Application of Hippo-Yap pathway regulator in promoting directed differentiation of induced pluripotent stem cells into pancreatic progenitor cells

Abstract

The present invention belongs to the technical field of cell biology, and particularly relates to the application of Hippo-Yap pathway regulators in promoting the directed differentiation of induced pluripotent stem cells into pancreatic progenitor cells. The method of the present invention can efficiently obtain pancreatic progenitor cells derived from non-human primate rhesus monkeys in vitro, providing a material source for further obtaining functional pancreatic islet β cells of non-human primate rhesus monkeys, and more importantly, providing a practical basis for the autologous transplantation treatment of non-human primate diabetic animal models.

Description

Technical Field

[0001] The present invention belongs to the technical field of cell biology, and particularly relates to the application of Hippo-Yap pathway regulators in promoting the directional differentiation of induced pluripotent stem cells into pancreatic progenitor cells. Background Art

[0002] Diabetes is a metabolic disorder disease that cannot normally regulate blood glucose levels in the biological body. Among them, type I diabetes is mainly caused by the decline of β-cell function and the lack of absolute insulin secretion due to the autoimmune attack on pancreatic islet β-cells in patients. So far, in addition to long-term injection of exogenous insulin to treat type I diabetes patients, pancreatic islet transplantation has also been proven to be able to effectively cure type I diabetes. However, due to the extreme lack of pancreatic islet donors and the existence of allogeneic immune rejection, this treatment method has not become the main means of treating type I diabetes.

[0003] Animal models are the basis for studying human diseases. Currently, the most commonly used model animals for diabetes research are still rodents. However, there are huge differences in various physiological functions between rodents and primates, especially in terms of their long evolutionary distance from humans. Therefore, rodent animal models are more suitable for basic research and have little real clinical guiding significance. As a non-human primate, the rhesus monkey is closer to humans in terms of anatomy, pathophysiology, immunity, and drug metabolism reactions, and is a more valuable model animal for preclinical evaluation of the effectiveness and safety of immune-related treatments and stem cell transplantation treatments. The autologous transplantation treatment with in vitro induced functional β-cells derived from rhesus monkeys has important guiding significance for the clinical application of future stem cell autologous transplantation treatment plans. The latest data show that functional β-cells induced from human induced pluripotent stem cells for transplantation treatment of non-human primate rhesus monkey diabetes models have good curative effects, but are still restricted by the problem of immune rejection between different species, and the grafts are quickly cleared in the body, so it is impossible to make the most accurate safety and effectiveness evaluation for this treatment method, especially the long-term safety and effectiveness evaluation in the body, to provide direct pathological and toxicological evidence for human autologous transplantation. Therefore, inducing functional β-cells from non-human primate sources in vitro and treating them in the form of autologous transplantation is of great significance for the feasibility, safety, and effectiveness evaluation of this treatment method.

[0004] Therefore, it is urgently necessary to further study how to effectively improve the differentiation efficiency of induced pluripotent stem cells of non-human primates into the pancreatic lineage and finally form pancreatic progenitor cells. Summary of the Invention

[0005] To solve the above problems, the present invention aims to find a method for promoting the directed differentiation of induced pluripotent stem cells of non-human primates (monkey iPSCs) into pancreatic progenitor cells.

[0006] For this purpose, the first object of the present invention is to provide the application of Hippo-YAP pathway regulators in promoting the directed differentiation of induced pluripotent stem cells into pancreatic progenitor cells. The Hippo-YAP pathway regulators are used to activate YAP and thus promote the specific differentiation of induced pluripotent stem cells derived from non-human primates into pancreatic progenitor cells.

[0007] The Hippo signaling pathway is one of the important intracellular signal transduction mechanisms. The inhibition of this signaling pathway ultimately leads to the activation of its downstream effector molecule YAP. YAP accumulates in the nucleus and initiates the expression of a series of downstream genes, thereby affecting cell proliferation, cytoskeleton, cell junctions, cell migration, and so on. There have been many reports indicating that the Hippo-YAP pathway plays a crucial role in early embryonic development, especially in pancreatic development. For example, Hippo activation can phosphorylate PDX1 at Thr11, leading to the degradation of PDX1 in a ubiquitinated form; YAP activation can promote the proliferation and epithelial transformation of pancreatic progenitor cells during early pancreatic development, and also promote the expression of multiple pancreatic precursor marker genes including NKX6.1.

[0008] The present invention searches for suitable pathway regulators from the Hippo-YAP signaling pathway, inhibits this signaling pathway, and ultimately stabilizes the accumulation of YAP in the nucleus and initiates transcription to promote the directed differentiation of induced pluripotent stem cells into endoderm cells, then further specialize into the pancreatic lineage, and finally differentiate into pancreatic progenitor cells. Pancreatic progenitor cells (PP) are a cell stage that stem cells will experience during the differentiation into pancreatic islet β cells. The cells at this stage have the ability of self-renewal and proliferation. The pancreatic progenitor cells obtained by differentiation are cultured and amplified in vitro to form a cell line, which can simplify the differentiation process, reduce the differentiation difficulty, thereby shortening the differentiation time, and ultimately making the pancreatic differentiation process more controllable and stable.

[0009] As a preference of the above technical solution, the Hippo-YAP pathway regulator is S1P or LPA or S1P + LPA.

[0010] The Hippo pathway is often considered a downstream branch of the GPCR signaling pathway because the activity of its core kinases Lats1 / 2 is mainly regulated by G protein-coupled receptor (GPCR) signals in cells. Among them, the small molecule sphingosine 1-phosphate (S1P) and blood-derived lysophosphatidic acid (LPA) are both lysophospholipid compounds. Both S1P and LPA mainly specifically activate cell surface G protein-coupled receptors (GPCRs), then cause intracellular signal cascades, and subsequently regulate signal pathways. There have been a large number of research data reports that both S1P and LPA can inhibit the core kinases Lats1 / 2 of the Hippo pathway through coupled receptors G12 / 13, Gq / 11, and Gi / o, and activate RHO and actin, ultimately stabilizing the accumulation of YAP in the nucleus and initiating transcription. In addition, YAP is often involved in gene expression, cell migration, and proliferation induced by LPA. In particular, studies have shown that S1P can reverse the dorsal pancreatic developmental disorder phenotype in CDH2 knockout mice and can stabilize the expression of PDX1.

[0011] Through the experimental exploration of the inventors, in the process of the differentiation of definitive endoderm cells into pancreatic progenitor cells, S1P or LPA or S1P+LPA is used stage by stage as a Hippo-YAP pathway regulator in the present invention, thereby establishing an efficient differentiation protocol for rhesus (macaque) pancreatic progenitor cells.

[0012] As a preference of the above technical solution, the final working concentrations of S1P and LPA are: S1P is 0.25 μM - 2 μM, and LPA is 5 μM - 20 μM.

[0013] As a preference of the above technical solution, the non-human primate is a rhesus monkey.

[0014] The second object of the present invention is to provide a culture medium for promoting the directed differentiation of induced pluripotent stem cells (monkey iPSCs) of non-human primates into pancreatic progenitor cells, which contains the above-mentioned Hippo-YAP pathway regulator.

[0015] As a preference of the above technical solution, the Hippo-YAP pathway regulator is S1P or LPA or S1P+LPA.

[0016] As a preference of the above technical solution, the final working concentrations of S1P and LPA are: S1P is 0.25 μM - 2 μM, and LPA is 5 μM - 20 μM.

[0017] As a preference of the above technical solution, the non-human primate is a rhesus monkey.

[0018] The third objective of the present invention is to provide a method for promoting the directed differentiation of induced pluripotent stem cells of non-human primates (monkey iPSC) into pancreatic progenitor cells, comprising the following steps:

[0019] S1. Induce pluripotent stem cells to differentiate into definitive endoderm cells;

[0020] S2. Induce definitive endoderm cells to specialize into the pancreatic lineage, and add a Hippo-YAP pathway regulator during the induction process;

[0021] S3. Further differentiate pancreatic lineage cells into pancreatic progenitor cells.

[0022] More preferably, in S1, the specific steps for inducing pluripotent stem cells to differentiate into definitive endoderm cells are as follows:

[0023] 1. Prepare and use definitive endoderm stage medium I, and culture 1.3×10⁶ - 1.5×10⁶ rhesus monkey pluripotent stem cells in a 37°C, 5% carbon dioxide incubator for one day.

[0024] 2. Prepare definitive endoderm stage medium II, replace the cells cultured in step 1 above with definitive endoderm stage medium II, and culture in a 37°C, 5% carbon dioxide incubator for three days, changing the medium every day.

[0025] The composition of the definitive endoderm stage medium I is as follows: Using MCDB131 medium (Life Technologies, Cat#10372019) and B27 (Gibco, Cat#12587-010) mixed at a ratio of 100:1 as the basal medium, and further including the following components at working concentrations: 1% Glutamax (Invitrogen, Cat#C11965500CP), 1% penicillin-streptomycin (Gibco, Cat#15140163), 4.5 mM glucose (Sigma, Cat#G7528), 100 ng / ml Activin A (Peprotech, Cat#120-14), 0.25 mM PVc, 3 μM Chir99021 (SelleckChem, Cat#S1263), 50 mM PI103 (SelleckChem, Cat#S1038), 10 μM Y27632 (SelleckChem, Cat#S1049), and the concentrations are all the final working concentrations.

[0026] The composition of the definitive endoderm stage medium II is as follows: MCDB131 medium (Life Technologies, Cat#10372019) and B27 (Gibco, Cat#12587-010) are mixed at a ratio of 100:1 as the basal medium, and it also includes the following components at working concentrations: 1% Glutamax (Invitrogen, Cat#C11965500CP), 1% penicillin-streptomycin (Gibco, Cat#15140163), 4.5 mM Glucose (Sigma, Cat#G7528), 100 ng / ml Activin A (Peprotech, Cat#120-14), 0.25 mM PVc, and the concentrations are all the final working concentrations.

[0027] More preferably, in S2, the definitive endoderm cells are induced to differentiate into pancreatic lineages according to the following specific steps:

[0028] 3. Prepare pancreatic lineage specification medium I, replace the cells obtained in step S1 with pancreatic lineage specification medium I, and culture them in an incubator at 37°C and 5% carbon dioxide for one day.

[0029] 4. Prepare pancreatic lineage specification medium II, replace the cells cultured in step 1 above with pancreatic lineage specification medium II, and culture them in an incubator at 37°C and 5% carbon dioxide for one day.

[0030] 5. Prepare pancreatic lineage specification medium III, replace the cells cultured in step 2 above with pancreatic lineage specification medium III, and culture them in an incubator at 37°C and 5% carbon dioxide for four days. Replace the medium every day.

[0031] The composition of the pancreatic lineage specification medium I is as follows: MCDB131 (Life Technologies, Cat#10372019) is used as the basal medium, and it also includes the following components at working concentrations: 1% penicillin-streptomycin (Gibco, Cat#15140163), 1% Glutamax (Invitrogen, Cat#C11965500CP), 0.5% BSA (Sigma, Cat#A4612), 4.5 mM Glucose (Sigma, Cat#G7528), 0.25 mM PVc, 10 μM SB431542 (SelleckChem, Cat#S1067), 100 nM WntC59 (SelleckChem, Cat#S7037), and a Hippo-YAP pathway regulator, and the concentrations are all the final working concentrations.

[0032] The composition of the pancreatic lineage specification medium II is as follows: Based on MCDB131 (Life Technologies, Cat#10372019), it also includes the following components at working concentrations: 1% penicillin-streptomycin (Gibco, Cat#15140163), 1% Glutamax (Invitrogen, Cat#C11965500CP), 0.5% BSA, 4.5 mM Glucose (Sigma, Cat#G7528), 0.25 mM PVc, 10 μM SB431542 (Selleck, Cat#S1067), 100 nM WntC59 (Selleck, Cat#S7037), 50 ng / ml FGF2 (Ongene; Cat#TP750002), and a Hippo-YAP pathway regulator. The concentrations are all the final working concentrations.

[0033] The composition of the pancreatic lineage specification medium III is as follows: A mixture of high-glucose DMEM (Gibco, Cat#C11965500CP) and B27 (Gibco, Cat#12587-010) at a ratio of 100:1 is used as the basal medium, and it also includes the following components at working concentrations: 0.1 μM LDN (SelleckChem, Cat#S7507), 4 μM RA (Sigma, Cat#R2625), 0.25 μM Sant-1 (SelleckChem, Cat#S7092), 1% penicillin-streptomycin (Gibco, Cat#15140163), 100 nM WntC59 (SelleckChem, Cat#S7037). The concentrations are all the final working concentrations.

[0034] More preferably, in S3, the pancreatic lineage cells are induced to further differentiate into pancreatic progenitor cells according to the following specific steps:

[0035] Prepare the pancreatic progenitor cell medium, replace the cells obtained in S2 with the pancreatic progenitor cell medium, and culture them in an incubator at 37°C and 5% carbon dioxide for seven days, changing the medium every day.

[0036] The composition of the pancreatic precursor cell culture medium is as follows: a high-glucose DMEM (Gibco, Cat#C11965500CP) culture medium and B27 (Gibco, Cat#12587-010) culture medium are mixed in a ratio of 100:1 as a basic culture medium, and also include the following working concentration components: 1% double antibody (Gibco, Cat#15140163), 1% Glutamax (Invitrogen, Cat#C11965500CP), 20mM NAM (STEMCELL, Cat#SC-07154), 0.25mM PVc, 100ng / ml EGF (Peprotech, Cat#AF-100-15), 0.2μM TPB (Santacruz, Cat#SC-204424), 0.25μM Sant-1 (SelleckChem, Cat#S7092), and the concentrations are all final working concentrations.

[0037] By implementing the above technical solution, the present invention has the following advantages:

[0038] The present invention is the first to add S1P or LPA or S1P+LPA during the in vitro induction of rhesus monkey induced pluripotent stem cells to differentiate into pancreatic precursor cells. In vitro flow cytometer detection experiments, cell immunofluorescence experiments, QPCR and other experiments have shown that after adding S1P or LPA or S1P+LPA, the intercellular adhesion phenomenon is significantly reduced and cell survival is significantly improved from a morphological point of view. At the same time, flow cytometry shows that a considerable proportion of pancreatic precursor cells expressing key transcription factors PDX1 and NKX6.1 are obtained, and the induction efficiency reaches 86%. This method can efficiently obtain pancreatic precursor cells from non-human primate rhesus monkeys in vitro, providing a material source for further obtaining functional pancreatic islet β cells from non-human primate rhesus monkeys, and providing a realistic basis for realizing autologous transplantation treatment of non-human primate diabetic animal models. BRIEF DESCRIPTION OF THE DRAWINGS

[0039] Figure 1 It is the change in efficiency of final differentiation of cells into pancreatic progenitor cells analyzed by flow cytometry after treatment with S1P or LPA or S1P+LPA in different concentration gradients in the embodiments of the present invention.

[0040] Figure 2-1 and Figure 2-2 They are schematic diagrams of experimental results of the effects of S1P+LPA treatment on cell morphology in the embodiments of the present invention. The scale bars are 20 μm and 50 μm.

[0041] Figure 3It is a schematic diagram of the experimental results of analyzing the mRNA expression changes of the pancreatic progenitor cell marker genes PDX1, NKX6.1, SOX9, and Prox1 by fluorescence quantitative PCR after treatment with S1P+LPA in the embodiments of the present invention.

[0042] Figure 4 It is a schematic diagram of the results of immunofluorescence staining analysis of the protein expressions of the pancreatic progenitor cell marker genes PDX1, NKX6.1, and SOX9 after treatment with S1P+LPA in the embodiments of the present invention. The scale bar is 50 μm.

[0043] Figure 5 It is a schematic diagram of the results of flow cytometry analysis of the differentiation efficiency of induced pancreatic progenitor cells after treatment with S1P+LPA in the embodiments of the present invention.

[0044] In all the above experimental results, the control group is the control group without adding the Hippo-YAP pathway regulator S1P or LPA or S1P+LPA; the experimental group is the positive group with the addition of the Hippo-YAP pathway regulator S1P or LPA or S1P+LPA. Detailed implementation manners

[0045] The experimental methods involved in the present invention will be further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0046] 1. Culture method of induced pluripotent stem cells derived from rhesus monkeys

[0047] The pluripotent stem cells of rhesus monkeys were cultured on a culture plate coated with MEF feeder cells. The composition of the monkey IPS medium used was as follows: based on KO-DMEM (Gibco, Cat#10829018), it also included the following components at working concentrations: 5% KnockOut Serum Replacement (Gibco, Cat#10828028), 1% Glutamax (Invitrogen, Cat#C11965500CP), 1% NEAA (Gibco, Cat#11140050), 1% penicillin-streptomycin (Gibco, Cat#15140163), 1% β-mercaptoethanol (amresco, Cat#M131), 100 ng / ml bFGF (amsbio, Cat#SFB-504-CT). The culture conditions were a 37°C, 5% carbon dioxide incubator. When the cell confluence was cultured to about 85%, subculture could be carried out. That is, ① Wash the cells once with PBS (Invitrogen, Cat#14190), add 1 ml of dispase (Roche, Cat#Rs-04942078001) at 1 U / ml, and place it in the incubator for digestion for 10 min. ② Wash the newly prepared feeder cells once with PBS (Invitrogen, Cat#14190), then add 2 ml of monkey IPS medium (+Y27632 10 μM) and place it in the incubator for standby. ③ Observe the cell digestion under the microscope. If more than 80% of the clones are rolled up and detached, pick up all the clones. ④ After digestion, add 1 ml of monkey IPS medium (+Y27632 10 μM) to each well of the digested cells, mix and dilute, and wash the original well once. ⑤ Collect the cells and transfer them to a 15 ml centrifuge tube, add 1 ml of medium to wash the original well and transfer it to the 15 ml centrifuge tube together. ⑥ Let it sediment naturally for about 5 min, sediment the large clones to the bottom, and discard the supernatant. ⑦ Add 2 ml of medium and gently pipette several times, then let it sediment naturally for 5 min again, and discard the supernatant. ⑧ Inoculate at a ratio of 1:6 to 1:10 into the newly prepared feeder cells, mix well and place it in the incubator for culture.

[0048] 2. Seeding method for the initial differentiation of induced pluripotent stem cells derived from rhesus monkeys

[0049] Add 4 - 5 ml of accutase (Sigma, A46964 - 100ML) to the excess cell clumps obtained by the subculture method in Step 1 above, digest at 37°C for 3 min until single - cell state, centrifuge at 300 g for 3 min, discard the supernatant and resuspend and count with mTeSR2 (StemCell Technologies, Cat#05860) medium (+Y27632 10 μM). Seed at 1.2×10⁶ cells per well into a six - well plate coated with Matrigel (BD systems, Cat#354230). After culturing for 24 hours, change the medium and remove Y27632 (SelleckChem, Cat#S1049) to initiate differentiation.

[0050] 3. Flow cytometry detection method

[0051] Digest the cells after induced differentiation into single - cell state with accutase (Sigma, A46964 - 100ML), add fixation and permeabilization solution (Fixation and Permeabilization Solution, BD; Cat#554722) and fix overnight. The next day, wash the cells once with the corresponding Wash Buffer (BD Perm / WashTM Buffer, Cat#554723), and then add the corresponding primary antibody according to the detection requirements and incubate overnight. The primary antibodies used in this invention are as follows: mouse anti - NKX6.1 (DSHB, Cat#F55A12), goat anti - PDX1 (RD system, Cat#AF2419). After the primary antibody incubation, wash the cells once with Wash Buffer (BD Perm / WashTM Buffer, Cat#554723), add the corresponding fluorescent secondary antibody and incubate for 2 h. The secondary antibodies used in this invention are as follows: goat anti - mouse secondary Antibody, Alexa Fluor 488 conjugate (Life Technology, Cat#A - 21121); donkey anti - mouse secondary Antibody, Alexa Fluor 647 conjugate (Life Technology, Cat#A - 31571). After the secondary antibody incubation, wash the cells once with Wash Buffer (BD Perm / WashTM Buffer, Cat#554723) and transfer the cells to a flow cytometry tube. Detect with a flow cytometer (BD Calibur) and analyze the flow cytometry results with FlowJo software.

[0052] 4. Cell immunofluorescence assay method

[0053] The cells were terminated from culture. ① Wash the cells once with PBS (Invitrogen, Cat#14190), and fix them with 4% paraformaldehyde (Biosharp, Cat#BL539A) for 14 - 45 min. ② After fixation, wash the cells 3 times with PBS (Invitrogen, Cat#14190), and add the blocking solution to block at 37°C for 1 h. Blocking solution: PBST (PBS + 0.1% - 0.5% TritonX - 100) + 2% - 3% donkey serum (Jackson Immuno, Cat#017 - 000 - 121). ③ Primary antibody incubation: Dilute the corresponding primary antibody with the blocking solution and incubate overnight at 4°C. The specific primary antibodies used in this invention for immunofluorescence are as follows: mouse anti - NKX6.1 (DSHB, Cat#F55A12), goat anti - PDX1 (RD system, Cat#AF2419), rabbit anti - SOX9 (abcam, Cat#ab185230). ④ After the primary antibody incubation, wash the cells 3 times with PBS (Invitrogen, Cat#14190), and then replace it with the corresponding secondary antibody and incubate in the dark at room temperature for 1 h. Secondary antibody preparation: PBS (Invitrogen, Cat#14190) + 2% - 3% donkey serum (Jackson Immuno, Cat#017 - 000 - 121) + secondary antibody. The specific secondary antibodies used in this invention for immunofluorescence are as follows: goat anti - mouse secondary Antibody, Alexa Fluor 488 conjugate (Life Technology, Cat#A - 21121); donkey anti - mouse secondary Antibody, Alexa Fluor 647 conjugate (Life Technology, Cat#A - 31571); donkey anti - rabbit secondary Antibody, Alexa Fluor 546 (Thermo, Cat#A10040). ⑤ After the secondary antibody incubation, replace it with DAPI (Invitrogen, Cat#D3571) and stain for 2 - 3 min. After washing 3 times with PBS (Invitrogen, Cat#14190), the cells can be observed under a fluorescence microscope.

[0054] 5. Real - time fluorescence quantitative PCR assay method

[0055] All the Q-PCR operation procedures involved in the present invention are from the steps in the kit instruction manual. The extraction of cellular RNA is fully carried out according to the operation steps in the instruction manual of Dtrect-zol RNA Miniprep ZTMO RESEARCH 200 preps kit (Jianshi Biology, Cat#TR205-200); the reverse transcription of RNA is fully carried out according to the operation steps in the instruction manual of Transcript One-Step GDNAremovaland cDNA synthesis supermix (TransGen Biotech, Cat#AT311-03) kit; the real-time quantitative PCR steps are fully carried out according to the operation steps in the instruction manual of KAPA SYBR FAST Universal qPCR Kit (KAPA biosystems, Cat#KK4601). Detection is performed on a real-time quantitative PCR instrument (ABI, 7500). Data analysis uses the ΔΔCt method and is normalized to undifferentiated embryonic stem cells. The primer sequences involved in the present invention are specifically as follows:

[0056] The primers for detecting the gene PDX1 are: Sense: AAAGCTCACGCGTGGAAAG; Anti: CGGCCGTGAGATGTACTTGTT;

[0057] The primers for detecting the gene NKX6.1 are: Sense: GTTGGGGATGACGGAGAGTC; Anti: TCTTCATCGTTCTCCGAGGC;

[0058] The primers for detecting the gene Prox1 are: Sense: ACATGCACTACAATAAAGCAAATGA; Anti: CTGCGATAATGGCATTGAA;

[0059] The primers for detecting the gene PDX1 are: Sense: AAAGCTCACGCGTGGAAAG; Anti: CGGCCGTGAGATGTACTTGTT;

[0060] The primers for detecting the gene SOX9 are: Sense: CTCCGGCATGAGCGAGG; Anti: TCTCGCTTCAGGTCAGCCTTG;

[0061] The primers for the internal reference gene GAPDH are: Sense: AATCCCATCACCATCTTCCAGGAG; Anti: CACCCTGTTGCTGTAGCCAAATTC;

[0062] The above has made a detailed description of the specific embodiments of the present invention. However, the present invention is not completely limited to the above embodiments, and various changes can be made without departing from the concept of the present invention within the scope of knowledge possessed by those skilled in the art.

Claims

1. Use of a Hippo-YAP pathway regulator in promoting the directed differentiation of induced pluripotent stem cells into pancreatic progenitor cells, wherein the Hippo-YAP pathway regulator is S1P + LPA.

2. The application according to claim 1, wherein The final working concentration of S1P is 0.25 μM - 2 μM, and the final working concentration of LPA is 5 μM - 20 μM.

3. Use of a Hippo-YAP pathway regulator in promoting the directed differentiation of induced pluripotent stem cells of non-human primates into pancreatic progenitor cells, wherein the Hippo-YAP pathway regulator is S1P + LPA.

4. The application according to claim 3, wherein The non-human primate is a rhesus monkey.

5. A culture medium for promoting the directed differentiation of induced pluripotent stem cells of non-human primates into pancreatic progenitor cells, characterized in that, Comprising the following parts: Medium I for the stage of inducing pluripotent stem cells to differentiate into definitive endoderm cells: MCDB131 medium and B27 are mixed at a ratio of 100:1 as the basal medium, 1% Glutamax, 1% penicillin-streptomycin, 4.5 mM glucose, 100 ng / ml Activin A, 0.25 mM PVc, 3 μM Chir99021, 50 mM PI103, 10 μM Y27632; Medium II for the stage of inducing pluripotent stem cells to differentiate into definitive endoderm: MCDB131 medium and B27 are mixed at a ratio of 100:1 as the basal medium, 1% Glutamax, 1% penicillin-streptomycin, 4.5 mM glucose, 100 ng / ml Activin A, 0.25 mM PVc; Medium I for inducing definitive endoderm cells to specialize into the pancreatic lineage: MCDB131 (Life Technologies, Cat#10372019) as the basal medium, 1% penicillin-streptomycin, 1% Glutamax, 0.5% BSA, 4.5 mM glucose, 0.25 mM PVc, 10 μM SB431542, 100 nM WntC59, S1P and LPA; Medium II for inducing definitive endoderm cells to specialize into the pancreatic lineage: MCDB131 as the basal medium, 1% penicillin-streptomycin, 1% Glutamax, 0.5% BSA, 4.5 mM glucose, 0.25 mM PVc, 10 μM SB431542, 100 nM WntC59, 50 ng / ml FGF2, S1P and LPA; Medium III for inducing definitive endoderm cells to specialize into the pancreatic lineage: high-glucose DMEM and B27 are mixed at a ratio of 100:1 as the basal medium, 0.1 μM LDN, 4 μM RA, 0.25 μM Sant-1, 1% penicillin-streptomycin, 100 nM WntC59; The composition of the medium for differentiating pancreatic lineage cells into pancreatic progenitor cells is as follows: high-glucose DMEM medium and B27 are mixed at a ratio of 100:1 as the basal medium, 1% double antibody, 1% Glutamax, 20 mM NAM, 0.25 mM PVc, 100 ng / ml EGF, 0.2 μM TPB, and 0.25 μM Sant-1.

6. A method for promoting the directed differentiation of induced pluripotent stem cells of non-human primates into pancreatic progenitor cells, characterized in that, It includes the following steps: S1. Inducing pluripotent stem cells to differentiate into definitive endoderm cells; S2. Inducing the definitive endoderm cells to specialize into pancreatic lineages, and adding Hippo-YAP pathway regulators during the induction process; S3. Further differentiating the pancreatic lineage cells into pancreatic progenitor cells; The Hippo-YAP pathway regulator described above is S1P + LPA; In S1, the specific steps for inducing pluripotent stem cells to differentiate into definitive endoderm cells are as follows: S11. Prepare and use definitive endoderm stage medium I, and culture 1.3×10^5 - 1.5×10^5 rhesus monkey pluripotent stem cells in a carbon dioxide incubator for one day; S12. Prepare definitive endoderm stage medium II, replace the cells cultured in the above step S11 with definitive endoderm stage medium II, and culture them in a carbon dioxide incubator for three days, changing the medium every day; Definitive endoderm stage medium I for inducing pluripotent stem cells to differentiate: MCDB131 medium and B27 are mixed at a ratio of 100:1 as the basal medium, 1% Glutamax, 1% double antibody, 4.5 mM Glucose, 100 ng / ml Activin A, 0.25 mM PVc, 3 μM Chir99021, 50 mM PI103, 10 μM Y27632; Definitive endoderm stage medium II for inducing pluripotent stem cells to differentiate: MCDB131 medium and B27 are mixed at a ratio of 100:1 as the basal medium, 1% Glutamax, 1% double antibody, 4.5 mM Glucose, 100 ng / ml Activin A, 0.25 mM PVc; In S2, the specific steps for inducing the definitive endoderm cells to specialize into pancreatic lineages are as follows: S21. Prepare pancreatic lineage specialization medium I, replace the cells obtained from the culture in step S1 with pancreatic lineage specialization medium I, and culture them in a carbon dioxide incubator for one day; S22. Prepare pancreatic lineage specialization medium II, replace the cells cultured in the above step 1 with pancreatic lineage specialization medium II, and culture them in a carbon dioxide incubator for one day; S23. Prepare pancreatic lineage specialization medium III, replace the cells cultured in the above step 2 with pancreatic lineage specialization medium III, and culture them in a carbon dioxide incubator for four days, changing the medium every day; Medium for inducing definitive endoderm cells to differentiate into pancreatic lineage - Medium I: Based on MCDB131 (Life Technologies, Cat#10372019), supplemented with 1% penicillin - streptomycin, 1% Glutamax, 0.5% BSA, 4.5 mM glucose, 0.25 mM PVc, 10 μM SB431542, 100 nM WntC59, S1P, and LPA; Medium for inducing definitive endoderm cells to differentiate into pancreatic lineage - Medium II: Based on MCDB131, supplemented with 1% penicillin - streptomycin, 1% Glutamax, 0.5% BSA, 4.5 mM glucose, 0.25 mM PVc, 10 μM SB431542, 100 nM WntC59, 50 ng / ml FGF2, S1P, and LPA; Medium for inducing definitive endoderm cells to differentiate into pancreatic lineage - Medium III: A mixture of high - glucose DMEM and B27 at a ratio of 100:1 as the basal medium, 0.1 μM LDN, 4 μM RA, 0.25 μM Sant - 1, 1% penicillin - streptomycin, 100 nM WntC59; In S3, the following specific steps are used to induce the further differentiation of pancreatic lineage cells into pancreatic progenitor cells: Prepare the pancreatic progenitor cell medium, replace the cells obtained in S2 with the pancreatic progenitor cell medium, and culture them in a carbon dioxide incubator for seven days, changing the medium daily; The composition of the medium for differentiating pancreatic lineage cells into pancreatic progenitor cells is: A mixture of high - glucose DMEM medium and B27 at a ratio of 100:1 as the basal medium, 1% penicillin - streptomycin, 1% Glutamax, 20 mM NAM, 0.25 mM PVc, 100 ng / ml EGF, 0.2 μM TPB, 0.25 μM Sant - 1.

Images