A lineage tracing method for early sheep embryonic development based on the CRISPR-Cas9 system and the PB transposon system

By inserting Cas9-T2A-EGFP and integrating the barcode into the sheep Rosa26 gene using the CRISPR-Cas9 and PB transposon systems, the problem of tracing cell lineages in early embryonic development of higher mammals has been solved, enabling high-resolution cell development tracking and molecular mapping, and providing an important reference for organ reconstruction and tissue regeneration.

CN116103342BActive Publication Date: 2026-01-30CHINA AGRI UNIV
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202211612527.0
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2022-12-14
Publication Date
2026-01-30
Estimated Expiration
2042-12-14

AI Technical Summary

Technical Problem

The lack of effective cell lineage tracing methods in existing technologies, especially in the early embryonic development of higher mammals such as sheep, makes it difficult to track cell developmental trajectories and fate maps of organ and tissue formation, thus limiting research on organ reconstruction and tissue regeneration.

Method used

Using the CRISPR-Cas9 system and the PB transposon system, three Cas9 target sites were inserted into the sheep Rosa26 gene to form a tandem array in the 3'UTR of tdTomato, combined with 40 8-base-pair integration barcodes, and single-cell transcription sequencing technology was used to track cell development processes.

Benefits of technology

It achieves high-resolution cell lineage tracking, provides molecular and cellular atlases of early embryonic development in ruminants, supports organ reconstruction and tissue regeneration research, avoids the instability of fluorescence genetic tracing technology, and has the advantages of simple operation and low cost.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure BDA0003999709520000021
    Figure BDA0003999709520000021
  • Figure BDA0003999709520000031
    Figure BDA0003999709520000031
  • Figure BDA0003999709520000041
    Figure BDA0003999709520000041
Patent Text Reader

Abstract

This invention discloses a lineage tracing method for early sheep embryonic development based on the CRISPR-Cas9 system and the PB transposon system. Specifically, it involves CRISPR-Cas9-mediated knockout of the sheep Rosa26 gene and site-specific insertion of the Cas9-T2A-EGFP gene to edit synthetic target DNA. This invention also provides a lineage tracing vector mediated by the synthetic target DNA. This vector contains 40 integrated barcodes, the synthetic target DNA, and three corresponding independent transcribed sgRNAs. The synthetic target DNA is embedded in a PB transposon vector expressing the red fluorescent protein tdTomato. This system can generate a large number of heritable repair results, and these sequences can be distinguished by the integrated barcodes. This lineage tracing vector system can be directly transfected into target cells, and the target cells can be tracked as development progresses, providing a comprehensive molecular-cellular atlas of ruminant development, with broad application prospects.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] This invention relates to the field of genetic engineering technology, and more specifically, to a pedigree tracing method for early sheep embryonic development based on the CRISPR-Cas9 system and the PB transposon system. Background Technology

[0002] Cells are the basic unit of all living organisms, and animal cells continuously migrate and differentiate from the beginning of embryonic development. Tracing the state of cells is crucial for understanding cell origin and fate, the development and regeneration of tissues and organs, and the mechanisms of physiological diseases. Cell lineage tracing technology can track the differentiation and developmental activities of specific single cells and their progeny. This technology has been applied in stem cell therapy, gene function research, organ transplantation, and new drug development. The CRISPR-Cas9 system enables highly efficient gene editing, including site-directed insertion, knockout, and mutation. After the CRISPR-Cas9 system cuts DNA, it produces indels. Different indel mutation sequences are passed on to daughter cells during cell division, forming lineage tracing barcodes. Combined with single-cell sequencing technology, cell lineage tracing can be performed efficiently. Recent studies have involved transferring artificially synthesized exogenous DNA barcodes into cells and then using CRISPR-Cas9 to edit target sites. Different genome repair results after target site cutting produce imprints. Theoretically, cells from the same origin will carry the common imprints of their progenitor cells. Analyzing these barcodes can construct phylogenetic trees of different cells. This demonstrates that cell lineage tracing technology has enormous development potential and application value.

[0003] Accurately inferring lineage relationships between cells is a major bottleneck in current ruminant cell lineage tracing technology, particularly in tracking how cells and their progeny change over time. Single-cell sequencing technology has significantly advanced fields such as developmental biology and cancer biology. Combining single-cell sequencing with genetic tracing techniques—accessing naturally occurring genetic markers accumulated in progeny through multiple cell divisions and then inferring lineage relationships through shared markers—can improve the accuracy of developmental trajectory inference and provides a systematic approach to tracing cell origins.

[0004] Early embryonic development in mammals involves cell fate determination at multiple levels and is one of the most important molecular events in living organisms. Studying the process of early embryonic lineage establishment, the fate determination of different germ layers and tissue precursor cells, and the regulatory mechanisms of their occurrence and development can not only prevent early developmental diseases and guide cell differentiation and transdifferentiation, but also provide a reference for the application of large animals in human organ reconstruction and tissue regeneration. Lineage tracing technology can provide a comprehensive molecular cellular atlas of animal development. Especially in the last five or six years, it has developed rapidly, with more and more lineage tracing technology development and experimental research results appearing in international academic journals, becoming an important topic of discussion in the international biological community. However, to date, cell lineage tracing has mainly focused on model animals such as nematodes, zebrafish, and mice, with no reports on higher mammals. Large animals such as sheep are not only important economic animals, but also more similar to humans in certain organ structures, sizes, and physiological metabolism, making them relatively ideal models for organ reconstruction and biomedical applications. Therefore, there is an urgent need to develop lineage tracing technology for early embryonic development in ruminants to observe the fate map of organ and tissue formation. Summary of the Invention

[0005] The purpose of this invention is to provide a pedigree tracing method for early sheep embryonic development based on the CRISPR-Cas9 system and the PB transposon system.

[0006] The concept of this invention is as follows: Using CRISPR-Cas9 technology, Cas9-T2A-EGFP is inserted site-specifically into the sheep Rosa26 gene, and overexpressed in early embryos using the CMV promoter. Simultaneously, three Cas9 target sites, forming a tandem array in the 3'UTR of the red fluorescent protein tdTomato, are introduced into the genome using the PB transposon. After multiple rounds of cell division, the edited target sites accumulate, and then these sequences are distinguished by a 40-base-pair integration barcode between the 3'UTR of tdTomato and the three Cas9 target sites. This can be used to study the lineage of sheep embryonic development and reconstruct the hierarchical structure of different cell types.

[0007] To achieve the objectives of this invention, in a first aspect, this invention provides a carrier system for ruminant pedigree tracing, which consists of 40 carriers for ruminant pedigree tracing, wherein each carrier carries a different integrated barcode intBC.

[0008] The vector used for ruminant lineage tracing is constructed by inserting a lineage tracing vector into a PB transposon vector expressing red fluorescent protein.

[0009] The lineage tracking vector includes an integrated barcode intBC, a synthetic target DNA sequence, and three independently transcribed sgRNAs that target the synthetic target DNA sequence.

[0010] Primers used to amplify 40 integrated barcode intBC sequences are shown in Table 1:

[0011] Table 1. 40 types of intBC primers

[0012]

[0013]

[0014]

[0015] Furthermore, the lineage tracing vector comprises the following structure: an integrated barcode intBC-synthesized target DNA sequence-bGH poly(A)-three independently transcribed sgRNAs.

[0016] The synthetic target DNA sequence contains three sites, ade2, bam3 and white B, denoted as sites 1 to 3, and its nucleotide sequence is shown in SEQ ID NO:6;

[0017] The three independently transcribed sgRNAs target sites 1 to 3, respectively. The sgRNA targeting site 1 is controlled by the mU6 promoter, the sgRNA targeting site 2 is controlled by the hU6 promoter, and the sgRNA targeting site 3 is controlled by the bU6 promoter.

[0018] Furthermore, in the structure of the lineage tracer vector, the nucleotide sequences of the three independently transcribed sgRNAs, namely the target DNA sequence -bGH poly(A), are shown in SEQ ID NO:7.

[0019] Furthermore, the vector for tracing ruminant lineages comprises the following structure: EF1α promoter - tdTomato - integrated barcode intBC - synthetic target DNA sequence - bGH poly(A) - three independently transcribed sgRNAs.

[0020] Secondly, the present invention provides the application of the carrier system in ruminant pedigree tracing.

[0021] Thirdly, the present invention provides a sheep early embryonic development pedigree tracing system, including a sheep Rosa26 gene editing vector based on CRISPR-Cas9 technology and the vector system for ruminant pedigree tracing.

[0022] The gene editing vectors include CRISPR-Cas9 targeting vectors and gene homologous recombination vectors.

[0023] The CRISPR-Cas9 targeting vector contains DNA fragments encoding sgRNA sequences (sgRNA1, sgRNA2).

[0024] Preferably, the skeleton carrier is PX458.

[0025] Preferably, the nucleotide sequences of the sgRNA action site are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0026] The gene homologous recombination vector contains Donor DNA and element sequences for inserting the Donor DNA into the sheep Rosa26 gene via homologous end repair.

[0027] Preferably, the Donor DNA is Cas9-T2A-EGFP.

[0028] Furthermore, the gene homologous recombination vector comprises the following structure: left homologous arm-CMV promoter-Cas9-T2A-EGFP-bGH poly(A)-right homologous arm.

[0029] Preferably, the nucleotide sequences of the left and right homologous arms are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.

[0030] Fourthly, the present invention provides the application of the system in pedigree tracing of early sheep embryonic development.

[0031] Fifthly, the present invention provides a method for pedigree tracing of early sheep embryonic development based on the CRISPR-Cas9 system and the PB transposon system. The method includes: microinjecting the sheep early embryonic development pedigree tracing system into a sheep pronuclear embryo to generate a large number of heritable indels; combining 40 integrated barcodes with inducible CRISPR-Cas9 indels; and using single-cell transcription sequencing technology to trace the developmental process of different cells.

[0032] By employing the above technical solution, the present invention has at least the following advantages and beneficial effects:

[0033] This invention utilizes a combination of the CRISPR-Cas9 system and the PB transposon system to construct an improved pedigree tracking vector system for ruminants. This vector system contains an 8-base-pair static integrated barcode (intBC) and a 260-base-pair synthetic target DNA (with 3 CRISPR / Cas cleavage sites). This synthetic DNA sequence is embedded in a PB transposon vector expressing red fluorescent protein. Another vector, based on Rosa26 safe homologous recombination for efficient EGFP-Cas9 expression, is used to edit the synthetic target DNA. This system can generate a large number of heritable repair results and target sites, enabling large-scale application in ruminant systems. It can record pedigree and other information at high resolution, revealing cell populations with continuous phenotypic lineages, and contributing to the understanding of molecular mechanisms from early embryonic development to organogenesis, aiming to provide a reference for the application of ruminants in human organ reconstruction and tissue regeneration.

[0034] This invention involves co-injecting a homologous recombination vector and a targeting vector into sheep pronuclear embryos via microinjection. The CMV promoter in the donor vector constructed using the Gibson Assembly method enables stable expression of Cas9-T2A-EGFP in sheep embryos, thereby continuously editing the synthetic target DNA and generating diversity throughout the tracing process.

[0035] The lineage vector system constructed in this invention can be directly transfected into target cells. As the target cells develop, they can be tracked. By integrating barcodes, lineage tracking and single-cell level transcriptome analysis can be performed simultaneously in thousands of individual cells. This provides a systematic method to track the origin of novel cells or identify known cell types under different conditions, with minimal impact on cell phenotype. At the same time, it does not involve the modification and optimization of the gene editing system itself. It has the advantages of simple operation and low cost, and has great application value and market potential. Attached Figure Description

[0036] Figure 1 The image shows two targeting vectors at the sheep Rosa26 site in a preferred embodiment of the present invention.

[0037] Figure 2 This is a schematic diagram of CRISPR-Cas9 gene editing targeting and homology repair template for the sheep Rosa26 gene in a preferred embodiment of the present invention. The sequences shown in the figure are the corresponding targeting sites (two sgRNAs) of the sheep Rosa26 gene; LHA and RHA represent the left and right homology arms, respectively, with lengths of 1017bp and 1004bp. The boxes contain the Cas9 gene to be integrated and the exogenous green fluorescent marker gene EGFP.

[0038] Figure 3The image shows PCR amplification electrophoresis images of LHA (1069bp after amplification), RHA (1060bp after amplification), and Cas9-T2A-EGFP (6128bp) vector fragments in the homologous recombination vector in a preferred embodiment of the present invention.

[0039] Figure 4 This is a schematic diagram of the structure of the ruminant pedigree tracer in a preferred embodiment of the present invention.

[0040] Figure 5 This is a schematic diagram illustrating the principle of ruminant pedigree tracing in a preferred embodiment of the present invention.

[0041] Figure 6 The image shown is an electrophoresis diagram of the homologous recombinant vector digested with enzymes in a preferred embodiment of the present invention, revealing a fragment size of 8153 bp.

[0042] Figure 7 The image shown is an electrophoresis diagram of the lineage tracer vector digested with enzymes in a preferred embodiment of the present invention, yielding a fragment size of 6072 bp.

[0043] Figure 8 This is an in vitro transcription electrophoresis diagram of sgRNA1, sgRNA2, PB enzyme mRNA, and Cas9 mRNA in a preferred embodiment of the present invention.

[0044] Figure 9 This is a microinjection diagram of the homologous recombination sequence, the CRISPR-Cas9 system vector, and the lineage tracing vector in a preferred embodiment of the present invention.

[0045] Figure 10 The images shown are fluorescence detection images of sheep embryos at stages E18.5 and E19.5 in a preferred embodiment of the present invention.

[0046] Figure 11 This is a statistical chart showing the number of intBCs detected in embryo samples in a preferred embodiment of the present invention. Detailed Implementation

[0047] The present invention aims to provide a lineage tracing microinjection system based on a vector for high-efficiency expression of EGFP-Cas9 by homologous recombination at the Rosa26 site in ruminants, which edits synthetic target DNA, thereby obtaining early embryos that can be used for lineage tracing of organ development in ruminants. These embryos express green and red fluorescence and produce a variety of indels.

[0048] This invention provides a gRNA site for effective editing of the Rosa26 site in sheep in the future. The resulting indel-expressing embryos can be accurately traced to a large number of cell sources, avoiding the reliability reduction caused by the instability of fluorescent genetic tracing technology. It provides important animal materials for future research on organ development and xenotransplantation and has clinical application value.

[0049] Preferably, the gene editing is CRISPR-Cas9-mediated gene editing achieved through homology repair.

[0050] The present invention adopts the following technical solution:

[0051] In one aspect, the present invention provides two sgRNAs that specifically target the sheep Rosa26 gene based on CRISPR-Cas9 technology.

[0052] Based on CRISPR-Cas9 technology, sgRNA1 and sgRNA2 of the sheep Rosa26 gene are specifically targeted. The nucleotide sequences of the action sites of sgRNA1 and sgRNA2 are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively.

[0053] Secondly, the present invention provides a CRISPR-Cas9 targeting vector containing the above-mentioned sgRNA1 and sgRNA2.

[0054] Preferably, the skeleton carrier is PX458.

[0055] Thirdly, the present invention provides a donor vector with higher biosafety that does not contain any eukaryotic selection markers. The vector contains a CMV promoter, the target gene Cas9-T2A-EGFP, a transcription termination signal of bGH poly(A)signal, and left and right homologous arm sequences for homologous recombination at the Rosa26 target site.

[0056] The target gene expression cassette structure is: CMV-Cas9-T2A-EGFP-bGH poly(A).

[0057] The element sequence includes left and right homologous arms for homologous recombination at the target site of the sheep Rosa26 gene, and their nucleotide sequences are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively.

[0058] The gene homologous recombination vector includes the following structure: left homologous arm-CMV promoter-Cas9-T2A-EGFP-bGHpoly(A)-right homologous arm.

[0059] Preferably, the donor vector can be constructed using the Gibson Assembly method, which overcomes the drawback of traditional enzyme digestion and ligation methods having no suitable restriction sites when the sequence length is large and the number of ligation fragments is large, through seamless ligation.

[0060] Fourthly, the present invention provides a sheep Rosa26 gene editing vector developed based on CRISPR-Cas9 technology, including the above-mentioned CRISPR-Cas9 targeting vector and gene homologous recombination vector.

[0061] The homologous recombination vector contains the target gene Cas9-T2A-EGFP and an element sequence (homologous recombination DNA fragment) for inserting the target gene into the sheep Rosa26 gene via homologous end repair.

[0062] Another object of the present invention is to provide a method for constructing a model of organ development in ruminants that traces the lineage.

[0063] This invention provides a pedigree tracing vector for ruminants, the vector system comprising an 8-base-pair static integrated barcode intBC, a 260-base-pair synthetic target DNA (3 CRISPR / Cas cleavage sites), and three independent sgRNAs.

[0064] In this invention, the integrated barcode intBC consists of 8 base pairs and has 40 types.

[0065] The lineage tracing vector comprises the following structure: intBC(1-40) - a synthetic target gene of 260 base pairs - bGHpoly(A) - three independently transcribed sgRNAs.

[0066] The target gene for the synthesis of the 260 base pairs is whiteB(site 3)-bri1-bam3(site 2)-whiteL-ade2(site 1), and its nucleotide sequence is shown in SEQ ID NO:6.

[0067] In this invention, the three independent transcribed sgRNAs are each controlled by an independent promoter: site 1 (ade2) is controlled by the mU6 promoter, site 2 (bam3) is controlled by the hU6 promoter, and site 3 (white B) is controlled by the bU6 promoter.

[0068] In this invention, the lineage tracing vector is inserted into a PB transposon vector expressing red fluorescent protein, and the synthetic target gene is knocked out by the CRISPR-Cas9 system.

[0069] The vector structure comprises the following: EF1α-tdTomato-intBC-white B(site 3)-bril-bam3(site 2)-white L-ade2(site 1)-bGH poly(A)-mU6-ade2 sgRNA-hU6-bam3 sgRNA-bU6-wihiteB sgRNA.

[0070] In this invention, the lineage tracer is transmitted in multiple copies via PB transposons.

[0071] The lineage tracing vector constructed in this invention is used to edit synthetic target genes by using the vector for efficient expression of EGFP-Cas9 based on homologous recombination at the Rosa26 site constructed above.

[0072] The ruminant pedigree tracing vector technology provided by the present invention includes introducing the sheep Rosa26 gene editing vector and the pedigree tracing vector into sheep pronuclear embryos.

[0073] This invention applies the aforementioned sgRNA1 and sgRNA2 targeting the sheep Rosa26 gene, the aforementioned CRISPR-Cas9 targeting vector, the aforementioned sheep Rosa26 gene editing vector, the aforementioned lineage tracing vector system, and the aforementioned ruminant lineage tracing vector technology to tracing the developmental process of cells from early embryonic to organogenesis stage.

[0074] This invention provides a method for CRISPR-Cas9-mediated knockout of the sheep Rosa26 gene and site-directed integration of the Cas9-T2A-EGFP gene. This method is used to edit synthetic target gene DNA. The CRISPR-Cas9 targeting vector, gene homologous recombination vector, and lineage tracing vector system are microinjected into sheep pronuclear embryos, generating a large number of heritable indels. Forty integration barcodes are combined with inducible CRISPR-Cas9 indels, and single-cell transcription sequencing is used to trace different cell developmental processes.

[0075] In this invention, the injection method includes introducing exogenous fragments into early animal embryos using microinjection.

[0076] In this invention, the concentration of homologous recombinant DNA fragment in the microinjection solution is 10 ng / ul; the concentration of 40 lineage tracer vector fragments is 10 ng / ul; the concentration of PB transposase mRNA is 100 ng / ul; the concentration of Cas9 mRNA is 100 ng / ul; and the concentrations of sgRNA1 and sgRNA2 are 100 ng / ul.

[0077] Specifically, the pedigree tracing method for ruminant mammals according to the present invention includes the following steps:

[0078] (1) Plasmid preparation: Two Cas9 / sgRNA plasmids to be introduced, homologous recombinant DNA fragments and 40 lineage tracing vectors were prepared.

[0079] (2) In vitro transcription of PB transposase, Cas9 enzyme, sgRNA1, and sgRNA2;

[0080] (3) Synchronize estrus for donor and recipient sheep, and perform superovulation and artificial insemination on donor sheep;

[0081] (4) Flushing pronuclear embryos from the oviduct of a donor sheep;

[0082] (5) The DNA template and RNA to be introduced are mixed evenly in proportion and microinjected into the pronuclear stage embryo;

[0083] (6) Surgical treatment of recipient sheep was performed, with 2-4 embryos transferred to the oviduct of each recipient sheep.

[0084] As a preferred embodiment of the present invention, in step (5) above, 10 ng / ul homologous recombinant DNA fragments are mixed evenly with 100 ng / ul sgRNA1, 100 ng / ul sgRNA2 and 40 10 ng / ul lineage tracer DNA templates, as well as 100 ng / ul PB transposase mRNA and 100 ng / ul Cas9 mRNA, and then microinjected.

[0085] In this invention, the animal is a mammal.

[0086] In one embodiment of the present invention, the animal embryo is an early embryo of a Hu sheep.

[0087] In this invention, the constructed lineage tracer vector system can be directly transfected into target cells, and the target cells can be tracked as they develop.

[0088] Preferably, the animal cells are derived from the mammal sheep.

[0089] In this invention, a lineage tracing system based on CRISPR barcodes is constructed. Compared with traditional lineage tracing methods, combining CRISPR barcodes with genetic operations can achieve high-resolution lineage tracking.

[0090] This invention utilizes a combination of the CRISPR-Cas9 system and the PB transposon (PiggyBac transposon) system to construct a pedigree tracing vector system for ruminants. This invention provides a method for CRISPR-Cas9-mediated knockout and site-specific insertion of the Cas9-T2A-EGFP gene into the sheep Rosa26 gene, used to edit synthetic target DNA. This invention also provides a pedigree tracing vector mediated by the synthetic target DNA. This vector contains 40 8-base-pair static integration barcodes (IntBC), 260-base-pair synthetic target DNA (3 CRISPR-Cas9 cleavage sites), and three corresponding independent transcribed sgRNAs. The synthetic target DNA sequence is embedded in a PB transposon vector expressing the red fluorescent protein tdTomato. This system can generate a large number of heritable repair results, and these sequences can be distinguished using the integration barcode. Meanwhile, the constructed lineage vector system can be directly transfected into target cells. By tracking the target cells as they develop, a comprehensive molecular and cellular atlas of ruminant development can be provided, with broad application prospects.

[0091] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the invention. Unless otherwise specified, the examples were conducted under conventional experimental conditions, such as those described in Sambrook et al.'s Molecular Cloning: A Laboratory Manual (Sambrook J & Russell DW, 2001), or according to the manufacturer's instructions. Example 1: Construction of CRISPR-Cas9 Targeting Vector

[0092] The target site is located in the sheep Rosa26 gene. The nucleotide sequences in sgRNA1 and sgRNA2 that recognize this target are shown in SEQ ID NO:1 and SEQ ID NO:2, respectively. Based on the above target sequence, corresponding primer sequences were designed (Table 2), synthesized by Beijing Qingke Biotechnology Co., Ltd., and purified by HPLC.

[0093] Table 2 Primers for targeting the sheep Rosa26 gene

[0094] Nucleotide name Sequence (5'-3') Ovis aries-Rosa26-sgRNA1-F caccgGGTGGAGTGAAATGAAGTCC Ovis aries-Rosa26-sgRNA1-R aaacGGACTTCATTTCACTCCACCc Ovis aries-Rosa26-sgRNA2-F caccgTGTGGGAAGATAAAGAAATT Ovis aries-Rosa26-sgRNA2-R aaacAATTTCTTTATCTTCCCACACc

[0095] Olio nucleic acid sequence formation: Primers were diluted to 100 μM, phosphorylated and annealed. The reaction mixture consisted of: 1 μl of Ovis aries-ROSA26-sgRNA1-F (100 μM), 1 μl of Ovis aries-Rosa26-sgRNA1-R (100 μM), 1 μl of 10×T4 ligation buffer, 1 μl of T4PNK, and 6 μl of ddH2O, for a total volume of 10 μl; and 1 μl of Ovis aries-Rosa26-sgRNA2-F (100 μM), 1 μl of Ovis aries-Rosa26-sgRNA2-R (100 μM), 1 μl of 10×T4 ligation buffer, 1 μl of T4PNK, and 6 μl of ddH2O, for a total volume of 10 μl. The reaction program was as follows: 37℃ for 30 min; 95℃ for 5 min, with the temperature decreasing by 5-25℃ per minute within the PCR instrument. After the reaction, the sample was diluted 250-fold, and the PX458 vector was digested with BbsI restriction enzyme. Ligation was performed overnight at 16°C. After the ligation reaction, linear DNA residues were removed using PlasmidSafe exonuclease at 37°C for 30 min and then at 70°C for 30 min. The sample was then stored at -20°C for at least one week.

[0096] The product obtained in this step can be directly used to transform *E. coli*, and DH5α competent cells are recommended. A heat shock method is used: take 2 μl of the PlasmidSafe plasmid, add it to 50 μl of competent cells, incubate on ice for 10 min, heat shock at 42℃ for 30 s, immediately place on ice for 2 min, add 100 μl of LB medium, and incubate at 37℃ for 1 h. Use LB plates containing Amp. Incubate overnight at 37℃. Observe the next day; the control plate should have no clones, while the plate containing the sgRNA insertion should have clones. Pick single clones and shake for 12 h; the bacterial culture is sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. After verifying the correct plasmid construction, extract the plasmid in small increments for subsequent experiments. The targeting vector map is shown below. Figure 1 As shown.

[0097] Example 2 Construction of homologous recombination vector

[0098] like Figure 2As shown, to insert Cas9-T2A-EGFP into the Rosa26 target site, homology-directed repair (HDR) is required to insert the locus with homologous arms into the target site. Since the construction of the donor vector requires cloning three long fragments into a single target vector, and given the uncertainty of restriction enzyme sites, it is difficult to guarantee proper splicing of each fragment. Therefore, Gibson Assembly, based on homologous recombination, is used, which can efficiently and seamlessly splice more long fragments together without being limited by restriction enzyme sites.

[0099] The structure of the donor carrier is as follows Figure 2 As shown, the upstream homologous arm 5-LHA, Cas9-T2A-EGFP, and the downstream homologous arm 3-RHA need to be ligated into the backbone vector pUC57-Amp. The upstream and downstream homologous arms are cloned from the sheep genome, and Cas9-T2A-EGFP is cloned from the laboratory-preserved vector PX458. Primers for each fragment are designed according to the Gibson Assembly primer design principle, and the primer sequences are shown in Table 3.

[0100] Table 3 Primers for amplification of each fragment of the donor vector.

[0101] Primer name Sequence (5'-3') LHA-F1 tcgagctcggtacctcgcgaatgcatGGACCGGAGCCATTGCTCCTG LHA-R1 aagttatgtaacgggtacctctagacttcgtcctctaaatcttata Cas9-T2A-EGFP-F tctagaggtacccgttacataactta Cas9-T2A-EGFP-R ttcctgcggccgctccccag RHA-F3 gcatgctggggagcggccgcaggaaccaacacctgggactgatttt RHA-R3 caagcttgcatgcaggcctctgcagTCGACctggaagggtaaggactatc

[0102] The LHA amplification system was as follows: 1 μl of Phanta MAX Super-Fidelity DNA Polymerase (P505, vazyme), 25 μl of 2×Phanta Max buffer, 1 μl of dNTP mix (10 mM each), 2 μl of forward primer (10 μM), 2 μl of reverse primer (10 μM), 2 μl of sheep genome template, and ddH2O to a final volume of 50 μl. The amplification conditions were: 98℃ pre-denaturation for 3 min; 34 cycles of 98℃ for 10 s, 52℃ for 15 s, and 72℃ for 15 s; after the cycles, 72℃ for 5 min and storage at 4℃. The amplification system for Cas9-T2A-EGFP was as follows: 1 μl of Phanta MAX Super-Fidelity DNA Polymerase (P505, vazyme), 25 μl of 2×Phanta Max buffer, 1 μl of dNTP mix (10 mM each), 2 μl of forward primer (10 μM), 2 μl of reverse primer (10 μM), 2 μl of sheep genomic template, and ddH2O to a final volume of 50 μl. The amplification conditions were: 98℃ pre-denaturation for 3 min; 98℃ for 10 s...

[0103] The amplification system for RHA was as follows: 1 μl of Phanta Max Super-Fidelity DNA Polymerase (P505, vazyme), 25 μl of 2×Phanta Max buffer, 1 μl of dNTP mix (10 mM each), 2 μl of forward primer (10 μM), 2 μl of reverse primer (10 μM), 2 μl of sheep genomic template, and ddH2O to a final volume of 50 μl. The amplification conditions were: 98℃ pre-denaturation for 3 min; 34 cycles of 98℃ for 10 s, 56℃ for 15 s, and 72℃ for 15 s; after each cycle, 72℃ for 5 min and storage at 4℃. The amplification results are shown below. Figure 3 As shown.

[0104] PCR product purification: (1) Take 100 μl of PCR product, add 5 times the volume of solution BB, mix well, add to a centrifuge column, centrifuge at 10000g for 1 min, and discard the effluent. (2) Add 650 μl of solution WB, centrifuge at 10000g for 1 min, and discard the effluent. (3) Centrifuge at 10000g for 2 min to completely remove the residual WB. (4) Place the centrifuge column in a clean centrifuge tube, add 50 μl of ddH2O to the center of the column, let stand at room temperature for 1 min, centrifuge at 10000g for 1 min to elute the DNA, and store the eluted DNA at -20℃.

[0105] The nucleotide sequences of the left and right homologous arms are shown in SEQ ID NO:3 and SEQ ID NO:4, respectively, and the nucleotide sequence of Cas9-T2A-EGFP is shown in SEQ ID NO:5.

[0106] Each purified fragment was seamlessly assembled using the pEASY-Uni Seamless Cloning and Assembly Kit (CU101-1) according to the manufacturer's instructions. The seamless cloning system consisted of: 5 μl of 2×Basic Assembli Mix, 0.25 pmol of Cas9-T2A-EGFP, 0.125 pmol of LHA, 0.125 pmol of RHA, 0.125 pmol of PUC57 fragment digested with enzymes, and water added to a final volume of 10 μl. The mixture was incubated at 50 °C for 30 min.

[0107] Example 3: Construction of lineage tracer vectors

[0108] To record the developmental trajectory and lineage of ruminant cells, a lineage tracing reporter system (40 lineage tracing plasmids) based on PB transposons was improved using CRISPR-Cas9 editing technology. When lineage tracing plasmids with PB vectors as the backbone were microinjected into sheep pronuclear embryos, a distinct red fluorescent tdTomato pattern was detected in the embryos upon integration of the PB transposons into the genome. (The structure of the lineage tracing vector is shown in the image below.) Figure 4 As shown. The lineage tracing vector consists of two parts. The first part, the target site, comprises an integration barcode intBC and three cleavage sites for Cas9 knockout. This sequence is inserted into the 3'UTR of the red fluorescent tdTomato. The second part encodes three independently transcribed sgRNAs, each controlled by a different promoter (mU6, hU6, and bU6, respectively, to allow recording of multiple distinct signals). The specific construction method is as follows:

[0109] (1) The phylogenetic tracer sequence whiteB(site 3)-bri1-bam3(site 2)-whiteL-ade2(site 1)-bGHpoly(A)signal-mU6-ade2 sgRNA-hU6-bam3 sgRNA-bU6-whiteB sgRNA was synthesized by General Biosciences. The synthesized sequence size is 2132bp, and the structural diagram is shown below. Figure 4 As shown, the DNA sequence encoding the above sequence is shown in SEQ ID NO:7.

[0110] (2) The original PB vector plasmid pPL149-PB-EF1a-tdTomato-Puro was digested with restriction endonucleases AscI and NotI, and 6316bp was recovered.

[0111] (3) The pPL149-PB-EF1a-tdTomato-Puro fragment recovered in step (2) and the lineage tracer sequence synthesized in step (1) were ligated. The ligation system was as follows: 2 μl of T4 Buffer, 0.02 pmol of PB vector fragment obtained by enzyme digestion, 0.06 pmol of lineage tracer sequence, 1 μl of T4 DNA Ligase, water added to 20 μl, and ligated overnight at 16°C to obtain a lineage tracer vector without integration barcode.

[0112] (4) Ligation of 40 integrated barcode fragments: intBC primers were synthesized by Beijing Qingke Biotechnology Co., Ltd., and the specific sequences are shown in Table 1. Ligation system for 40 intBC fragments: T4 Buffer 1 μl, IntBC1~40-F 2.5 μl, IntBC1~40-R 2.5 μl, add water to 10 μl; 95℃, 5 minutes, then dilute 50 times after completion and set aside.

[0113] (5) Enzyme digestion of lineage tracer vector without integrated barcode: 10×NEBuffer 5ul, lineage tracer plasmid without integrated barcode 3ug, SpeI 2ul, NotI 2ul, add water to 50ul, and recover the 8462bp fragment after enzyme digestion.

[0114] (6) Construct 40 lineage tracer vectors with integrated barcodes: The 8462bp lineage tracer vector fragment without integrated barcode after enzyme digestion was ligated with the 40 intBC fragments in step (4) using T4 DNA Ligase to obtain 40 lineage tracer plasmids with integrated barcode intBC.

[0115] A schematic diagram illustrating the principle of ruminant pedigree tracing is shown below. Figure 5 Each cell contains multiple genomes and target integration sites that can be distinguished by intBCs. sgRNA guides Cas9 to the cleavage site to generate insertion or deletion mutations. Cas9 is used to generate insertions or deletions when repairing double-strand breaks. These breaks are inherited in the next generation of cells and are distinguished by tracking different intBCs, thus recording pedigree information of early ruminant embryos.

[0116] Example 4: Enzyme digestion of homologous recombinant plasmids and 40 vectors carrying integrated barcode lineage tracers

[0117] The sheep Rosa26 homologous recombinant plasmid from Example 2 was digested with enzymes. The specific digestion system was as follows: 10×NEBuffer 10 μl, plasmid 20 μg, NsiI 5 μl, SalI 5 μl, and water was added to a final volume of 100 μl. The digested fragment was 8153 bp. The results of the enzyme digestion electrophoresis are shown below. Figure 6 As shown.

[0118] Forty lineage tracer plasmids with integrated barcodes from Example 3 were digested with enzymes. The specific digestion system was as follows: 10×NEBuffer 5 μl, plasmid 3 μg, PspXI 2 μl, EcoRI 2 μl, water added to 50 μl. The digested fragment was 6072 bp. The results of enzyme digestion electrophoresis are shown below. Figure 7 As shown.

[0119] Enzyme digestion product purification: Prepare an agarose gel of appropriate concentration and separate DNA fragments by electrophoresis. After the DNA fragments are separated, place the gel under a UV lamp, quickly cut off the gel containing the target DNA fragment, and recover and purify the DNA. The operation is as follows: (1) Separate the target gel fragment under a UV lamp, place it in a clean EP tube, and weigh it. The formula for converting the gel volume is: 100μl = 100mg. (2) Add 3 times the volume of Buffer GDP to the EP tube, shake to mix, and place it in a 50℃ water bath to fully dissolve the gel block for 7-10 minutes. (3) Take out the HiPure DNA Column and the Collection Tube and set them up correctly as required. Transfer the solution in (2) into the HiPure DNA Column tube, and then centrifuge at 12000rpm for 1 minute. Repeat the centrifugation once. (4) Take 150ul of Buffer GDP and add it to the HiPure DNA Column. Let it stand for 1 minute and centrifuge under the same conditions as above. (5) Add 2500 μl of buffer DW containing anhydrous ethanol to the HiPure DNA Column, centrifuge under the same conditions as above, discard the filtrate, and repeat centrifugation once. (6) Centrifuge for another 2 min under the same conditions. (7) Take a new Collection Tube, place the HiPure DNA Column in place, and add 25 μl of RNase-free ddH2O to the HiPure DNA Column. Let it stand at room temperature for 2 min. (8) Centrifuge at 12000 rpm for 1 min to collect the DNA and store at -20℃.

[0120] Example 5: In vitro transcription of CRISPR-Cas9 targeting vector and lineage tracer system

[0121] The two targeting vectors, PB enzyme vector, and Cas9 vector constructed in Example 1 were subjected to in vitro transcription. The in vitro transcription steps were described in the kit instructions. Specific transcription details are provided below. Figure 8 The primer sequences for in vitro transcription are shown in Table 4.

[0122] Table 4 Primer sequences for in vitro transcription

[0123]

[0124]

[0125] Example 6: Microinjection of CRISPR-Cas9 vector system and lineage tracing system into ruminants

[0126] Two sgRNAs, PB enzyme mRNA, Cas9 enzyme mRNA transcribed in Example 5, along with a sheep Rosa26 homologous recombinant DNA fragment and 40 lineage tracer fragments, were co-injected into Hu sheep pronuclear embryos. The specific procedure is as follows:

[0127] (1) Eighteen hours after insemination in the uterine horn of the donor sheep, the uterus was exposed to the window surface by surgical means, and the pronuclear embryo was flushed out from the oviduct and the development of the corpus luteum in both ovaries was recorded.

[0128] (2) Fertilized eggs with clear zona pellucida and uniform cytoplasm visible in the pronucleus were selected for pronuclear microinjection. The in vitro transcribed Cas9 mRNA, PB mRNA, sgRNA1, and sgRNA2 were diluted to 100 ng / μl, the sheep Rosa26 homologous recombinant DNA fragment was diluted to 10 ng / μl, and the 40 lineage tracer fragments were diluted to 10 ng / μl before microinjection. The microinjection details are as follows: Figure 9 As shown.

[0129] (3) Surgical treatment of recipient sheep, with 2-4 embryos transferred to each recipient oviduct. After the surgery, the sheep need to be observed in a small pen for 1 day. The pen should be kept clean to prevent wound infection and ensure postoperative recovery.

[0130] Example 7: Detection of lineage tracing results at different embryonic stages

[0131] When the embryos of Example 6 developed to E18.5 and E19.5, they were removed and photographed under a fluorescence microscope, revealing obvious fluorescence. Specific details are as follows... Figure 10 As shown; the expression of intBC in the test sample was examined, and up to 39 types of intBC could be detected in a single sample. See the detailed results below. Figure 11 The test results showed that the CRISPR-Cas9 targeting system and lineage tracer vector system were successfully introduced into sheep pronuclear embryos.

[0132] Although the present invention has been described in detail above with general descriptions and specific embodiments, modifications or improvements can be made to it, which will be obvious to those skilled in the art. Therefore, all such modifications or improvements made without departing from the spirit of the present invention fall within the scope of protection claimed by the present invention.

Claims

1. A carrier system for ruminant lineage tracing, characterized in that, It is composed of 40 vectors for ruminant lineage tracing, wherein each vector carries a different integrated barcode intBC; The vector for ruminant lineage tracing is constructed by inserting a lineage tracing vector into a PB transposon vector expressing red fluorescent protein; The lineage tracing vector comprises an integrated barcode intBC, a synthetic target DNA sequence, and three independently transcribed sgRNAs targeting the synthetic target DNA sequence; The lineage tracing vector comprises the following structure: integrated barcode intBC-synthetic target DNA sequence-bGH poly(A)-three independently transcribed sgRNAs; The synthetic target DNA sequence comprises three sites ade2, bam3 and white B, respectively denoted as site 1-site 3, and the nucleotide sequence is shown in SEQ ID NO: 6; The three independently transcribed sgRNAs target site 1-site 3, respectively; The primers for amplifying the integrated barcode intBC are as follows: The sgRNA targeting site 1 is controlled by mU6 promoter, the sgRNA targeting site 2 is controlled by hU6 promoter, and the sgRNA targeting site 3 is controlled by bU6 promoter; The nucleotide sequence of the synthetic target DNA sequence-bGH poly(A)-three independently transcribed sgRNAs in the structure of the lineage tracing vector is shown in SEQ ID NO:

7.

2. The carrier system according to claim 1, characterized in that The vector for ruminant lineage tracing comprises the following structure: EF1α promoter-tdTomato-integrated barcode intBC-synthetic target DNA sequence-bGH poly(A)-three independently transcribed sgRNAs.

3. Use of the vector system of claim 1 or 2 in ruminant lineage tracing.

4. A sheep early embryonic development lineage tracing system characterised in that, The system comprises a sheep Rosa26 gene editing vector based on CRISPR-Cas9 technology and the vector system of claim 1 or 2; The gene editing vector comprises a CRISPR-Cas9 targeting vector and a gene homologous recombination vector; The CRISPR-Cas9 targeting vector contains a DNA fragment encoding sgRNA sequence; The nucleotide sequences of the sgRNA action sites are shown in SEQ ID NO: 1 and SEQ ID NO: 2, respectively; The gene homologous recombination vector comprises a Donor DNA and an element sequence for site-specific insertion of the Donor DNA into the sheep Rosa26 gene through homologous end repair; The Donor DNA is Cas9-T2A-EGFP.

5. The system of claim 4, wherein, The gene homologous recombination vector comprises the following structure: left homologous arm-CMV promoter-Cas9-T2A-EGFP-bGH poly(A)-right homologous arm; The nucleotide sequences of the left and right homologous arms are shown in SEQ ID NO: 3 and SEQ ID NO: 4, respectively.

6. Use of the system of claim 4 or 5 in sheep early embryonic development lineage tracing.

7. A method for lineage tracing of sheep early embryo development based on the CRISPR-Cas9 system and the PB transposon system, characterized in that, The method comprises: microinjecting the system of claim 4 or 5 into a sheep pronuclear embryo, and combining single-cell transcriptome sequencing technology to track the development process of different cells.

Citation Information

Patent Citations

  • Dox-regulated pedigree tracing technology for recording pig tissue differentiation and organogenesis

    CN114908097A