A kind of transgenic tomato microvesicle nanoparticles and its preparation method and application

Through genetic engineering, mouse-derived lncENAF was introduced into tomatoes to prepare transgenic tomato microvesicle nanoparticles, which solved the problem of non-coding RNA transfection in tomatoes, achieved the effect of inhibiting inflammatory cytokines, and provided a new type of anti-inflammatory drug.

CN116850155BActive Publication Date: 2025-10-03苏州华原细胞生物技术有限公司
View PDF 1 Cites 0 Cited by

Patent Information

Application Number
CN202310845592.6
Authority / Receiving Office
CN · China
Patent Type
Patents(China)
Current Assignee / Owner
Filing Date
2023-07-11
Publication Date
2025-10-03
Estimated Expiration
2043-07-11

AI Technical Summary

Technical Problem

There are no reports in the existing technology on transfecting animal-derived non-coding RNA into tomatoes, and there is a lack of methods to use long non-coding RNA lncENAF to alleviate inflammation.

Method used

Through genetic engineering methods, mouse-derived lncENAF was introduced into tomatoes to prepare transgenic tomato microvesicle nanoparticles. Transgenic tomato plants were obtained by Agrobacterium infection, and microvesicle nanoparticles containing lncENAF were extracted from the fruits.

Benefits of technology

The genetic transformation of lncENAF in plants was achieved, and the prepared microvesicle nanoparticles were able to inhibit the production of inflammatory cytokines IL-6, IL-1β and TNF-α, providing a new drug strategy to alleviate inflammation.

✦ Generated by Eureka AI based on patent content.

Smart Images

  • Figure CN116850155B_ABST
    Figure CN116850155B_ABST
Patent Text Reader

Abstract

The present invention discloses transgenic tomato microvesicle nanoparticles, a preparation method, and applications thereof, relating to the field of biotechnology. The preparation method comprises the following steps: (1) connecting a DNA molecule of lncENAF into a gene expression vector, which is then transformed into competent cells to obtain a recombinant microbial strain; (2) infecting a tomato explant with the recombinant microbial strain, followed by tissue culture and identification screening to obtain a transgenic tomato plant; (3) culturing the transgenic tomato plant to produce transgenic tomato fruit; and (4) extracting microvesicles from the transgenic tomato fruit to obtain microvesicle nanoparticles containing lncENAF. The present invention successfully achieves the genetic transformation of animal-derived lncENAF in plants. The transgenic tomato fruit prepared using the method of the present invention can be used to extract microvesicle nanoparticles containing lncENAF, which can be used to prepare drugs to relieve inflammation.
Need to check novelty before this filing date? Find Prior Art

Description

Technical Field

[0001] The present invention relates to the field of biotechnology, and in particular to transgenic tomato microvesicle nanoparticles and a preparation method and application thereof. Background Art

[0002] Long non-coding RNA (lncRNA) is a type of non-coding RNA molecule that does not encode proteins and has transcripts exceeding 200 nucleotides in length. It can regulate genes at various levels, including epigenetic regulation, transcriptional regulation, and post-transcriptional regulation. In recent years, the regulatory role of long non-coding RNA has attracted increasing attention and research.

[0003] The long noncoding RNA lncENAF has been shown to bind to heterogeneous nuclear ribonucleoprotein F (hnRNPF). lncENAF and its binding protein hnRNPF can inhibit the production of cytokines such as IL-6 in macrophages induced by lipopolysaccharide.

[0004] Currently, there are no reports on the transfection of animal-derived non-coding RNA into tomatoes. This paper attempts to genetically engineer the mouse-derived non-coding RNA lncENAF and infect it with Agrobacterium to produce a transgenic tomato. The microvesicles (containing lncENAF) in the tomato fruit are then obtained to develop new methods for alleviating or treating inflammatory diseases. Summary of the Invention

[0005] The purpose of the present invention is to provide transgenic tomato microvesicle nanoparticles and their preparation method and application to solve the problems existing in the above-mentioned prior art. The present invention successfully realizes the genetic transformation of animal-derived lncENAF in plants. The transgenic tomato microvesicle nanoparticles prepared by the method of the present invention can be used to prepare drugs for alleviating inflammation.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] The present invention provides a method for preparing transgenic tomato microvesicle nanoparticles, comprising the following steps:

[0008] (1) The lncENAF DNA molecule was connected to a gene expression vector, and then transformed into competent cells to obtain a recombinant microbial strain;

[0009] (2) using the recombinant microbial strain to infect tomato explants, followed by tissue culture and identification screening to obtain transgenic tomato plants;

[0010] (3) cultivating the transgenic tomato plants and setting fruit to obtain transgenic tomato fruits;

[0011] (4) performing microvesicle extraction on the transgenic tomato fruit to obtain microvesicle nanoparticles containing lncENAF;

[0012] In step (1), the nucleotide sequence of the lncENAF DNA molecule is shown as SEQ ID NO.1.

[0013] Furthermore, in step (1), the gene expression vector is pCAMBIA1301.

[0014] Furthermore, in step (1), the competent cells are Escherichia coli competent cells.

[0015] Furthermore, in step (2), the tomato explant is a leaf.

[0016] Furthermore, in step (4), the extraction adopts density gradient centrifugation.

[0017] The present invention also provides microvesicle nanoparticles containing lncENAF prepared according to the above preparation method.

[0018] The present invention also provides use of the above-mentioned microvesicle nanoparticles containing lncENAF in the preparation of a drug for alleviating inflammation.

[0019] Furthermore, the relief of inflammation refers to inhibiting the production of inflammatory cytokines IL-6, IL-1β and / or TNF-α.

[0020] The present invention also provides a drug for alleviating inflammation, comprising the above-mentioned microvesicle nanoparticles containing lncENAF.

[0021] Furthermore, the medicine also includes pharmaceutically acceptable excipients.

[0022] The present invention discloses the following technical effects:

[0023] In this study, mouse-derived lncENAF (SEQ ID NO. 1) was infected with Agrobacterium to produce transgenic tomato seedlings containing lncENAF. The seedlings were then cultivated to produce tomato fruits, which were then extracted from the tomato fruits to produce tomato microvesicle nanoparticles. Co-incubation of these microvesicle nanoparticles with HEK-293T cells revealed that HEK-293T cells, which originally did not express lncENAF, expressed lncEANF and alleviated the expression of inflammatory cytokines induced by LPS stimulation. The transgenic tomato microvesicle nanoparticles (containing lncENAF) prepared by this method can be used to prepare drugs that alleviate inflammation. Therefore, the transgenic tomato microvesicle nanoparticles of this invention provide a new strategy for the development of anti-inflammatory drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0025] Figure 1 This is the electrophoresis detection diagram of lncENAF synthesis;

[0026] Figure 2 This is a map of the pCAMBIA1301 plasmid vector;

[0027] Figure 3 Electrophoresis diagram of PCR detection after lncENAF was inserted into the pCAMBIA1301 plasmid; Figures 1-6 are negative control, blank control, positive sample 1, positive sample 2, positive sample 3, and negative sample, respectively;

[0028] Figure 4 Flowchart constructed for transgenic tomatoes;

[0029] Figure 5 Identification diagram of lncENAF in transgenic tomato leaves (A) and fruits (B); 1-7 are positive sample 1, negative sample, positive sample 3, positive sample 4, positive sample 5, positive sample 6, and positive sample 7, respectively;

[0030] Figure 6 Flowchart for the extraction of microvesicle nanoparticles from transgenic tomato fruit;

[0031] Figure 7 Identification of lncENAF in tomato fruit microvesicle nanoparticles;

[0032] Figure 8 TEM (A) and particle size diagram (B) of tomato fruit microvesicle nanoparticles; the scale bar in A is 200 nm;

[0033] Figure 9 A diagram shows the inhibitory effect of tomato fruit microvesicle nanoparticles on inflammation. DETAILED DESCRIPTION

[0034] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0035] It should be understood that the terms described herein are intended only to describe particular embodiments and are not intended to limit the present invention. In addition, for numerical ranges herein, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. The intermediate value within any stated value or stated range, and each smaller range between any other stated value or intermediate value within the stated range, is also encompassed within the present invention. The upper and lower limits of these smaller ranges may be independently included or excluded within the scope.

[0036] Unless otherwise indicated, all technical and scientific terms used herein have the same meaning as commonly understood by those skilled in the art. Although only preferred methods and materials are described herein, any methods and materials similar or equivalent to those described herein may also be used in the practice or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of any conflict with any incorporated document, the contents of this specification shall prevail.

[0037] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments described herein without departing from the scope or spirit of the invention. Other embodiments will be apparent to those skilled in the art from the description of the invention. The description and examples are intended to be illustrative only.

[0038] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0039] HEK-293T cells and Raw264.7 cells in the following examples were purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences.

[0040] Example 1

[0041] 1. Construction of lncENAF transgenic tomato

[0042] 1.1 Gene synthesis

[0043] (1) The lncENAF gene sequence was synthesized by Sangon Biotech (Shanghai) Co., Ltd. The sequence of lncENAF is shown in SEQ ID NO. 1;

[0044] SEQ ID NO.1:

[0045] ATTGTACACCATGCAGACAAAGCGCTCAAACACTTGCAATGCTGGGCTTTCCCAATATCCTCTGCCATCTTTCCTACCCTTATAAAAGTCCAGAAAGAAAATAATCATTCTATCTGGAGGTGGGGGCCACTTCTTTAATCCTGGCACTTGGGAAGCAGAGGTAGGTATTGCTTTGAGTTCAAGACCAGACTGGTCTACAAAGTGAGTTCCGGGACAGTCAGGACTGTTGAA CTTGGAAGCCTTGTCCTCAAATTTCTGGCAATTTTACTAGCACCAGTCTTCCCGCCTCAGCCTCCAGTGTCTTCCTGAGATGATCTGACTGCATGAAATGCCCTCGCCTCATTTTAGTTGGCTGGCCCTAAGGTCAAGGTAAATCCGCGCCCAAGCTGCCCGGTGGAGGTGGTCTCAGAGGGTGCTGCGGGATCGAGGTAGTGAGGAGACTAGATCGCAAGACGTGATCCTCACA TTTATTTGCCTGGAGTTCTCATGCCAGAGAACCTGGCAGATTTTACTATTTCCCAATTGTTTACTCGCCAAGCTTTCAGGTCCACGCGCCTCAGGGCTGCGCCTCTCACTCTGAAACTTCATTCAAAGGCCAGGCAGGGAGGCCCAAGAGGTGGCGAATGGGCTTGAGTATGACCTCAAGGCC.

[0046] (2) PCR reaction:

[0047] Using the synthesized lncENAF (SEQ ID NO. 1) as a template, PCR amplification was performed using the ORF amplification primers CZ-lncENAF-KpnI-F and CZ-lncENAF-BamH IR to obtain the amplified product.

[0048] Upstream primer CZ-lncENAF-KpnI-F: AGGAGCTCCCGCGGGTCGAC ATTGTACACCATGCAGAC (SEQ ID NO. 2); downstream primer CZ-lncENAF-BamHI-R: AGCCTGCAGCCATGG GGCCTTGAGGTCATACTC (SEQ ID NO. 3); wherein, the underlined portion is the homology arm primer connected to the vector.

[0049] The reaction system (total volume 50 μL) is shown in Table 1:

[0050] Table 1

[0051] Components volume <![CDATA[ddH2O]]> 17μL 2×Phanta Max Buffer 25 μL dNTP Mix (10mM each) 1 μL Template DNA 2μL Upstream primer (10 μM) 2μL Downstream primer (10 μM) 2μL Phanta Max Super-Fidelity DNA Polymease(1U / μL) 1 μL

[0052] The PCR reaction program was as follows: 95°C for 30s; 95°C for 15s, annealing temperature at 55°C for 15s, extension at 72°C for 1min, 35 cycles; and final extension at 72°C for 5min.

[0053] (3) Agarose gel electrophoresis

[0054] Prepare 1% agarose gel. The formula is shown in Table 2.

[0055] Table 2

[0056]

[0057] Pour the 1× TAE and agar powder into a 250 mL Erlenmeyer flask and heat in a microwave to boil to fully dissolve the agarose. Cool to 60°C and dropwise add 1 / 10,000th of GoldView I Nucleic Acid Dye. Shake thoroughly to mix, then pour the solution into a clean electrophoresis tank, insert a comb, and let stand at room temperature for 15 minutes until the gel is completely solidified.

[0058] Sample loading: Remove the comb and place the agarose gel in 1×TAE buffer. Add the corresponding amount of 10× Loading buffer to the PCR reaction system and mix well. Use a pipette to take 5μL and add it to the small hole of the gel;

[0059] Electrophoresis: Set the electrophoresis program to 110V, 30min;

[0060] Exposure: After electrophoresis, place the agarose gel on a gel imager for imaging. Figure 1 .

[0061] 1.2 Vector construction

[0062] (1) Double-digest the vector pCAMBIA1301 with KpnI and BamHI to linearize it (see the vector map of pCAMBIA1301 for details). Figure 2 );

[0063] The enzyme digestion reaction system is shown in Table 3:

[0064] Table 3

[0065]

[0066] (2) After the enzyme digestion product is purified, it is subjected to a recombination ligation reaction with the PCR product obtained in 1.1;

[0067] The recombination ligation reaction system (total volume 10 μL) is shown in Table 4:

[0068] Table 4

[0069] Components volume Linearized vector 4μL Insert 1 μL 5×CE II Buffer 2μL Exnase II 1 μL <![CDATA[ddH2O]]> Make up to 10 μL

[0070] Gently pipette the reaction mixture to mix thoroughly, centrifuge, and collect the reaction mixture at the bottom of the tube. Incubate at 37°C for 30 minutes, then immediately cool on ice.

[0071] (3) The recombinant product was transformed into Escherichia coli DH5α cells;

[0072] a) Add 10 μL of the ligation product to 100 μL of E. coli competent cells and incubate on ice for 30 minutes;

[0073] b) heat shock at 42°C for 60 seconds, followed by an ice bath for 2 minutes;

[0074] c) Add 800 μL of LB liquid medium and incubate at 37°C in a shaking incubator for 30 min;

[0075] d) Centrifuge at 6000 rpm for 3 min, discard the supernatant, spread on a plate containing 50 mg / L Kana resistance medium, incubate inverted at 37°C for 16 h, and then pick resistant colonies;

[0076] e) Add 100 μL of LB (containing Kana) liquid medium to each well of a 96-well plate;

[0077] f) Take 4 colonies from each plate and expand the culture at 37°C, 180 rpm for 2 hours;

[0078] g) Take 1 μL of bacterial solution for PCR positive test:

[0079] PCR-positive transformants were selected and cultured to extract plasmids. The amplified products were then sent for sequencing. The amplification and sequencing primers were the vector sequences inserted on both sides of the target gene, namely: M13-F: 5'-GTTGTAAAACGACGGCCAG-3' (SEQ ID NO. 4); 2301-R: 5'-GCTTCCGGCTCGTATGTTG-3' (SEQ ID NO. 5);

[0080] h) Electrophoresis test, the electrophoresis results are shown in Figure 3 .

[0081] 1.3 Tomato transformation

[0082] (1) Tomato seedlings were sterile and cut into leaves as explants. After pre-culture, they were co-cultured with Agrobacterium containing the transformation vector (in the dark) for 2 days and then transferred to hygromycin resistance selection medium plates with a 16:8 light intensity and a room temperature of 25°C.

[0083] The formula of the hygromycin resistance selection medium is: 5g / L beef extract, 1g / L yeast extract, 5g / L peptone, 5g / L sucrose, 4g / L MgSO4·7H2O, 15g / L agar powder, and 5mg / L hygromycin b.

[0084] (2) After Agrobacterium infection, the plants were screened and subcultured four times (14 days apart) to induce resistant shoots, which were then transferred to growth medium (the growth medium used was 1 / 2MS modified plant medium, purchased from Biyuntian Biotechnology Co., Ltd., product number: B5010);

[0085] (3) After the roots of the normally elongated seedlings were cut, they were transferred to the rooting medium again (MS medium was purchased from Qingdao Hi-Tech Park Haibo Biotechnology Co., Ltd., product number: HB8469) until strong roots grew.

[0086] Specific process reference Figure 4 .

[0087] 1.4 DNA extraction and PCR identification from tomato seedling leaves

[0088] (1) DNA extraction from plant leaves was performed using the Plant DNA Extraction Kit (B518411) from Sangon Biotech (Shanghai) Co., Ltd.

[0089] a) Place a 0.5mm diameter plant leaf into a 1.5mL centrifuge tube and grind with a grinding rod. Add 100μL of Qlysis-P Reagent, vortex to mix, and incubate in an 85°C water bath for 20 minutes.

[0090] b) After incubation in a water bath, add 100 μL of Buffer NST to the centrifuge tube and vortex to mix.

[0091] c) Centrifugation: 12,000 rpm at room temperature for 5 min;

[0092] d) The supernatant was used as a template for direct PCR detection.

[0093] (2) PCR and electrophoresis

[0094] The PCR detection strategy is to use upstream vector primers and downstream target gene internal primers, with a product length of approximately 750 bp. The primers used for PCR detection are 35S-F: GACGCACAATCCCACTATCC (SEQ ID NO. 6); lncENAF-R: GGCCTTGAGGTCATACTC (SEQ ID NO. 7);

[0095] The PCR reaction system (total volume 25 μL) is shown in Table 5:

[0096] Table 5

[0097]

[0098] The PCR reaction program was as follows: 95°C for 30s; (95°C for 15s, annealing temperature at 52°C for 15s, extension at 72°C for 1min) × 35 cycles; and final extension at 72°C for 5min.

[0099] 1% agarose gel electrophoresis was performed at 100V for 30 min, and gel imaging was performed. The results are shown in the figure. Figure 5 As shown in A.

[0100] The correctly identified tomato transformation seedlings are transplanted and cultured until they are full-grown to obtain tomato fruits.

[0101] 2. Extraction and PCR Identification of Tomato Fruit RNA

[0102] 2.1 Extraction of total RNA from tomato fruits

[0103] RNA was extracted from the tomatoes obtained in 1.4 using the Plant Total RNA Rapid Extraction Kit (B518631) from Sangon Biotech (Shanghai) Co., Ltd.

[0104] (1) Add 600 μL of Buffer Rlysis-P to a 1.5 mL RNase-free centrifuge tube for later use.

[0105] (2) Grind 50 mg of tomato into powder using liquid nitrogen, add it to the above 1.5 mL centrifuge tube, and immediately shake to mix;

[0106] (3) Completely lyse the sample in a 65°C water bath for 5 min;

[0107] (4) Add 60 μL of Buffer PCA to the lysed sample and mix thoroughly. Incubate at -20°C for 3 min.

[0108] (5) Centrifuge at 12,000 rpm at room temperature and 4°C for 5 min, and collect the supernatant;

[0109] (6) Add an equal volume of phenol:chloroform (volume ratio 25:24, pH 4.5) to the supernatant and mix thoroughly. Centrifuge at 12,000 rpm at 4°C for 5 min and collect the supernatant.

[0110] (7) Add an equal volume of chloroform to the supernatant and mix thoroughly. Centrifuge at 12,000 rpm at 4°C for 5 min and collect the supernatant.

[0111] (8) Add 1 / 3 volume of anhydrous ethanol, mix well, let it stand at room temperature for 3 minutes, centrifuge at 12,000 rpm at 4°C for 5 minutes, and carefully discard the supernatant (after adding anhydrous ethanol and mixing well, let it stand at -20°C for 10 minutes to increase the yield of RNA);

[0112] (9) Wash the precipitate with 700 μL of 75% ethanol (prepared with DEPC water), centrifuge at 12,000 rpm at 4°C for 3 min, and carefully discard the supernatant.

[0113] (10) Invert the tube at room temperature for 10 min to evaporate any ethanol remaining in the tube. Add 50 μL of DEPC water to dissolve the precipitate and obtain RNA.

[0114] 2.2 RNA concentration and purity determination

[0115] (1) The extracted RNA concentration and purity were detected using Nanodrop 2000, and the detection probe was washed three times with 2 μL of DEPC water;

[0116] (2) Take 1 μL of DEPC water to adjust the concentration to ±0.2 ng / μL, and then take 1 μL of RNA sample to test its concentration and purity. Generally, RNA A 260 / 280 Between 1.8-2.0, A 260 / 230 ≥1.5;

[0117] (3) Wash the detection probe 5 times with 2 μL of double-distilled water.

[0118] 2.3 Reverse transcription

[0119] Take 1000ng of total RNA and II Q RT SuperMix for qPCR (+gDNAwiper) Reverse Transcription Kit (R323-01) instructions were used for the operation. The total system volume was 20 μL. The specific operation steps are as follows:

[0120] (1) Adjust the RNA sample to the same concentration with DEPC water, such as 500 ng / μL, and prepare the genome removal reaction system in 200 μL of enzyme-free EP tube, as shown in Table 6:

[0121] Table 6

[0122]

[0123] (2) Use a pipette to gently blow and mix, and react at 42℃ for 2 minutes in a PCR instrument.

[0124] (3) Preparation of reverse transcription reaction system (Table 7)

[0125] Table 7

[0126]

[0127] (4) Use a pipette to gently pipette to mix, place in a PCR instrument, and set the reverse transcription reaction program according to Table 8.

[0128] Table 8

[0129]

[0130] After the reaction is completed, continue with subsequent experiments or store at -20℃ for future use.

[0131] 2.4 PCR amplification and identification

[0132] The primers used for PCR detection were lncENAF-F: GGAAGCAGAGGTAGGTGTAT (SEQ ID NO. 8); lncENAF-R: GGCTTCCAAGTTCAACAGTC (SEQ ID NO. 9); the size of the target product was 112 bp.

[0133] The PCR reaction system (total volume 25 μL) is shown in Table 9:

[0134] Table 9

[0135]

[0136]

[0137] The PCR reaction program was as follows: 95°C for 30 s; 95°C for 15 s, annealing temperature at 55°C for 15 s, extension at 72°C for 30 s, 35 cycles; and final extension at 72°C for 5 min.

[0138] 1% agarose gel electrophoresis was performed at 100V for 30 min, and gel imaging was performed. The results are shown in the figure. Figure 5 As shown in B.

[0139] 3. Extraction of Tomato Microvesicles

[0140] (1) Wash and weigh 50 g of tomato fruit (obtained in Section 1.4).

[0141] (2) Crush the tomatoes and an appropriate amount of PBS at a mass ratio of 1:5 and grind them at the maximum speed for 5 times, each time for 1 minute.

[0142] (3) Pour the grinding solution into a 50 mL centrifuge tube and centrifuge at 1000 g for 10 min.

[0143] (4) After centrifugation, collect the supernatant and discard the precipitate. Centrifuge the supernatant at 3000g for 20 minutes.

[0144] (5) After centrifugation, collect the supernatant and discard the precipitate. Centrifuge the supernatant at 10,000 g for 40 min.

[0145] (6) After differential centrifugation, the supernatant was collected and ultracentrifuged at 4°C, 150,000 g, and 90 min. A sucrose solution with a concentration gradient of 60 wt%, 45 wt%, 30 wt%, and 8 wt% was prepared in advance, with each gradient being 8 mL.

[0146] (7) After ultracentrifugation, discard the supernatant, resuspend the precipitate with an appropriate amount of PBS, add it to the top layer of the sucrose solution, and ultracentrifuge at 150,000g, 4°C, for 2 hours.

[0147] (8) Two bands appeared (between 8 wt% and 30 wt%, and between 30 wt% and 45 wt%). Band 1 and band 2 were aspirated separately and centrifuged at 150,000 g to remove sucrose.

[0148] (9) Resuspend the precipitate in 1 mL of PBS, filter with a 0.22 μm filter membrane, and store at -80°C (see Figure 6 ).

[0149] 4. Extraction and Identification of RNA from Tomato Microvesicles

[0150] 4.1 Extraction of RNA from tomato microvesicles

[0151] (1) Take tomato microvesicles (lane 1 and lane 2) separately, add 200 μL of Trizol and shake thoroughly, add 40 μL of chloroform, vortex thoroughly to mix, and place on ice for 5 min;

[0152] (2) Centrifugation at 14,000 rpm for 15 min at 4°C;

[0153] (3) Transfer the supernatant to a new 1.5 mL enzyme-free EP tube and add an equal volume of pre-chilled isopropanol;

[0154] (4) Gently invert to mix, and place on ice for 10 minutes;

[0155] (5) Centrifuge at 14,000 rpm for 10 min at 4°C, discard the supernatant, and retain the white precipitate;

[0156] (6) Add 1 mL of 75% anhydrous ethanol prepared with DEPC water, gently blow up the precipitate but do not disperse it, and centrifuge at 14,000 rpm at 4°C for 5 min. Repeat once.

[0157] (7) Discard the supernatant, centrifuge the liquid on the tube wall to the bottom of the tube, aspirate the liquid with a pipette tip, open the EP tube cap, heat in a 42°C metal bath to turn the precipitate from white to colorless, add an appropriate amount of DPEC water according to the size of the precipitate to dissolve the precipitate, and wait for subsequent detection of concentration and purity.

[0158] 4.2 RNA concentration determination and reverse transcription refer to sections 2.2 and 2.3.

[0159] 4.3 PCR identification of RNA expression in microvesicles

[0160] Refer to section 2.4 for PCR identification. Electrophoresis of PCR products was performed on 1% agarose gel. The electrophoresis results are shown in Figure 7 Both bands 1 and 2 contain lncENAF, and band 2 contains more lncENAF, so band 2 was used for subsequent functional verification.

[0161] 5. Characterization of Tomato Microvesicles

[0162] (1) Use phosphomolybdic acid to negatively stain the sample of band 2 and observe it under an electron microscope (see Figure 8 Middle A), the results showed that the extract of 4.1 was a nanoscale vesicle-like structure.

[0163] (2) About 200 μL of nanovesicles from strip 2 were extracted and their particle size was measured using a nanoparticle size analyzer (see Figure 8 Middle B), the results showed that the average particle size was 112.5±59.9 nm.

[0164] 6. Effects of Tomato Microvesicles on Cells

[0165] 6.1 Effects of tomato microvesicles on HEK-293T cells

[0166] HEK-293T cells were seeded into 24-well plates (80,000 cells per well). After the cells adhered to the wall and cultured for 12 hours, 20 μg of the extracted tomato microvesicles (lane 2) were co-incubated with the cells for 24 hours. The cells were then collected and the cellular RNA was extracted using the Trizol method and reverse transcribed (specific steps 2.1, 2.2, and 4.3). The level of lncENAF was then quantitatively analyzed by fluorescence (see Table 10 for results). The results showed that the transgenic tomato microvesicles entered the HEK-293T cells and expressed lncENAF in the cells.

[0167] Table 10 CT values ​​of lncENAF in HEK-293T cells after co-incubation of transgenic tomato microvesicles with cells

[0168]

[0169] 6.2 Inhibitory Effect of Tomato Microvesicles on Inflammatory Cytokines

[0170] (1) Raw264.7 cells were plated into 24-well plates (50,000 cells per well). After the cells adhered to the wall, they were divided into four groups: control group (no treatment), LPS stimulation group (10 μg / mL lipopolysaccharide stimulation for 6 h), LPS + ordinary tomato microvesicles group, and LPS + lncENAF transgenic tomato microvesicles group.

[0171] Among them, the control group: no treatment;

[0172] LPS stimulation group: stimulated with 10 μg / mL LPS (lipopolysaccharide) for 6 h;

[0173] LPS+common tomato microvesicle group: 20 μg of common tomato microvesicles were added and incubated with cells for 24 h, and then stimulated with 10 μg / mL LPS for 6 h;

[0174] LPS+lncENAF transgenic tomato microvesicle group: 20 μg of lncENAF transgenic tomato microvesicles (carrying lncENAF) were added and incubated with the cells for 24 h, and then stimulated with 10 μg / mL LPS for 6 h.

[0175] (2) After LPS stimulation in each experimental group, cells were collected, and RNA was extracted and reverse transcribed (specific steps 2.1, 2.2, and 4.3). Real-time fluorescence quantitative PCR (RT-qPCR) was then used to detect the expression levels of inflammatory cytokines IL-6, IL-1β, and TNF-α. The detection primers are shown in Table 13.

[0176] The real-time fluorescence quantitative PCR detection method is as follows:

[0177] (1) Add the diluted cDNA to 20 μL of reverse transcription reaction system (20 μL of cDNA is diluted with 20 μL of DEPC water) and mix thoroughly with a pipette;

[0178] (2) Prepare N+1 qPCR reaction systems as needed. After thorough mixing, take 18 μL and add it to a pre-labeled 96-well PCR reaction plate. Then add 2 μL of reverse transcription product. The specific system is shown in Table 11:

[0179] Table 11

[0180]

[0181] (3) After the 96-well PCR reaction plate is tapped, it is placed in a Bio-Rad fluorescence quantitative analyzer. The program settings are shown in Table 12:

[0182] Table 12

[0183]

[0184]

[0185] (4) After the program is completed, the relative mRNA expression level is calculated using the ΔΔCt method.

[0186] The calculation steps are as follows:

[0187] ΔCt = average Ct value of target gene - average Ct value of reference gene;

[0188] △△Ct=△Ct experimental group-△Ct control group;

[0189] The internal reference gene was GAPDH.

[0190] Table 13

[0191]

[0192] The results of real-time fluorescence quantitative PCR (RT-qPCR) detection of inflammatory cytokines IL-6, IL-1β and TNF-α were as follows: Figure 9 As shown, according to Figure 9 It can be seen that after co-incubation of lncENAF transgenic tomato microvesicles with Raw264.7 cells, the production of inflammatory cytokines (IL-6, IL-1β and TNF-α) induced by LPS stimulation can be inhibited, indicating that the transgenic tomato fruits prepared by the present invention can carry lncENAF, and the transgenic tomato fruit microvesicles carry lncENAF, thereby exerting an anti-inflammatory effect.

[0193] The embodiments described above are merely descriptions of preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Without departing from the spirit of the present invention, various modifications and improvements made to the technical solutions of the present invention by persons skilled in the art should fall within the scope of protection defined by the claims of the present invention.

Claims

1. A method for preparing transgenic tomato microvesicle nanoparticles, characterized in that: The following steps are involved: (1) The lncENAF DNA molecule was connected to a gene expression vector, and then transformed into competent cells to obtain a recombinant microbial strain; (2) using the recombinant microbial strain to infect tomato explants, followed by tissue culture and identification screening to obtain transgenic tomato plants; (3) cultivating the transgenic tomato plants and setting fruit to obtain transgenic tomato fruits; (4) performing microvesicle extraction on the transgenic tomato fruit to obtain microvesicle nanoparticles containing lncENAF; In step (1), the nucleotide sequence of the lncENAF DNA molecule is shown as SEQ ID NO.

1.

2. The preparation method according to claim 1, characterized in that In step (1), the gene expression vector is pCAMBIA1301.

3. The preparation method according to claim 1, characterized in that In step (1), the competent cells are Escherichia coli competent cells.

4. The preparation method according to claim 1, characterized in that In step (2), the tomato explant is a leaf.

5. The preparation method according to claim 1, characterized in that In step (4), the extraction is performed by density gradient centrifugation.

6. A microvesicle nanoparticle containing lncENAF prepared according to the preparation method according to any one of claims 1 to 5.

7. Use of the microvesicle nanoparticles according to claim 6 in preparing a drug for alleviating inflammation.

8. The use according to claim 7, characterized in that The relief of inflammation refers to the inhibition of the production of inflammatory cytokines IL-6, IL-1β and / or TNF-α.

9. A drug for relieving inflammation, characterized in that: The drug includes the microvesicle nanoparticles containing lncENAF according to claim 6.

10. The drug according to claim 9, characterized in that The drug also includes pharmaceutically acceptable excipients.

Citation Information

Patent Citations

  • Gene for increasing tomato fruit weight and number of ventricles and regulation and control method thereof

    CN113462706A