Cas12a-based method for differentiating between prv field strains and gE / TK gene-deleted vaccine strains
By designing specific crRNA and primers using the CRISPR/Cas12a system and MIRA isothermal amplification technology, and utilizing the Cas12a protein to recognize and cleave target DNA probes, rapid, sensitive, and visual detection of porcine pseudorabies virus wild-type strains and gene-deleted vaccine strains was achieved, solving the problems of long detection time and complexity of existing detection methods.
Patent Information
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- ZHEJIANG UNIV
- Filing Date
- 2023-06-29
- Publication Date
- 2026-06-12
AI Technical Summary
Existing PRV testing methods are time-consuming, costly, and complex to operate, making it difficult to meet the needs for convenient on-site testing and unable to accurately distinguish between wild-type porcine pseudorabies virus strains and gene-deleted vaccine strains.
Using the CRISPR/Cas12a system, specific crRNA and primers were designed and combined with MIRA isothermal amplification technology. The target DNA probe was recognized and cleaved by the Cas12a protein, and the fluorescence signal was used to achieve visual detection.
It enables rapid, sensitive, and convenient differential diagnosis of PRV wild-type strains and gE/TK gene deletion vaccine strains, improving the accuracy and efficiency of detection, and is suitable for rural and field environments with limited resources.
Smart Images

Figure CN116855638B_ABST
Abstract
Description
Technical Field
[0001] This invention belongs to the fields of biology and chemistry, and relates to a method for visually detecting porcine pseudorabies virus (PRV) using the CRISPR / Cas12a system. Background Technology
[0002] The clustered regularly interspaced short palindromic repeats (CRISPR) / CRISPR associated proteins (Cas) system is an adaptive immune system in bacteria and archaea. Cas12a belongs to type 2V immune systems, which bind to specific crRNAs (CRISPR RNAs) and then specifically recognize target double-stranded DNA sequences tagged with a protospacer adjacent motif (PAM) through base complementarity pairing. The PAM sequence recognized by Cas12a is typically 5'-TTTN-3'. After recognizing and binding to the target sequence, the trans-cleavage activity of the Cas12a protein is activated, indiscriminately cleaving single-stranded DNA probes in the system. Based on this characteristic, Cas12a can be developed for nucleic acid detection.
[0003] Pseudorabies (PR) is an acute, contagious disease affecting multiple mammals, caused by PRV infection. It can lead to reproductive disorders in pregnant sows and boars, and mortality rates of up to 100% in suckling piglets, causing enormous economic losses to the global pig farming industry. The PRV genome is a linear double-stranded DNA, approximately 150 kb in length, encoding about 100 proteins, including 11 glycoproteins (gB, gC, gD, gE, gG, gH, gI, gK, gL, gM, and gN). The gB protein (approximately 2745 bp) is a component of the viral envelope and is essential for PRV replication. The deletion of some immune-related virulence genes, such as gE (approximately 1740 bp) and TK (approximately 960 bp), does not affect viral replication or immunogenicity, but significantly reduces viral virulence and invasiveness. Therefore, PRV strains lacking these gene types can be used as vaccines for PR control. my country is a major pork producer and consumer. Since the last century, my country has used the gE gene-deleted Bartha strain for the prevention and control of porcine pseudorabies. Subsequently, gE gene-deleted C strain, TK gene-deleted HB-98 strain, and gE / TK gene-deleted HB2000 strain were developed. The use of gene-deleted weak-read vaccines has played an indispensable role in the prevention and control of porcine pseudorabies in my country. Therefore, in order to accurately distinguish between vaccinated pigs and wild-type infected pigs and to promptly cull positive pigs, there is a huge market demand for a rapid, sensitive, reliable, and convenient diagnostic identification technology for PRV wild-type strains and gene-deleted vaccine strains. However, traditional PRV detection methods, such as PCR and ELISA, require expensive equipment and a high level of prior knowledge from operators, making it difficult to meet the needs of convenient on-site testing. Therefore, overcoming the many limitations of traditional detection methods, introducing cutting-edge technologies, and developing an efficient, convenient, sensitive, and specific porcine pseudorabies virus detection technology is of great significance. Summary of the Invention
[0004] The technical problem to be solved by this invention is to provide a visualization method for PRV wild-type strains and gE based on CRISPR / Cas12a. - / TK - Methods for identifying and diagnosing gene-deleted vaccine strains.
[0005] To address the aforementioned technical problems, this invention provides a visualization method for porcine pseudorabies wild-type virus strains and gE based on CRISPR / Cas12a. - / TK - The crRNA sequence for identifying gene-deleted vaccine strains is defined as follows:
[0006] gB-crRNA-5'-UAAUUUCUACUAAGUGUAGAUUGCGCACGCCGCACUUCACG-3', gE-crRNA-5'-UAAUUUCUACUAAGUAGAUUCCGGAUCGCGGAACCAGAC-3', TK-crRNA-5'-UAAUUUCUACUAAGUGUAGAUGGCGCGUACAAGGCGCCCGA-3'.
[0007] This invention also provides a visualization of porcine pseudorabies wild-type virus strains and gE based on CRISPR / Cas12a. - / TK - Primers and probes for identifying gene-deleted vaccine strains:
[0008] The isothermal amplification primers are:
[0009] MIRA-gB-F-5-'CGTGTACATGTCCCCCTTCTAC-3',
[0010] MIRA-gB-R-5'-GGATCATCTCCTCGGCCT-3',
[0011] MIRA-gE-F-5'-CACATGCTCTCTCCGGTGT-3',
[0012] MIRA-gE-R-5'-TCGTCACTTCCGGTTTCTCC-3':
[0013] MIRA-TK-F-5'-AGCTCCAGGACACCCTCTTTCGG-3',
[0014] MIRA-TK-R-5'-ACACGCACTGCCGGATGTGG-3';
[0015] The FAM-BHQ1 single-stranded DNA probe is 5'-FAM-TTATT-BHQ1-3';
[0016] The primers for full-length amplification of the gB, gE, and TK genes are:
[0017] gB-F-5'-TGACCTACGAGGCGTCATGCC-3',
[0018] gB-R-5'-TTCTTCTTGCCGCCTTGTGC-3',
[0019] gE-F-5'-ATGCGGCCCTTTCTGCT-3',
[0020] gE-R-5-'TTAAGCGGGGCGGGACAT-3',
[0021] TK-F-5'-AAGCCCGAAGAGACTCTCGC-3',
[0022] TK-R-5'-TCACACCCCCATCTCCGAC-3';
[0023] The primers for adding homologous arms to both ends of the three genes are:
[0024] pIERS2-gB-F-5'-CCGTCAGATCCCGCTAGCTGACCTACGAGGCGTCATG-3',
[0025] pIERS2-gB-R-5'-GGTTCAGGGGGAGGATCCTTCTTCTTGCGCGCCTTG-3',
[0026] pIERS2-gE-F-5'-AACCGTCAGATCCGCTAGCATGCGGCCCTTTCTG-3',
[0027] pIERS2-gE-R-5'-GTTCAGGGGGAGGATCCTTAAGCGGGGCGGGA-3',
[0028] pIERS2-TK-F-5'-GTCAGATCCGCTAGCATGCGCATCCTCCGG-3',
[0029] pIERS2-TK-R-5'-TCAGGGGGGAGGATCCTCACAACCCCATCTCCGAC-3'.
[0030] This invention designs isothermal amplification primers MIRA-gB-F / MIRA-gB-R, MIRA-gE-F / MIRA-gE-R, and MIRA-TK-F / MIRA-TK-R to amplify three target gene fragments of PRV via MIRA.
[0031] This invention also provides a visualization of porcine pseudorabies wild-type virus strains and gE based on CRISPR / Cas12a. - / TK - The method for identifying and diagnosing gene-deleted vaccine strains includes the following steps:
[0032] Step 1: Extraction of viral genome; PRV can be extracted from the sample to be tested according to the instructions of the EasyBlood / Tissue Genome Extraction Kit.
[0033] Step 2: Using the above-mentioned isothermal amplification primers, the extracted viral genome is amplified using isothermal amplification technology; the nucleic acid to be tested can be amplified at isothermal temperature according to the instructions accompanying the AMP Future MIRA Nucleic Acid Isothermal Amplification Kit.
[0034] Step 3: Use the amplified product for Cas12a detection.
[0035] As an improvement to the differential diagnostic method of the present invention, the principle of the present invention based on CRISPR / Cas12a technology is as follows:
[0036] Viral genomes extracted from samples were pre-amplified using MIRA isothermal amplification technology to target genes. Cas12a protein and crRNA bind to each other at 37°C to form a crRNA / Cas12a protein complex. Subsequently, crRNA recognizes the target double-stranded DNA through base complementarity pairing, and the three combine to form a crRNA / Cas12a / target DNA ternary complex. After the complex is formed, the trans-cleavage activity of Cas12a protein is activated, and it begins to indiscriminately cleave single-stranded DNA in the system. When a single-stranded DNA probe with a FAM fluorescent group at one end and a fluorescence quencher group at the other end is cleaved, the FAM group emits visible green fluorescence under 470nm LED blue light excitation. If the detection system exhibits luminescence after the reaction, the target detection result is positive; otherwise, it is negative.
[0037] As a further improvement to the differential diagnosis method of the present invention:
[0038] In step two:
[0039] The MIRA isothermal amplification system consisted of 50 μL, including 29.4 μL of buffer A, 2 μL each of MIRA-gB-F, MIRA-gB-R, MIRA-gE-F, MIRA-gE-R, MIRA-TK-F and MIRA-TK-R, 2 μL of DNA template, 12.1 μL of DEPC water, and 2.5 μL of buffer B. The reaction was carried out at 37°C for 20 minutes.
[0040] As a further improvement to the differential diagnosis method of the present invention:
[0041] In step three:
[0042] The Cas12a visualization assay consists of 10 μL of the following components: Cas12a protein 50–100 nM, crRNA 70–140 nM, single-stranded DNA probe 1 μL, MIRA amplification product 2 μL, 1×NEB 2.1 buffer, and DEPC water added to a final volume of 10 μL. The assay is carried out at 37°C for 15 minutes, and fluorescence is observed under a 470 nm blue light gel cutter.
[0043] As a further improvement to the differential diagnosis method of the present invention:
[0044] Step three is:
[0045] In the Cas12a detection stage, the sample to be tested and three types of crRNA (the three gene-specific crRNAs of this invention, gB-crRNA, gE-crRNA, and TK-crRNA) were first placed in three test tubes and incubated at 37°C for 3 to 5 minutes; the molar ratio of crRNA to the sample to be tested was 1:1 to 2:1 (the molar ratio of crRNA / Cas12a protein was preferably 1.4:1);
[0046] Next, add 1 μL of FAM-BHQ1 single-stranded DNA probe (concentration 10 μM), 2 μL of the MIRA isothermal amplification product obtained in step two, and 1×NEB 2.1 buffer to each of the three test tubes. Finally, add DEPC water to a final volume of 10 μL and mix well. Incubate at 37°C for 15 min. Then, place the three test tubes under a 470 nm blue light gel cutter to observe the fluorescence. Finally, make a preliminary judgment according to the following rules:
[0047] ① If all three tubes show fluorescence, it indicates that the sample being tested is infected with a wild-type virus strain;
[0048] ②If the gB tube emits fluorescence while the other two tubes do not, it indicates that the sample to be tested is a vaccine strain with double gene deletion of gE and TK.
[0049] ③ If the gE tube does not emit fluorescence, it indicates that the sample to be tested is a gE-deficient vaccine strain;
[0050] ④ If a TK tube does not emit fluorescence, it indicates that the sample to be tested is a TK-deleted vaccine strain;
[0051] ⑤ If no fluorescence is detected in any of the three test tubes, the test result is negative (i.e., the sample tested was neither vaccinated nor infected with the PRV wild strain).
[0052] This enables the visual detection of PRV wild-type strains and vaccine strains.
[0053] This invention aims to overcome the shortcomings of existing PRV diagnostic techniques, such as time consumption and high cost. Based on the Cas12a protein and combined with MIRA (Multienzyme Isothermal Rapid Amplification) DNA isothermal amplification technology, a visualized rapid differential diagnostic method for PRV wild-type strains and gE / TK gene deletion vaccine strains has been developed. The purpose of this invention is to establish a rapid and sensitive differential diagnostic technique for PRV wild-type strains and gE / TK gene deletion vaccine strains, accurately distinguishing between vaccinated pigs and wild-type infected pigs, and promptly culling positive pigs. The detection method described in this invention greatly improves the accuracy, convenience, and efficiency of PRV detection methods.
[0054] That is, the present invention amplifies the target sequence of porcine pseudorabies virus using MIRA nucleic acid isothermal technology, designs crRNA specifically targeting the viral genome based on the target sequence, and then uses Cas12a protein to bind crRNA to detect the target DNA.
[0055] The visual detection targets of this invention are porcine pseudorabies wild-type virus strain and gE. - / TK - Gene-deleted vaccine strain.
[0056] The present invention provides a visual diagnostic identification method for PRV wild-type strains and gE / TK gene deletion vaccine strains, including Cas12a protein, crRNA, MIRA amplification primers, three standard recombinant plasmids containing PRV-infected samples, some commonly used commercially available PRV live vaccines, and clinical samples infected and uninfected with PRV.
[0057] The method for synthesizing and purifying crRNA in this invention is as follows: A sequence with the structure "T7 promoter-Cas12a backbone sequence-Spacer sequence" and its complementary sequence are annealed to synthesize a double strand. Using this double strand as a template, crRNA is synthesized by transcription under the action of T7 RNA polymerase. The transcription system includes: 1 μL T7 polymerase, 4 μL double-stranded DNA template, 1 μL ATP, 1 μL UTP, 1 μL CTP, 1 μL GTP, 1×NEB 2.1 buffer, incubated overnight at 37°C, followed by purification. The in vitro transcription kit is the T7 High Yield RNA Transcription Kit purchased from Nanjing Novizan Biotechnology Co., Ltd., and the RNA purification kit is the Monarch RNACleanup Kit purchased from New England Biolabs.
[0058] Compared to existing porcine pseudorabies virus detection technologies, the advantages of this discovery are as follows:
[0059] (1) This invention discloses for the first time a rapid diagnostic identification method for porcine pseudorabies wild-type virus strain and TK / gE gene deletion vaccine strain based on CRISPR / Cas12a, which is of great significance for rapid molecular detection research of porcine pseudorabies virus and screening and early diagnosis of porcine pseudorabies positive pigs.
[0060] (2) The detection method provided by this invention was used to detect porcine pseudorabies wild-type strains (DF and Ea strains) and vaccine strains (Bartha-k61, C, and HB98 strains), as well as porcine reproductive and respiratory syndrome virus (PRRSV), classical swine fever virus (CSFV), porcine epidemic diarrhea virus (PEDV), and porcine transmissible gastroenteritis virus (TGEV). The results showed that the detection method provided by this invention can effectively diagnose and differentiate porcine pseudorabies wild-type strains and vaccine strains. Furthermore, it does not produce a fluorescent reaction when detecting other viruses. The sensitivity of the detection method provided by this invention was also tested, and it can detect as low as 10-1. 1 Copy the target plasmid.
[0061] (3) The method and technical platform for detecting and identifying porcine pseudorabies wild-type virus strains and vaccine strains provided by this invention can achieve visual detection results in just 35 minutes (20 minutes of isothermal amplification and 15 minutes of CRISPR / Cas12a reaction). It can play an important role in routine infectious disease screening and early culling of positive infected pigs in pig farms.
[0062] (4) This invention innovatively developed a PRV detection method that can overcome the restriction of PAM sequence on Cas12a protein, which can greatly broaden the application range of Cas12a.
[0063] (5) The detection method provided by the present invention only requires a constant temperature heat source of 37-42℃ and an excitation light source of 470nm throughout the detection process, and is also applicable in rural areas and the field where conditions are limited.
[0064] In summary, this invention provides a method for the visual identification and diagnosis of wild-type porcine pseudorabies virus strains and gE / TK gene-deleted vaccine strains based on CRISPR / Cas12a protein. The specific steps include: pre-amplifying the gB, gE, and TK genes of porcine pseudorabies virus at 37°C using MIRADNA isothermal amplification technology; under crRNA-mediated regulation, Cas12a can specifically recognize the target DNA sequence, and its trans-cleavage activity is activated after recognition, allowing it to indiscriminately cleave single-stranded DNA probes with a FAM fluorescent group at one end and a BHQ1 quenching group at the other. Under 470nm blue light excitation, the probes emit visible fluorescence, which serves as a positive indicator. This method is simple to operate, has superior sensitivity and specificity, and requires no expensive laboratory equipment, showing promising development and application prospects in the prevention and eradication of porcine pseudorabies. Attached Figure Description
[0065] To more clearly illustrate the specific embodiments of the present invention or the technical solutions in the prior art, the accompanying drawings used in the description of the specific embodiments will be briefly introduced below.
[0066] Figure 1 This is a schematic diagram illustrating the principle and workflow of MIRA-CRISPR / Cas12a detection and identification of porcine pseudorabies virus. This invention relates to two crRNA design methods, such as... Figure 1 The diagram shows two different paths, A and B.
[0067] The path shown in A is as follows: the site to be detected contains the "TTTN" sequence, and primers can be designed in a conventional manner for direct amplification and detection.
[0068] The path shown in B is that the detection range does not contain sites that meet the detection requirements and contain TTTN. A pair of conserved and highly efficient isothermal amplification primers can be designed, and a "T" base can be inserted at a certain position 3' away from the front primer. A PAM sequence is artificially introduced into the amplification product through the primer, so that Cas12a can recognize and detect the target sequence.
[0069] Figure 2 This is a detailed comparison and location of the crRNA recognition sequences of the porcine pseudorabies gB, gE, and TK genes.
[0070] Figure 2 In the middle: the gray background sequence represents the target sequence being detected, and the underlined sequence represents the PAM sequence recognized by Cas12a.
[0071] Figure 3 Screening for the optimal crRNA / Cas12a protein ratio in a Cas12a detection system for porcine pseudorabies.
[0072] Figure 4 Fluorescence display of the sensitivity of MIRA-Cas12a in detecting the gB, gE, and TK genes of porcine pseudorabies virus.
[0073] Figure 5 Two porcine pseudorabies wild-type strains, three vaccine strains, two positive porcine pseudorabies samples, and four other porcine viruses were detected using the MIRA-Cas12a assay: porcine reproductive and respiratory syndrome virus (PRRSV), classical swine fever virus (CFV), porcine epidemic diarrhea virus (PEDV), and porcine transmissible gastroenteritis virus (TGEV). Detailed Implementation
[0074] To more clearly describe the present invention, the specific implementation of the technical solution of the present invention will be described in detail below with reference to the accompanying drawings.
[0075] Example 1: Construction of standard recombinant plasmids for PRVgB, gE, and TK genes
[0076] The primer sequences for amplifying the full-length gB, gE, and TK genes are as follows:
[0077] gB-F-5'-TGACCTACGAGGCGTCATGCC-3',
[0078] gB-R-5'-TTCTTCTTGCCGCCTTGTGC-3',
[0079] gE-F-5'-ATGCGGCCCTTTCTGCT-3',
[0080] gE-R-5-'TTAAGCGGGGCGGGACAT-3',
[0081] TK-F-5'-AAGCCCGAAGAGACTCTCGC-3',
[0082] TK-R-5'-TCACACCCCCATCTCCGAC-3',
[0083] The primers for adding homologous arms to both ends of the three genes are:
[0084] pIERS2-gB-F-5'-CCGTCAGATCCCGCTAGCTGACCTACGAGGCGTCATG-3',
[0085] pIERS2-gB-R-5'-GGTTCAGGGGGAGGATCCTTCTTCTTGCGCGCCTTG-3',
[0086] pIERS2-gE-F-5'-AACCGTCAGATCCGCTAGCATGCGGCCCTTTCTG-3',
[0087] pIERS2-gE-R-5'-GTTCAGGGGGAGGATCCTTAAGCGGGGCGGGA-3',
[0088] pIERS2-TK-F-5'-GTCAGATCCGCTAGCATGCGCATCCTCCGG-3',
[0089] pIERS2-TK-R-5'-TCAGGGGGGAGGATCCTCACAACCCCATCTCCGAC-3'.
[0090] First, using the PRV wild-type strain DF as a template, the complete sequences of the gB, gE, and TK genes were amplified via PCR. The amplification system consisted of 50 μL of 2×Phanta Master Mix (25 μL), PRV-DF strain nucleic acid (2 μL), DEPC water (19 μL), and 2 μL each of the preceding and following primers. The primers were gB-F / gB-R, gE-F / gE-R, and TK-F / TK-R, with a primer concentration of 10 μM. The PCR program used was as follows:
[0091] ① Pre-denaturation at 95℃ for 3 minutes;
[0092] ② Denaturation at 95℃ for 15 seconds;
[0093] ③ Anneal at 58℃ for 15 seconds;
[0094] ④72℃, 2 min 30 s extension;
[0095] ⑤ Repeat steps ②-④ for 35 cycles;
[0096] ⑥72℃, total extension 5min;
[0097] ⑦4℃, save.
[0098] After the PCR program was completed, the PCR products were mixed with 10× Loading buffer and subjected to gel electrophoresis. The bands that met the criteria were cut out (gB gene 2661 bp, gE gene 1740 bp, TK gene 1060 bp) and purified using an agarose gel extraction kit (purchased from Shanghai Huiling Biotechnology Co., Ltd.). The specific steps for gel extraction are as follows:
[0099] ① Under 470nm blue light gel cutter, carefully cut the strip around 2500bp with a clean blade, taking care to avoid impurities. Place the cut strip in a 1.5mL EP tube and weigh the cut gel. Add sol solution at a ratio of gel weight (mg): DD sol solution (μL) = 1:3.
[0100] ② Heat the glue block at 56℃ until it is completely melted;
[0101] ③ Transfer the completely melted gel to the centrifuge column provided with the kit, centrifuge at 12000 rpm for 30 seconds at room temperature, and discard the filtrate;
[0102] ④ Add 600 μL of wash buffer WB, centrifuge at 12000 rpm at room temperature for 30 s, and discard the filtrate;
[0103] ⑤ Repeat rinsing step ④;
[0104] ⑥ Replace the adsorption column in the centrifuge tube and centrifuge at 12000 rpm for 2 min;
[0105] ⑦ Place the adsorption column into a new 1.5 mL EP tube, add 50 μL of preheated Elution buffer at 65 °C, let stand at room temperature for 2 min, then centrifuge at 12000 rpm for 1 min at room temperature. The filtrate is the recovered product, which should be stored at 4 °C for later use.
[0106] The recovered product was subjected to PCR to add homologous arms to both ends of the gene. The PCR system consisted of 20 μL of 2×PhantaMaster Mix, 2 μL of the gel-recovered product from the previous step, 1 μL each of the front and rear primers, and 6 μL of DEPC water. The reaction procedure was as follows:
[0107] ① Pre-denaturation at 95℃ for 3 minutes;
[0108] ② Denaturation at 95℃ for 15 seconds;
[0109] ③ Anneal at 56℃ for 15 seconds;
[0110] ④72℃, 2 min 30 s extension;
[0111] ⑤ Repeat steps ②-④ for 35 cycles;
[0112] ⑥72℃, total extension 5min;
[0113] After the PCR program was completed, the PCR products were mixed with 10× Loading buffer and subjected to gel electrophoresis. The product bands were purified by gel extraction using Huiling Biotechnology's gel extraction kit for adding homologous sequences. The concentration of the purified products was determined using Nanodrop2000. The concentration of gB gene amplification product was 19.9 ng / μL, gE gene amplification product was 23.8 ng / μL, and TK gene amplification product was 26 ng / μL. The products were stored at 4℃ for later use.
[0114] The gB, gE, and TK genes were cloned into the pIERS2-EPFG vector plasmid. The specific steps were as follows, according to the ClonExpress II OneStep Cloning Kit instructions:
[0115] The amount of cloning vector used can be calculated using the following formula: Amount of cloning vector used = [0.02 × number of base pairs of cloning vector] ng (approximately 0.03 pmol).
[0116] The optimal amount of insert fragment used = [0.04 × number of base pairs of insert fragment] ng (approximately 0.06 pmol); calculate the amount of PCR product containing the vector and the added homologous fragment of the plasmid, and ligate the vector and gene fragment according to the system (20 μL). The system contains: 2 μL of pIERS2-EPFG vector plasmid, 6 μL of PCR amplification product with homologous fragment, 4 μL of 5×CE Buffer, 2 μL of EXnase, and 6 μL of DEPC water. After gently mixing, incubate in a constant temperature water bath at 37℃ for 37 min for ligation.
[0117] After ligation, the ligation product was transformed into competent DH5α cells to construct a recombinant plasmid. The specific steps are as follows:
[0118] ① Remove competent DH5α cells from -80℃ and thaw them on ice;
[0119] ② Add the above ligation product to 500 μL of thawed competent cells DH5α, mix gently, and incubate on ice for 30 min;
[0120] ③ The above product was heat-shocked at 42℃ for 45s;
[0121] ④ Incubate the heat-shocked DH5α on ice for another 2-3 minutes;
[0122] ⑤ Add 1 mL of LB liquid medium containing 50 μg / mL kanamycin to the EP tube after the reaction, and incubate at 37℃ in a shaker at 180 r / min for 1 h;
[0123] ⑥ Centrifuge the above bacterial solution at 4000 rpm for 3 min at room temperature, discard the supernatant (retain about 150 μL of supernatant), and gently mix the remaining bacterial solution with a pipette.
[0124] ⑦ The above-mentioned mixed bacterial solution was inoculated onto LB solid medium containing 50 μg / mL kanamycin by spreading on a plate and incubated overnight at 37°C.
[0125] ⑧ Pick 4 individual colonies and inoculate them into 1 mL of LB liquid medium containing 50 μg / mL kanamycin. Incubate at 37°C and 180 r / min in a shaker for 4 h.
[0126] ⑨ The cultured bacterial solution was sent to Hangzhou Qingke Biotechnology Co., Ltd. for sequencing and identification;
[0127] ⑩ Take 2 mL of the identified positive bacterial solution into a 10 mL centrifuge tube, add 8 mL of LB liquid medium containing 50 μg / mL kanamycin, and incubate overnight at 37°C with a constant temperature of 180 r / min.
[0128] Next, plasmids were extracted from the overnight culture using the OMEGA Plasmid Mini KitⅠ according to the instructions. The specific steps are as follows:
[0129] ① Centrifuge the centrifuge tubes containing bacterial culture at 4°C and 5000 rpm for 10 minutes in a refrigerated centrifuge, and discard the filtrate;
[0130] ② Add 500 μL SolutionⅠ / RNase A and vortex mix.
[0131] ③ Transfer the mixed bacterial solution to a 2mL EP tube, add 500μL SolutionⅡ, gently invert to mix, and let stand for 2-3 minutes;
[0132] ④ Add 700 μL Solution Ⅲ, quickly invert and mix until a white flocculent precipitate appears;
[0133] ⑤ Centrifuge at 13000 rpm at room temperature for 10 minutes, take the supernatant and add 700 μL at a time to the centrifuge column, centrifuge at 13000 rpm at room temperature for 1 min, and discard the filtrate;
[0134] ⑥ Add 500 μL HBC Buffer, centrifuge at 13000 rpm for 1 min at room temperature, and discard the filtrate;
[0135] ⑦ Add 700 μL DNA Wash Buffer, centrifuge at 13000 rpm for 1 min at room temperature, and discard the filtrate;
[0136] ⑧ Repeat step ⑦ to wash again, then discard the filtrate;
[0137] ⑨ Incubate at 13000 rpm for 2 minutes at room temperature.
[0138] ⑩ Transfer the centrifuge column to a new 1.5 mL EP tube, add 50 μL of Elution Buffer, let stand at room temperature for 1 min, and then centrifuge at 13000 rpm for 1 min;
[0139] The filtrate was loaded onto the column again and centrifuged at 13,000 rpm at room temperature for 1 min to obtain standard recombinant plasmids. The concentrations measured by Nanodrop were as follows: gB gene standard recombinant plasmid concentration was 423.4 ng / μL, gE gene standard recombinant plasmid concentration was 219 ng / μL, and TK gene standard recombinant plasmid concentration was 325.4 ng / μL.
[0140] Example 2, crRNA Design
[0141] Multiple porcine pseudorabies gB, gE, and TK sequences were downloaded from NCBI and compared using MEGA-X software. Conserved and specific detection sites were designed on the porcine pseudorabies gB gene, such as... Figure 2 As shown, specific crRNAs were designed based on the target sequence; the common deleted sequences of gE / TK deletion vaccine strains used in China were statistically analyzed, and detection sites were designed at their specific and conserved positions, and specific gE / TK crRNAs were designed based on the detection sites.
[0142] In the design process of crRNA, this invention fully considers the following issues:
[0143] 1) When Cas12a functions, it requires crRNA to guide the Cas12a protein to recognize and bind to double-stranded DNA with a PAM sequence;
[0144] 2) The PAM sequence recognized by LbCas12a is TTTN. Therefore, to design a transcription template for crRNA, it is necessary to find the sites containing TTTN in the gB, gE and TK genes, select the 20 bases following TTTN, add the Cas12a backbone sequence and T7 promoter sequence, and use them as the positive strand of the crRNA transcription template for crRNA design.
[0145] 3) Since there is no detectable sequence containing TTTN that meets the detection requirements on the TK gene sequence, this invention designs a pair of primers that can be specifically amplified on the TK gene, and inserts a T base after a position with a "TT" sequence on the front primer, and then takes the last 20 bases of the "TTTN" sequence for crRNA design.
[0146] The crRNA sequence is as follows:
[0147] gB-crRNA-5'-UAAUUUCUACUAAGUGUAGAUUGCGCACGCCCGCACUUCACG-3',
[0148] gE-crRNA-5'-UAAUUUCUACUAAGUGUAGAUUCCGGAUCGCGGAACCAGAC-3', TK-crRNA-5'-UAAUUUCUACUAAGUGUAGAUGGCGCGUACAAGGCGCCCGA-3';
[0149] The specific implementation method for in vitro transcription and purification of crRNA is as follows:
[0150] ① The positive and negative strands are annealed to synthesize double-stranded DNA, which is then used as a template for transcription to synthesize crRNA;
[0151] ② Take 4 μL of the positive and negative strands into the same 200 μL microcentrifuge tube, mix thoroughly, and then synthesize double strands through an annealing program to serve as a template for in vitro transcription and synthesis of crRNA;
[0152] ③ Perform in vitro transcription of crRNA according to the instructions accompanying the Novizan T7 in vitro transcription kit. The specific system is as follows: Take 2 μL of T7 RNA Polymerase Mix, 1 μL of 10× Reaction buffer, 2 μL each of ATP Solution, ATP Solution, ATP Solution, and ATP Solution, and 8 μL of double-stranded DNA template into an EP tube free of DNase / RNase, mix gently, and then incubate at 37℃ for 16 h to complete in vitro transcription.
[0153] ④ Purify crRNA according to the NEB Monarch RNA Cleanup Kit instructions. The specific implementation system is as follows: Add DEPC water to 50 μL of the above reaction product, then add 1 μL of TURBO DNase, mix gently, and react at 37℃ for 30 min. The purpose of this step is to digest the residual DNA template in the transcription system.
[0154] ⑤ Transfer the above product to a 1.5 μL DNase / RNase-free EP tube and add 100 μL binding buffer;
[0155] ⑥ Add 150 μL of anhydrous ethanol and mix by inverting.
[0156] ⑦ Load onto the column, centrifuge at 13000 rpm for 1 min at room temperature, and discard the filtrate;
[0157] ⑧ Add 500 μL RNA Cleanup Wash buffer, centrifuge at 13000 rpm for 1 min at room temperature, and discard the filtrate;
[0158] ⑨ Repeat step ⑧ of the washing process;
[0159] ⑩ Transfer the centrifuge column to a new EP tube; add 20 μL of DEPC water, centrifuge at 13000 rpm at room temperature for 1 min, collect the filtrate, and you will get the purified RNA product - crRNA.
[0160] The concentrations of the purified products were determined using Nanodrop, and the concentrations obtained were: gB crRNA concentration 499.71 ng / μL, gE crRNA concentration 429.59 ng / μL, and TK crRNA concentration 328.84 ng / μL.
[0161] Example 3: Primer Design
[0162] Based on the alignment results of MEGA-X software, highly conserved fragments of the gB, gE, and TK genes were identified. Primers for amplifying the full length of the gB, gE, and TK genes were designed using Primer5, as well as isothermal amplification primers containing the target sequence of the detection site, which were then synthesized by a biotechnology company.
[0163] The isothermal amplification primer sequence specified in this invention is as follows:
[0164] MIRA-gB-F-5-'CGTGTACATGTCCCCCTTCTAC-3',
[0165] MIRA-gB-R-5'-GGATCATCTCCTCGGCCT-3',
[0166] MIRA-gE-F-5'-CACATGCTCTCTCCGGTGT-3',
[0167] MIRA-gE-R-5'-TCGTCACTTCCGGTTTCTCC-3':
[0168] MIRA-TK-F-5'-AGCTCCAGGACACCCTCTTTCGG-3',
[0169] MIRA-TK-R-5'-ACACGCACTGCCGGATGTGG-3';
[0170] The FAM-BHQ1 single-stranded DNA probe is 5'-FAM-TTATT-BHQ1-3'.
[0171] This invention inserts a PAM sequence into the product by introducing a T base in the pre-primer, thereby enabling Cas12a to be detected at any location without a PAM sequence.
[0172] Example 4: Optimization of the MIRA-Cas12a detection reaction system
[0173] The optimized process for the MIRA-Cas12a reaction system of this invention is as follows:
[0174] With 2.8×10 7The gB recombinant plasmid at a concentration of copies / μL was used as a template. Experiments were conducted with crRNA (pmol) / Cas12a (pmol) ratios of 1:1, 1.2:1, 1.4:1, 1.6:1, 1.8:1, and 2:1, respectively. The reaction system was 10 μL, containing 100 nM Cas12a protein, 100 nM, 120 nM, 140 nM, 160 nM, 180 nM, and 200 nM crRNA, 1 μM FAM-BHQ1 single-stranded DNA probe, 1×2.1 NE Buffer, 1 μL of recombinant plasmid template, and DEPC water to a final volume of 10 μL. The reaction temperature was 37℃, and the reaction time was 15 min. The final fluorescence value was measured using a fluorescence quantitative PCR instrument. Optimized results are shown below. Figure 3 As shown, the final optimized Cas12a protein / crRNA ratio was 1:1.4.
[0175] 1×2.1NE Buffer is available from New England Biolabs.
[0176] Cas12a protein is available from Guangzhou Bolais Biotechnology Co., Ltd.
[0177] Example 5
[0178] The detection principle and process of MIRA-CRISPR / Cas12a disclosed in this invention are as follows:
[0179] The MIRA-Cas12a detection process consists of three steps:
[0180] Step 1: Extract the viral genome from the pathogen sample;
[0181] Step 2: The extracted viral genome is amplified using isothermal amplification technology;
[0182] Step 3: Use the amplified product for Cas12a detection.
[0183] The principle of MIRA-Cas12a detection is as follows: Viral genome extracted from the sample is pre-amplified using MIRA isothermal amplification technology. Cas12a protein and crRNA bind to each other at 37℃ to form a crRNA / Cas12a protein complex. Subsequently, crRNA recognizes the target double-stranded DNA through base complementarity pairing, and the three bind to form a crRNA / Cas12a / target DNA ternary complex. After the complex is formed, the trans-cleavage activity of the Cas12a protein is activated, indiscriminately cleaving single-stranded DNA in the system. When a single-stranded DNA probe with a FAM fluorescent group at one end and a fluorescence quencher group at the other end is cleaved, the FAM group emits visible green fluorescence under 470nm LED blue light excitation. If the detection system exhibits luminescence after the reaction, the target detection result is positive; otherwise, it is negative.
[0184] Step one specifically involves: using the EasyBlood / Tissue Genomics Rapid Extraction Kit, extracting nucleic acids from the tissue according to the kit's instructions.
[0185] ① Take 2-25 mg of diseased tissue, add 20 μL of proteinase K and 200 μL of Buffer G1 provided with the kit, mix thoroughly, incubate at 56℃ for 10 min, then add 200 μL of Buffer G2 and mix well;
[0186] ② Transfer the incubated product to the matching centrifuge column, centrifuge at 12000 rpm for 30 s at room temperature, and discard the filtrate;
[0187] ③ Add 500 μL of Buffer G3 to the centrifuge column for rinsing, centrifuge at 1200 rpm at room temperature for 30 s, and discard the filtrate;
[0188] ④ Repeat rinsing step ③ once, then discard the filtrate;
[0189] ⑤ Place the adsorption column back into the centrifuge tube and centrifuge at 12,000 rpm for 1 min at room temperature;
[0190] ⑥ Place the adsorption column into a new sterile collection tube, add 50 μL of deionized water, and let it stand at room temperature for 1 min;
[0191] ⑦ Centrifuge at 1200 rpm at room temperature for 1 min, collect the filtrate, which is the final extraction product.
[0192] Step two is as follows:
[0193] After genome extraction, the target fragment was amplified using the MIRA kit to improve detection sensitivity. The specific procedure was as follows: One lyophilized powder tube from the MIRA kit was removed, and 29.4 μL of the accompanying A buffer, 2 μL each of the three isothermal amplification primers (MIRA-gB-F / MIRA-gB-R, MIRA-gE-F / MIRA-gE-R, and MIRA-TK-F / MIRA-TK-R, all at 10 μM), 12.1 μL of DEPC water, 2 μL of the genome obtained in step one, and 2.5 μL of B buffer were added. The reaction was carried out at 37°C for 20 minutes, and then stopped on ice.
[0194] Step three specifically involves:
[0195] In the Cas12a detection stage, 1 pmol of Cas12a protein was first placed in three test tubes along with 1.4 pmol of three different crRNAs and incubated at 37°C for 3-5 minutes.
[0196] Next, add the following to each of the three test tubes: 1 μL of the probe (FAM-BHQ1 single-stranded DNA probe, concentration 10 μM), 2 μL of the MIRA isothermal amplification product obtained in step two, 1×NEB 2.1 buffer, and finally add DEPC water to a final volume of 10 μL. Mix well and incubate at 37°C for 15 min. Then, place the three test tubes in a 470 nm blue light gel cutter to observe the fluorescence. Figure 1 As shown, five possible test results are predicted:
[0197] ① If all three tubes show fluorescence, it indicates that the sample tested was infected with a wild-type virus strain;
[0198] ②If the gB tube emits fluorescence while the other two tubes do not, it indicates that the sample being tested is a vaccine strain with double gene deletion of gE and TK.
[0199] ③ If the gE tube does not emit fluorescence, it indicates that the sample being tested is a gE-deficient vaccine strain;
[0200] ④ If a TK tube does not emit fluorescence, it indicates that the sample being tested is a TK-deficient vaccine strain;
[0201] ⑤ If no fluorescence is detected in any of the three test tubes, the test result is negative, meaning that the sample was neither vaccinated nor infected with the wild-type PRV strain.
[0202] Example 6, Sensitivity Experiment:
[0203] 2.8×10 4 The gB standard recombinant plasmid at a concentration of copies / μL was serially diluted 10-fold to a concentration of 2.8 × 10⁻⁶. 0 Copies / μL, 2.8 × 10 1 Copies / μL, 2.8 × 102 Copies / μL, 2.8 × 10 3 Copies / μL, 2.8 × 10 4 Copy / μL;
[0204] 6.6×10 4 The gE standard recombinant plasmid at a concentration of copies / μL was serially diluted 10-fold to a concentration of 6.6 × 10⁻⁶. 0 Copies / μL, 6.6 × 10 1 Copies / μL, 6.6 × 10 2 Copies / μL, 6.6 × 10 3 Copies / μL, 6.6 × 10 4 Copy / μL;
[0205] 6.3×10 4 The TK standard recombinant plasmid at a concentration of copies / μL was serially diluted 10-fold to a concentration of 6.3 × 10⁻⁶. 0 6.3 × 10⁻⁶ copies / μL 1 6.3 × 10⁻⁶ copies / μL 2 6.3 × 10⁻⁶ copies / μL 3 6.3 × 10⁻⁶ copies / μL 4 Copy / μL;
[0206] DEPC water was used as a negative control in all cases.
[0207] The diluted gB standard plasmid, gE standard recombinant plasmid, and TK standard plasmid were used to replace the viral nucleic acid in step two of Example 5. The rest of the steps were the same as steps two and three of Example 5. The results are as follows: Figure 4 As shown, it is:
[0208] When the concentration of the gB standard plasmid is as low as 28 copies, the detection result is negative. Therefore, the minimum detectable concentration of the gB standard recombinant plasmid is 28 copies.
[0209] When the concentration of the gE standard recombinant plasmid is as low as 66 copies, the detection result is negative. Therefore, the minimum detectable concentration of the gE standard recombinant plasmid is 66 copies.
[0210] When the concentration of the TK standard plasmid is as low as 63 copies, the detection result is negative. Therefore, the minimum detectable concentration of the TK standard recombinant plasmid is 63 copies.
[0211] Example 7: Specificity tests and clinical sample detection:
[0212] Specificity testing was performed using PRRSV, CFV, PEDV, and TGEV; clinical samples were tested using two wild-type PRV strains (DF and Ea strains), three vaccine strains (Bartha-k61, C, and HB98 strains), and three clinical samples (infected with XT and Ea strains, respectively), with DEPC water as a negative control.
[0213] Specifically:
[0214] ① In accordance with Example 5, the genomes of PRRSV, CFV, PEDV and TGEV live vaccines, two PRV wild-type strains (DF strain and Ea strain), three porcine pseudorabies gene-deleted vaccine strains (Bartha-k61 strain, C strain, HB98 strain), and three clinical samples (sample 1 infected with XT strain, sample 2 infected with Ea strain, and sample 3 not infected with any virus) were extracted and kept for later use.
[0215] ② The genome obtained in ① was detected according to the methods in steps two and three of Example 5.
[0216] The results are as follows Figure 5 As shown, specifically:
[0217] 1) No fluorescence was produced in any of the three reaction tubes when detecting PRRSV, CFV, PEDV and TGEV;
[0218] 2) When detecting PRV strains Ea and DF, all three reaction tubes showed positive reactions, that is, visible fluorescence was produced.
[0219] 3) When detecting PRV vaccine strains Bartha-k61 and C, the gB and TK reaction tubes produced visible fluorescence, while the gE tube did not produce fluorescence.
[0220] 4) When detecting the PRV vaccine strain HB98, the gB and gE reaction tubes produced visible fluorescence, while the TK tube did not produce fluorescence.
[0221] The above detection results are completely consistent with the prediction results in step three of Example 5. Therefore, the method of the present invention can accurately detect and identify porcine pseudorabies wild-type virus strains and gene-deleted vaccine strains.
[0222] Finally, it should be noted that the above examples are merely some specific embodiments of the present invention. Obviously, the present invention is not limited to the above embodiments and many variations are possible. All variations that can be directly derived or conceived by those skilled in the art from the disclosure of the present invention should be considered within the scope of protection of the present invention.
Claims
1. Visualization of porcine pseudorabies wild-type virus and gE based on CRISPR / Cas12a - / TK - crRNA for identifying gene-deleted vaccine strains is characterized by for: gB-crRNA-5'-UAAUUUCUACUAAGUGUAGAUUGCGCACGCCCGCACUUCACG-3', gE-crRNA-5'-UAAUUUCUACUAAGUGUAGAUUCCGGAUCGCGGAACCAGAC-3', TK-crRNA-5'-UAAUUUCUACUAAGUGUAGAUGGCGCGUACAAGGCGCCCGA-3'.
2. A visualization method for porcine pseudorabies wild-type virus strains and gE based on CRISPR / Cas12a. - / TK - A method for identifying gene-deleted vaccine strains for non-disease diagnostic purposes, characterized in that... Includes the following steps: Step 1: Extraction of viral genome: PRV was extracted from the sample according to the instructions of the EasyBlood / Tissue Genome Extraction Kit. Step 2: Using isothermal amplification primers, the extracted viral genome is amplified using isothermal amplification technology; The isothermal amplification primers are: MIRA-gB-F-5'-CGTGTACATGTCCCCCTTCTAC-3', MIRA-gB-R-5'-GGATCATCTCCTCGGCCT-3', MIRA-gE-F-5'- CACATGCTCTCTCCGGTGT-3', MIRA-gE-R-5'-TCGTCACTTCCGGTTTCTCC-3': MIRA-TK-F-5'-AGTCCAGGACACCCTCTTTCGG-3', MIRA-TK-R-5'- ACACGCACTGCCGGATGTGG -3'; The FAM-BHQ1 single-stranded DNA probe is 5'-FAM-TTATT-BHQ1-3'; Step 3: Use the amplified product for Cas12a detection: In step three: The Cas12a visualization assay consists of 10 μL of the following components: Cas12a protein 50-100 nM, crRNA 70-140 nM, single-stranded DNA probe 1 μL, MIRA amplification product 2 μL, 1×NEB 2.1 buffer, and DEPC water added to 10 μL. The mixture is incubated at 37°C for 15 minutes and the fluorescence is observed under a 470 nm blue light gel cutter. crRNA as described in claim 1.
3. The method according to claim 2, characterized in that: Viral genomes extracted from samples were pre-amplified using MIRA isothermal amplification technology to target genes. Cas12a protein and crRNA bind to each other at 37°C to form a crRNA / Cas12a protein complex. Subsequently, crRNA recognizes the target double-stranded DNA through base complementarity pairing, and the three combine to form a crRNA / Cas12a / target DNA ternary complex. After the complex is formed, the trans-cleavage activity of Cas12a protein is activated, and it begins to indiscriminately cleave single-stranded DNA in the system. When a single-stranded DNA probe with a FAM fluorescent group at one end and a fluorescence quencher group at the other end is cleaved, the FAM group emits visible green fluorescence under 470nm LED blue light excitation. If the detection system shows luminescence after the reaction, the target detection result is positive; otherwise, it is negative.
4. The method according to claim 2 or 3, characterized in that: In step two: The MIRA isothermal amplification system consisted of 29.4 μL of buffer A, 2 μL each of MIRA-gB-F, MIRA-gB-R, MIRA-gE-F, MIRA-gE-R, MIRA-TK-F and MIRA-TK-R, 2 μL of DNA template, 12.1 μL of DEPC water, and 2.5 μL of buffer B; the reaction was carried out at 37°C for 20 minutes.
5. The method according to claim 4, characterized in that: Step three is: In the Cas12a detection stage, the test sample and three types of crRNA were first placed in three test tubes and incubated at 37°C for 3-5 minutes; the molar ratio of crRNA to test sample was 1:1 to 2:
1. Next, add 1 μL of FAM-BHQ1 single-stranded DNA probe, 2 μL of the MIRA isothermal amplification product obtained in step two, and 1×NEB 2.1 buffer to each of the three test tubes. Finally, add DEPC water to a final volume of 10 μL and mix well. Incubate at 37°C for 15 min. Then, place the three test tubes under a 470nm blue light gel cutter to observe the fluorescence. Finally, make a preliminary judgment according to the following rules: ① If all three tubes show fluorescence, it indicates that the sample being tested is infected with a wild-type virus strain; ②If the gB tube emits fluorescence while the other two tubes do not, it indicates that the sample to be tested is a vaccine strain with double gene deletion of gE and TK. ③ If the gE tube does not emit fluorescence, it indicates that the sample to be tested is a gE-deficient vaccine strain; ④ If a TK tube does not emit fluorescence, it indicates that the sample to be tested is a TK-deleted vaccine strain; ⑤ If no fluorescence is detected in any of the three test tubes, the test result is negative.
Citation Information
Patent Citations
Porcine pseudorabies virus gene deletion strain, vaccine composition, and preparation method therefor and application thereof
WO2016026264A1