Arabidopsis thaliana LncRNA44 and its application

By cloning Arabidopsis LncRNA44 and overexpressing it in Arabidopsis, the negative impact of high temperature stress on plant growth was resolved, the high temperature resistance of Arabidopsis seeds was improved, and genetic support was provided for improving the high temperature resistance of crops.

CN116200386BActive Publication Date: 2025-09-26SHANDONG AGRICULTURAL UNIVERSITY
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310067266.7
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-02-06
Publication Date
2025-09-26
Estimated Expiration
2043-02-06

AI Technical Summary

Technical Problem

High temperature stress has a serious impact on plant growth, development and yield, and existing technologies are difficult to effectively improve plant resistance to high temperatures.

Method used

By cloning the nucleotide sequence of Arabidopsis LncRNA44 and inserting it into a recombinant vector, Arabidopsis was transformed using Agrobacterium infection to increase the expression level of LncRNA44 in Arabidopsis, thereby enhancing its high temperature resistance.

Benefits of technology

It significantly improved the high temperature resistance of transgenic Arabidopsis seeds during germination, provided a theoretical basis and gene source for breeding new varieties of high temperature-resistant crops, and improved the high temperature resistance of economic crops.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116200386B_ABST
    Figure CN116200386B_ABST
Patent Text Reader

Abstract

The present invention discloses an Arabidopsis thaliana LncRNA44 and its applications. The nucleotide sequence of LncRNA44 is shown in SEQ ID No. 1. It was cloned from Arabidopsis thaliana and has been verified to regulate the plant's resistance to high temperatures during the germination period. By increasing the expression level of LncRNA44 in the plant, transgenic Arabidopsis thaliana with greater heat resistance than wild-type plants can be obtained. The LncRNA44 described in the present invention can provide a theoretical basis and gene source for the development of new crop varieties.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention belongs to the fields of molecular biology and genetic engineering, and particularly relates to Arabidopsis thaliana LncRNA44 and applications thereof. Background Art

[0002] Global warming has led to climate change, including extreme high temperatures, and heat stress has become an increasingly serious food security concern. Heat stress can affect plants at any stage of growth, but some stages are more sensitive to heat than others. Heat stress can have a strong negative impact during the heat-sensitive developmental stages of early plant establishment, flowering, and gametophyte development, and in crops, this effect is particularly detrimental.

[0003] High temperatures exceeding a critical threshold can cause heat stress, impairing or even completely halting leaf photosynthesis, impacting plant growth, development, and yield. High temperatures degrade the D1 protein, the reaction center binding protein of photosystem II, thereby inhibiting or even inactivating PSII. High temperatures also disrupt the structure of chloroplasts, degrade chlorophyll, reduce CO2 solubility, decrease the affinity of ribulose-1,5-bisphosphate carboxylase for CO2, and reduce the thermal stability of key components of the photosynthetic system, all of which affect the plant's photosynthetic rate.

[0004] High temperature stress directly affects plant respiration by affecting the activity of respiratory enzymes. High temperatures can inactivate and irreversibly inactivate enzymes involved in respiration. They can also increase biosynthesis, transport, and protein turnover, leading to increased energy demand. Respiration can also degrade and eliminate harmful substances in plants exposed to high temperatures, closely related to heat resistance and mitigating the harmful effects of high temperature stress.

[0005] High temperature stress can alter the composition of membrane lipids in cells, leading to protein denaturation. It can also disrupt the structural integrity of endoplasmic reticulum, Golgi apparatus, and mitochondria, altering the types and modes of action of ion carriers on the membranes, ultimately leading to a loss of membrane selective absorption, electrolyte leakage, and increased relative conductivity. High temperatures can also cause peroxidation of membrane lipids. Various reactive oxygen species (singlet oxygen, peroxide radicals, superoxide radicals, and hydroxyl radicals) produced by plants at high temperatures peroxidize unsaturated fatty acids in membrane lipids into the highly reactive lipid peroxide malondialdehyde (MDA). The resulting MDA can cross-link nucleic acids, lipids, proteins, and carbohydrates, and undergo chain polymerization reactions with enzyme proteins, inactivating enzymes and thus damaging the plant, affecting its normal growth.

[0006] In addition, plants can undergo many physiological and biochemical changes under high temperature stress, including accumulation of reactive oxygen species (ROS), ion leakage, lipid peroxidation, protein denaturation and aggregation, redox imbalance, oxidative stress, and cell structure damage.

[0007] Long noncoding RNA (lncRNA) refers to a class of RNAs longer than 200 base pairs that do not have protein-coding functions. lncRNAs are expressed both spatially and temporally. Classification of lncRNAs depends primarily on their location relative to mRNA, including intronic lncRNAs, enhancer lncRNAs, intergenic lncRNAs, transcriptional pseudogene lncRNAs, and antisense lncRNAs. Studies have shown that lncRNAs have biological functions.

[0008] Across diverse plant species, lncRNAs have been found to be associated with numerous plant developmental functions, such as lateral root development, vernalization, photomorphogenesis, pollen development, plant fertility, fiber development, and nodule formation. Furthermore, lncRNAs regulate plant development through four potential mechanisms: alterations in histone and chromatin modifications, transcriptional regulation, miRNA target mimicry, and post-translational changes. Research on the biological functions and mechanisms of RNA action has primarily focused on model plants, with limited research in crops other than rice. Summary of the Invention

[0009] The present invention provides an Arabidopsis thaliana LncRNA44 and an application thereof, and experimental verification shows that the LncRNA44 has the effect of improving the high temperature resistance of Arabidopsis thaliana.

[0010] In order to achieve the above-mentioned purpose, the present invention adopts the following technical solutions:

[0011] The present invention provides an Arabidopsis thaliana LncRNA44, the nucleotide sequence of the LncRNA44 is shown as SEQ ID No.1.

[0012] The present invention also provides a recombinant vector, which comprises an original vector and the Arabidopsis thaliana LncRNA44; the original vector is a PBI121 expression vector.

[0013] The present invention also provides a recombinant strain, which contains the Arabidopsis thaliana LncRNA44; the recombinant strain is Agrobacterium GV3101.

[0014] The present invention also provides a primer pair, which consists of:

[0015] Forward primer: Forward primer: 5′-acgggggactctagaggatccACGCTCCACATGTATCTTCACTGG-3′;

[0016] Reverse primer: 5′-cgatcggggaaattcgagctcTCTGTTTTGACATTACAATTTTTATTTCC-3′.

[0017] The present invention also provides a method for amplifying the Arabidopsis LncRNA44, comprising the following steps: extracting genomic DNA of Arabidopsis, using it as a template, and using a forward primer: 5'-acgggggactctagaggatccACGCTCCACATGTATCTTCACTGG-3'; a reverse primer: 5'-cgatcggggaaattcgagctcTCTGTTTTGACATTACAATTTTTATTTCC-3' as primers to amplify the Arabidopsis LncRNA44 by a PCR method.

[0018] The present invention also provides a kit comprising the primer pair for amplifying and / or detecting the Arabidopsis thaliana LncRNA44 having a nucleotide sequence as shown in SEQ ID No. 1.

[0019] The present invention also provides the use of the Arabidopsis thaliana LncRNA44, or the recombinant vector, or the recombinant strain in improving plant high temperature tolerance.

[0020] Furthermore, by increasing the expression level of the Arabidopsis thaliana LncRNA44 in the plant, the high temperature resistance of the plant seed germination is improved.

[0021] The present invention also provides the use of the Arabidopsis thaliana LncRNA44, or the recombinant vector, or the recombinant strain in regulating plant growth.

[0022] The present invention also provides the use of the Arabidopsis thaliana LncRNA44, or the recombinant vector, or the recombinant strain in screening and / or cultivating high-temperature resistant plants.

[0023] Furthermore, the plant is Arabidopsis thaliana.

[0024] Compared with the prior art, the present invention has the following advantages and beneficial effects:

[0025] The present invention extracts the Arabidopsis genome using the CTAB method. Using Arabidopsis DNA as a template, PCR amplification is performed using specific primers. The PCR product is recovered, purified, and sequenced to obtain the LncRNA44 gene. This gene is then linked to an expression vector and transformed into Arabidopsis using Agrobacterium infection. Experimental results confirm that LncRNA44 significantly improves the high-temperature resistance of transgenic Arabidopsis seeds during germination. The LncRNA described in this invention can provide a theoretical basis and gene source for the development of new crop varieties, helping to fundamentally improve the heat resistance of commercial crops. BRIEF DESCRIPTION OF THE DRAWINGS

[0026] Figure 1 This is the secondary structure of LncRNA44.

[0027] Figure 2 This is the seed germination status of wild-type Arabidopsis, transgenic Arabidopsis and mutant Arabidopsis after treatment; among them, Col-0 represents wild-type Arabidopsis, OE3 and OE4 represent transgenic Arabidopsis, and lnc44 represents mutant Arabidopsis. DETAILED DESCRIPTION

[0028] The technical solution of the present invention is further described below in conjunction with the embodiments, but the scope of protection of the present invention is not limited thereto. Without departing from the spirit and essence of the present invention, modifications or replacements made to the method, steps or conditions of the present invention are within the scope of the present invention.

[0029] Unless otherwise specified, the experimental materials, reagents, and instruments used in the examples of the present invention are all commercially available. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art.

[0030] Example 1: Cloning of Arabidopsis LncRNA44

[0031] 1. Extract the Arabidopsis genome.

[0032] 2. PCR amplification of the LncRNA44 gene: Using the extracted Arabidopsis genomic DNA as a template, primers were designed according to the LncRNA44 gene sequence for PCR amplification. The PCR amplification product was recovered and purified, and sequenced.

[0033] The primers used were:

[0034] Forward primer: 5′-acgggggactctagaggatccACGCTCCACATGTATCTTCACTGG-3′ (SEQ ID No. 2);

[0035] Reverse primer: 5′-cgatcggggaaattcgagctcTCTGTTTTGACATTACAATTTTTATTTCC-3′ (SEQ ID No. 3).

[0036] 3. PCR reaction system and amplification conditions are as follows:

[0037]

[0038] 4. The purified PCR amplification product was sent to Sangon Biotech for sequencing, and the nucleotide sequence of Arabidopsis thaliana LncRNA44 was obtained as shown in SEQ ID No. 1. Arabidopsis thaliana LncRNA44 is located on chromosome 5, with a gene length of about 1300 bp and a secondary structure mainly composed of three large stem-loop structures ( Figure 1 ).

[0039] The specific operations for recovering and purifying PCR amplification products are as follows: After gel electrophoresis, use a clean blade to cut out the gel containing the target fragment (about 1300bp) and place it into a centrifuge tube. Do not cut the gel too large to avoid the DNA fragment solution containing a large amount of impurities during recovery. After adding an equal volume of XP2 (Binding Buffer) solution (volume / gel mass) to the centrifuge tube, incubate at 55°C for 10 minutes until the gel is completely melted; transfer the solution in the centrifuge tube to a 2ml adsorption column, centrifuge for 1 minute, and discard the liquid phase; add 0.5ml of XP2 solution to the adsorption column again, centrifuge for 1 minute, and discard the liquid phase; add 0.70ml of SPW Wash Buffer solution to the adsorption column, centrifuge for 1 minute, and discard the liquid phase; add 0.70ml of SPW Wash Buffer solution again, centrifuge for 1 minute, and discard the liquid phase; after centrifugation for 1 minute again, place the adsorption column on a new centrifuge tube, let it stand for 10 minutes, add 30μl of dissolving solution, let it stand for 1 minute, and finally centrifuge for 1 minute. The resulting liquid phase is the recovered DNA solution.

[0040] Example 2: Construction of recombinant expression vector and preparation of transgenic plants

[0041] 1. Construction of recombinant expression vector

[0042] The LncRNA44 gene cloned in Example 1 was ligated into the dicotyledonous plant binary expression vector PBI121 through homologous recombination. The reaction product was transformed into Escherichia coli, plated, positive clones were screened, and plasmids were extracted to obtain the recombinant plasmid PBI121-LncRNA44.

[0043] The lnc44 mutant silences LncRNA44 using artificial microRNAs. The microRNA sequence is TAATTCGTTTATCATCCGCCG (SEQ ID No. 4), and the microRNA* sequence is CGACGGATGATAATCGAATTT (SEQ ID No. 5). The expression vector to which they are connected is PBI121. Gene synthesis and expression vector construction were completed by Shanghai Sangon Biotechnology Co., Ltd.

[0044] 2. Agrobacterium transformation

[0045] Thaw competent Agrobacterium GV3101 cells on ice; add 2 μL of the recombinant plasmids PBI121-LncRNA44 and PBI121-lnc44, incubate on ice for 30 minutes, freeze in liquid nitrogen for 1 minute, and then incubate at 37°C in a water bath for 5 minutes. Add 950 μL of antibiotic-free YEP medium and shake at 28°C at 220 rpm for 4 hours. Concentrate the culture by centrifugation at 10,000 rpm for 1 minute, and resolubilize the cells with 100 μL of YEP. Spread the resolubilized cells onto solid YEP medium supplemented with 50 mg / L kanamycin and 100 mg / L rifampicin and incubate at 28°C for 36–48 hours. PCR analysis of the culture fluid identified positive clones to obtain the recombinant strains GV3101-LncRNA44 and GV3101-lnc44.

[0046] 3. Cultivation of transgenic plants

[0047] Single colonies of the recombinant strains GV3101-LncRNA44 and GV3101-lnc44 were picked respectively, added to 6 mL of LB (Kan) medium, and cultured overnight; centrifuged at 6000 rpm for 5 minutes at room temperature to collect the bacteria; suspended the bacteria in 8-10 mL of infection solution (5% sucrose, 0.03-0.05% silwetL) and mixed evenly; immersed the inflorescence of Arabidopsis thaliana in the infection solution and infected for 10-15 seconds, then took out the Arabidopsis thaliana and placed it in a dark box, covered it with a film, and cultured in the dark for 12 hours; took out the Arabidopsis thaliana and cultured normally under long daylight, infected once every 5-7 days, and generally infected 3-4 times; harvested the mature Arabidopsis thaliana seeds after infection, dried and stored.

[0048] 4. Transgenic plant screening

[0049] Arabidopsis seeds were selected and sterilized with 70% ethanol for 5 minutes, then with 2.6% NaClO for 10 minutes, and rinsed with sterile water 3 to 5 times to remove residual NaClO solution. The sterilized Arabidopsis seeds were spread onto 1 / 2MS culture medium containing 50 mg / L Kan and treated in the dark at 4°C for 2 days. After stratification, the culture dishes were placed in a light incubator at 22°C and grown for about 7 days. Arabidopsis seedlings with green cotyledons were selected and transferred to the culture medium for culture. After three weeks, leaves were selected from each plant, genomic DNA was extracted, and identification was performed to finally obtain LncRNA44 overexpressing plants and lnc44 mutant plants.

[0050] Example 3: Comparison of growth characteristics of wild-type, LncRNA44 overexpressing strains and mutants after high temperature treatment.

[0051] The two LncRNA44 overexpression lines obtained in Example 2 were named OE3 and OE4, and the mutant was named lnc44. The wild type, overexpression line and mutant were cultured at 4°C for 3 days and then placed in 22°C. The results are shown in Figure 2 A, The growth of several plants is the same, indicating that the increase or knockout of LncRNA44 gene expression does not affect the normal growth and development of plants. The wild type, overexpression lines and mutants were stratified at 4℃ for 3 days, then placed in a high temperature culture at 45℃ for 20 hours, and then placed in a culture at 22℃. The results are shown in Figure 2 B. The germination rate of wild-type seeds was lower than that of the overexpressing strain, while the germination rate of the mutant was even lower than that of the wild-type. These results indicate that the LncRNA44 gene is involved in plant heat resistance and that LncRNA44-overexpressing plants have stronger resistance to heat stress.

[0052] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein with equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. An Arabidopsis thaliana LncRNA44, characterized in that The nucleotide sequence of LncRNA44 is shown in SEQ ID No.

1.

2. A recombinant vector, characterized in that The recombinant vector comprises an original vector and the Arabidopsis LncRNA44 according to claim 1; the original vector is a PBI121 expression vector.

3. A recombinant strain, characterized in that The recombinant strain contains the Arabidopsis thaliana LncRNA44 according to claim 1; and the recombinant strain is Agrobacterium GV3101.

4. A primer pair, characterized in that: Its composition is: Forward primer: 5′- acgggggactctagaggatccACGCTCCACATGTATCTTCACTGG -3′; Reverse primer: 5′- cgatcggggaaattcgagctcTCTGTTTTGACATTACAATTTTTATTTCC -3′.

5. A method for amplifying Arabidopsis thaliana LncRNA44 according to claim 1, characterized in that: The following steps are involved: The Arabidopsis thaliana genomic DNA was extracted and used as a template. The forward primer: 5'-acgggggactctagaggatccACGCTCCACATGTATCTTCACTGG -3'; the reverse primer: 5'-cgatcggggaaattcgagctcTCTGTTTTGACATTACAATTTTTATTTCC -3' was used as primers to amplify the Arabidopsis thaliana LncRNA44 according to claim 1 by PCR.

6. A kit, characterized in that The kit comprises the primer pair according to claim 4, which is used to amplify and / or detect the Arabidopsis thaliana LncRNA44 whose nucleotide sequence is shown in SEQ ID No.

1.

7. Use of the Arabidopsis thaliana LncRNA44 according to claim 1, or the recombinant vector according to claim 2, or the recombinant strain according to claim 3 in improving the high temperature resistance of Arabidopsis thaliana, characterized in that: The high temperature resistance of Arabidopsis thaliana is improved by overexpressing the Arabidopsis thaliana LncRNA44 gene.

8. Use of the Arabidopsis thaliana LncRNA44 according to claim 1, or the recombinant vector according to claim 2, or the recombinant strain according to claim 3 in screening and / or cultivating heat-resistant Arabidopsis thaliana, characterized in that: The high temperature resistance of Arabidopsis thaliana is improved by overexpressing the Arabidopsis thaliana LncRNA44 gene.

Citation Information

Patent Citations

  • Arabidopsis thaliana LncRNA29 and application thereof

    CN116024218A