas aeruginosa positive clone transformants and expression of recombinant proteins
[0074] 1. Conversion and Detection
[0075] (1) Extracting Escherichia coli and constructing the correct recombinant vector
[0076] E. coli carrying P19 and its mutant recombinant vectors were cultured in LB liquid medium containing gentamicin sulfate at a final concentration of 50 μg / mL at 37°C for 18 h. Vector extraction was performed using the vector miniprep kit from OMEGA.
[0077] (2) Electrocution
[0078] Pseudomonas aeruginosa was cultured in LB medium (containing 50 mM 3-(N-morpholino)propanesulfonic acid) at 37°C for 8 h. The culture was centrifuged at 10,000 rpm for 1 min to obtain 1.5 mL of bacterial culture. The supernatant was discarded, and the bacterial cells were dissolved in 1 mL of 10% sterile sucrose solution. The mixture was then centrifuged again at 10,000 rpm for 1 min, and the supernatant was discarded. The cells were washed once more with sucrose solution. Then, 150 μL of 10% sterile sucrose solution was added to dissolve the bacterial cells. 150 ng of extraction vector was added, and the mixture was electroporated at 2.5 kV using a 2 mm Bio-Rad electroporator. 800 μL of LB medium was added, and the mixture was mixed thoroughly by pipetting. The mixture was incubated at 37°C for 60 min and then plated onto agar plates containing 100 μg / mL gentamicin sulfate for overnight culture.
[0079] (3) PCR detection of P19 vector in Pseudomonas aeruginosa
[0080] Transformants of *Pseudomonas aeruginosa* grown on plates were identified as positive clones using colony PCR. Primers 6 and 7 were used together, and detection was performed using Novoprotein 2×Specific Taq Master Mix (catalog number: E010). Results are as follows: Figure 3 As shown in the figure, the size of the bands after PCR detection is in line with the expected size, the same as the size of the Escherichia coli detected in Example 1. The size of the empty vector fragment is also in line with the expected size, indicating that the recombinant expression vector has been successfully transformed into Pseudomonas aeruginosa.
[0081] 2. Expression and detection of recombinant proteins
[0082] (1) Induction and extraction of recombinant proteins
[0083] Pseudomonas aeruginosa containing the P19 recombinant expression vector and its mutant recombinant expression vector were cultured in LB-MOPS medium (containing 3-(N-morpholino)propanesulfonic acid at a final concentration of 50 mM) until OD600. 600 The value was 1.0. 4 μL of bacterial culture was cultured in 4 mL of LB-MOP medium in a 14 mL Falcon tube. L-arabinose was added to a final concentration of 1 mg / mL for induction. The culture was incubated at 37°C with shaking at 220 rpm for 16 h, after which protein was extracted. Since Western blotting is very sensitive, only 1 mL of bacterial culture was needed. The culture was then centrifuged to obtain the bacterial cells, and SDS-loading buffer (Tris-HCl (pH 6.8), Glycerin, SDS, Bromophenol blue, DTT) was added at a loading:sample volume ratio of 1:4. The mixture was heated at 100°C for 5 min, centrifuged for 30 s using a benchtop centrifuge, and a suitable amount of supernatant was loaded onto the sample.
[0084] (2) Western blotting detection
[0085] Run at 80V for about 15 minutes. After the sample has passed through the compression gel, adjust the voltage to 120V and stop when the sample electrophoresis reaches the bottom of the gel.
[0086] Prepare the wet-to-electrode transfer solution: Tris 3.0g, Gly 14.4g, M-OH 200mL, add deionized water to a final volume of 1000mL; lay the NC membrane flat on the surface of the deionized water, allow it to absorb water naturally through capillary action, then immerse it completely in the water for 10 minutes to remove air bubbles, and then immerse it in the transfer solution; remove the gel, cut off the upper left corner, soak it briefly in the transfer solution, place it on a clean glass plate, and lay the membrane and filter paper in sequence; use a glass rod to remove air bubbles, and cut off any excess parts of the filter paper and membrane; add a small amount of transfer solution to drive out air bubbles again, seal tightly, and place it in the electrostatic precipitator, ensuring the membrane is on the positive electrode side; 400mA, 2h.
[0087] After electroporation, remove the membrane, rinse it briefly with deionized water and PBST or TTBS, and then immerse it in blocking buffer with gentle shaking for 1 hour. Both the blocking buffer and the antibody solvent are maleic acid solutions containing 5% skim milk powder. To prepare the blocking buffer, take 50 mL of maleic acid solution and add 2.5 g of skim milk powder.
[0088] After discarding the blocking solution, add a solution containing His primary antibody (mouse antibody), and incubate gently at room temperature for 1 hour or at 4°C overnight. After incubation, collect the primary antibody solution, store it in a refrigerator, and reuse it. After primary antibody incubation, rinse the membrane with TTBS and then rinse three times for 10 minutes each time. After rinsing, combine with secondary antibody. Select a suitable secondary antibody according to the source of the primary antibody, dilute it at the appropriate ratio (1:1000 to 1:10000), and incubate gently at room temperature for 1 hour. After secondary antibody incubation, rinse the membrane with TTBS and then rinse three times for 10 minutes each time.
[0089] Using the horseradish peroxidase HRP-ECL luminescence method, luminescent solutions A and B were diluted and mixed in a 1:1 ratio. Excess liquid was blotted away with absorbent paper. The NC membrane was placed on plastic wrap with the sample side facing up. ECL luminescent solution (Millipore luminescent substrate HRP) was then added to the surface of the NC membrane, ensuring complete coverage. The membrane was incubated at room temperature for 3–5 minutes. Western blotting results were then detected using a chemiluminescence detection system. The results are shown below. Figure 4 As shown in the figure, the p19 protein can be expressed in large quantities in Pseudomonas aeruginosa.
[0090] Example 3: Detection of Pseudomonas aeruginosa content
[0091] Pseudomonas aeruginosa containing the P19 recombinant expression vector and its mutant recombinant expression vector were cultured in LB-MOPS to OD.600 The concentration was 1.0. 4 μL of the culture was incubated in a 14 mL tube with 4 mL of P broth medium. L-arabinose at a final concentration of 1 mg / mL was added for induction. After incubation at 37°C with shaking for 18 h, a photograph was taken, and 2 mL of the bacterial culture was centrifuged at 13000 rpm for 2 min. 100 μL of the supernatant was transferred to a 96-well plate, and the absorbance was measured at 695 nm using a microplate reader. Another 100 μL of the bacterial culture was measured at 600 nm using a microplate reader. The absorbance at 695 nm was divided by the absorbance at 600 nm to obtain the pyocyanin content. This method was used to prevent the bacterial concentration from affecting the results. In this invention, the ratio of PAO1 in the PJN105 vector without P19 was used as a control. Dividing the values of P19 and P19 mutants by this control value clearly shows the up- and down-regulated ratio of pyocyanin.
[0092] The results are as follows Figure 5 As shown in the figure, the bacterial culture of *Pseudomonas aeruginosa* expressing the P19 protein is significantly darker than that of ordinary *Pseudomonas aeruginosa*, while the bacterial culture of *Pseudomonas aeruginosa* expressing the P19 mutant protein is the lightest in color. The comparison of pyocyanin content indicates that the pyocyanin content in *Pseudomonas aeruginosa* expressing the P19 protein is significantly higher than that in the blank control, while the pyocyanin content in *Pseudomonas aeruginosa* expressing the P19 mutant protein is significantly lower than that in the blank control. This suggests that the P19 protein can regulate the synthesis of pyocyanin in *Pseudomonas aeruginosa*, and that the P19 mutant protein can be used to control *Pseudomonas aeruginosa*.
[0093] The above embodiments are preferred embodiments of the present invention, but the embodiments of the present invention are not limited to the above embodiments. Any changes, modifications, substitutions, combinations, or simplifications made without departing from the spirit and principle of the present invention shall be considered equivalent substitutions and shall be included within the protection scope of the present invention. sequence list <110> South China Agricultural University <120> Application of P19 protein in regulating the virulence of Pseudomonas aeruginosa <160> 4 <170> SIPOSequenceListing 1.0 <210> 1 <211> 172 <212> PRT <213> Carnation Italian ringspot virus <400> 1 Met Glu Arg Ala Ile Gln Gly Asn Asp Ala Arg Glu Gln Ala Asn Ser 1 5 10 15 Glu Arg Trp Asp Gly Gly Ser Gly Gly Thr Thr Ser Pro Phe Lys Leu 20 25 30 Pro Asp Glu Ser Pro Ser Trp Thr Glu Trp Arg Leu His Asn Asp Glu 35 40 45 Thr Asn Ser Asn Gln Asp Asn Pro Leu Gly Phe Lys Glu Ser Trp Gly 50 55 60 Phe Gly Lys Val Val Phe Lys Arg Tyr Leu Arg Tyr Asp Arg Thr Glu 65 70 75 80 Ala Ser Leu His Arg Val Leu Gly Ser Trp Thr Gly Asp Ser Val Asn 85 90 95 Tyr Ala Ala Ser Arg Phe Phe Gly Phe Asp Gln Ile Gly Cys Thr Tyr 100 105 110 Ser Ile Arg Phe Arg Gly Val Ser Ile Thr Val Ser Gly Gly Ser Arg 115 120 125 Thr Leu Gln His Leu Cys Glu Met Ala Ile Arg Ser Lys Gln Glu Leu 130 135 140 Leu Gln Leu Ala Pro Ile Glu Val Glu Ser Asn Val Ser Arg Gly Cys 145 150 155 160 Pro Glu Gly Thr Glu Thr Phe Glu Lys Glu Ser Glu 165 170 <210> 2 <211> 519 <212> DNA <213> Carnation Italian ringspot virus (Carnation Italian ringspot virus) <400> 2 atggaacgag ctatacaagg aaacgacgct agggaacaag ctaacagtga acgttgggat 120. ttctcccttc aaacttcctc acgaaagtcc ttctcccttc gagtggcggc tacataacga tgagacgaat tcgaatcaag fathercccct tggtttcaag gaaagctggg gtttcggga agttgtattt aagagatatc tcagatacga caggacgga gcttcactgc acagagtcct tggatcttgg acggggagatt cggttaacta tgcagcatct 300 cgatttttcg gtttcgacca gatcggatgt acctatagta ttcggtttcg aggagttagt 360 atcaccgttt ctggagggtc gcgaactctt cagcatctct gtgagatggc aattcggtct 420 aagcaagaac tgctacagct tgccccaatc gaagtggaa gtaatgtatc aagaggatgc cctgaaggta ctgagacctt cgaaaaaga agcgagtaa <210> 3 <211> 172 <212> PRT <213> Carnation Italian ringspot virus (Carnation Italian ringspot virus) <400> 3 Met Glu Arg Ala Ile Gln Gly Asn Asp Ala Arg Glu Gln Ala Asn Ser 1 5 10 15 Glu Arg Trp Asp Gly Gly Ser Gly Gly Thr Thr Ser Pro Phe Lys Leu 20 25 30 Pro Asp Glu Ser Pro Ser Trp Thr Glu Trp Arg Leu His Asn Asp Glu 35 40 45 Thr Asn Ser Asn Gln Asp Asn Pro Leu Gly Phe Lys Glu Ser Trp Gly 50 55 60 Phe Gly Lys Val Val Phe Ala Gly Tyr Leu Arg Tyr Asp Arg Thr Glu 65 70 75 80 Ala Ser Leu His Arg Val Leu Gly Ser Trp Thr Gly Asp Ser Val Asn 85 90 95 Tyr Ala Ala Ser Arg Phe Phe Gly Phe Asp Gln Ile Gly Cys Thr Tyr 100 105 110 Ser Ile Arg Phe Arg Gly Val Ser Ile Thr Val Ser Gly Gly Ser Arg 115 120 125 Thr Leu Gln His Leu Cys Glu Met Ala Ile Arg Ser Lys Gln Glu Leu 130 135 140 Leu Gln Leu Ala Pro Ile Glu Val Glu Ser Asn Val Ser Arg Gly Cys 145 150 155 160 Pro Glu Gly Thr Glu Thr Phe Glu Lys Glu Ser Glu 165 170 <210> 4 <211> 519 <212> DNA <213> Carnation Italian ringspot virus <400> 4 atggaacgag ctatacaagg aaacgacgct agggaacaag ctaacagtga acgttgggat 60 ggaggatcag gaggtaccac ttctcccttc aaacttcctg acgaaagtcc gagttggact 120 gagtggcggc tacataacga tgagacgaat tcgaatcaag ataatcccct tggtttcaag 180 gaaagctggg gtttcggggaa agttgtattt gcgggatatc tcagatacga caggacggaa 240 gcttcactgc acagagtcct tggatcttgg acgggagatt cggttaacta tgcagcatct 300 cgatttttcg gtttcgacca gatcggatgt acctatagta ttcggtttcg aggagttagt 360 atcaccgttt ctggagggtc gcgaactctt cagcatctct gtgagatggc aattcggtct 420 aagcaagaac tgctacagct tgccccaatc gaagtggaaa gtaatgtatc aagaggatgc 480 cctgaaggta ctgagacctt cgaaaaagaa agcgagtaa 519
Claims
1. The application of the P19 mutant protein of Dianthus caryophyllus Italian ringspot virus in the preparation of reagents for reducing the virulence of Pseudomonas aeruginosa, characterized in that, The expression of the P19 mutant protein in Pseudomonas aeruginosa reduces the synthesis of pyocyanin in Pseudomonas aeruginosa; the amino acid sequence of the P19 mutant protein is shown in SEQ ID NO.
3.
2. The application according to claim 1, characterized in that, The expression of the P19 mutant protein in Pseudomonas aeruginosa is achieved by constructing a recombinant expression vector of the P19 mutant protein and then introducing it into Pseudomonas aeruginosa.
3. The application according to claim 1 or 2, characterized in that, The nucleotide sequence encoding the P19 mutant protein is shown in SEQ ID NO.4.
Citation Information
Patent Citations
Fixed-locus plant genome modification method
CN106222197A
High-yield pyocyanin engineering bacterium and construction method and application thereof
CN111849851A