Transgenic animals with a modified myostatin gene

Abstract

This application relates to animals or cells possessing a myostatin gene, wherein 12 base pairs of the second exon of the myostatin gene are deleted. This application may also include compositions capable of manipulating the deletion of 12 base pairs of the myostatin gene to construct animals or cells. This application also relates to the use of this composition for increasing muscle mass.

Description

Technical Field

[0001] This application relates to transgenic animals or cells having artificially modified genes. The transgenic animals or cells possess a myostatin gene with a 12-base-pair deletion in the second exon.

[0002] This application relates to technologies associated with the production of transgenic animals or cells. Background Technology

[0003] The Belgian Blue is renowned as a superior breed of cattle with well-developed muscles. This breed was accidentally created in the 19th century by Belgian breeders through crossbreeding. Although they consume less feed compared to wild-type cattle, they are characterized by highly proliferating muscle cells due to genetic reasons, resulting in low fat and high protein content. These traits have been reportedly caused by modifications to the myostatin gene (McPherron AC, Lawler AM, Lee SJ (1997) Nature 387:83-90).

[0004] Myostatin, as its name suggests, combines "myo" with "statin," and as research continues, it has become known that the myostatin protein inhibits muscle differentiation and growth. In various animal models, myostatin has been studied to use gene-editing tools to control muscle cell differentiation and growth through gene regulation.

[0005] Furthermore, in the case of transgenic large animals containing myostatin, high-quality meat can be obtained, thereby improving utilization. However, the deletion of the myostatin gene still has technical limitations and several side effects, such as enlarged heart, increased blood pressure, and shortened lifespan.

[0006] Due to the aforementioned technical limitations, myostatin transgenic animals cannot yet be used for industrial purposes.

[0007] Therefore, the applicant sought to obtain healthy transgenic animals with increased muscle mass and myostatin. This disclosure was thus completed by confirming that the transgenic bovine animals of this application possess a specific variant in which myostatin is modified, and are transgenic animals without conventional side effects.

[0008] Related technical documents

[0009] Patent documents

[0010] (Patent Document 1) CN 104531705A

[0011] (Patent Document 2) CN 107034221A

[0012] Non-patent literature

[0013] (Non-patent literature 1) Am J Physiol Endocrinol Metab. 2017 Mar 1; 312(3):E150-E160, Myostatin propeptide mutation of the hyper muscular compact mice decreases the formation of myostatin and improves insulin sensitivity. Summary of the Invention

[0014] Technical issues

[0015] One object of this application is to provide an animal having an artificially modified myostatin gene, wherein 12 base pairs of the second exon of the myostatin gene are deleted.

[0016] Another objective of this application is to provide an embryo with an artificially modified myostatin gene, wherein 12 base pairs of the second exon of the myostatin gene are missing.

[0017] Another object of this application is to provide a composition for deleting 12 base pairs in the second exon of the myostatin gene.

[0018] Another object of this application is to provide the use of the composition to induce muscle growth in animal muscles.

[0019] Technical solution

[0020] To address the aforementioned issues, this application provides a transgenic animal possessing a specific portion of an artificially modified myostatin gene.

[0021] This modification may occur in the second exon of the myostatin gene.

[0022] Compared to the myostatin gene sequence in wild-type animals, the above modification is a deletion of 12 base pairs in the second exon, corresponding to the region encoding the amino acid sequences of leucine, tryptophan, isoleucine, and tyrosine.

[0023] Nucleic acids encoding the amino acid sequence leucine, tryptophan, isoleucine, and tyrosine may have one or more sequences encoding each amino acid.

[0024] In other words, the sequence encoding leucine can be selected from one of 5'-CTT-3', 5'-CTC-3', 5'-CTA-3', or 5'-CTG-3', the sequence encoding tryptophan can be selected from one of 5'-TGG-3', the sequence encoding isoleucine can be selected from one of 5'-ATT-3', 5'-ATC-3', or 5'-ATA-3', and the sequence encoding tyrosine can be selected from one of 5'-TAT-3' or 5'-TAC-3'.

[0025] The expression level of myostatin mRNA in transgenic animals was lower than that in wild-type animals.

[0026] In addition, transgenic animals can express mature myostatin protein with the same amino acid sequence as wild-type animals.

[0027] Compared to wild-type animals, genetically modified animals may have an increase in apparent muscle mass.

[0028] Genetically modified animals include mammals.

[0029] Mammals include ungulates.

[0030] Hoofed animals include even-toed ungulates. Even-toed ungulates can include, but are not limited to, pigs, deer, cattle, sheep, and goats.

[0031] Mammals can include rodents. Rodents can include mice and rats, but are not limited to these.

[0032] Preferably, the transgenic animal in this application is a bovine animal. The bovine animal expresses pro-myostatin protein containing the amino acid sequence represented by SEQ ID NO: 30.

[0033] In addition, this application provides engineered cells having an artificially modified myostatin gene, wherein the myostatin gene has a modified specific portion.

[0034] The transformation of engineered cells can occur in the second exon of the myostatin gene.

[0035] Compared to the myostatin gene sequence in wild-type cells, the above modification is a deletion of 12 base pairs in the second exon, corresponding to the region encoding the amino acid sequences of leucine, tryptophan, isoleucine, and tyrosine.

[0036] Nucleic acids encoding the amino acid sequence leucine, tryptophan, isoleucine, and tyrosine can have one or more sequences encoding each amino acid.

[0037] In other words, the sequence encoding leucine can be one of 5'-CTT-3', 5'-CTC-3', 5'-CTA-3', or 5'-CTG-3', the sequence encoding tryptophan can be one of 5'-TGG-3', the sequence encoding isoleucine can be one of 5'-ATT-3', 5'-ATC-3', or 5'-ATA-3', and the sequence encoding tyrosine can be one of 5'-TAT-3' or 5'-TAC-3'.

[0038] Compared to wild-type cells, engineered cells express less myostatin mRNA.

[0039] In addition, engineered cells can express mature myostatin protein with the same amino acid sequence as wild-type animals.

[0040] The cells can be embryonic cells, somatic cells, or stem cells.

[0041] Cells include, but are not limited to, oocytes, epithelial cells, fibroblasts, nerve cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, macrophages, monocytes, muscle cells, B lymphocytes, T lymphocytes, embryonic stem cells, embryonic germ cells, fetal-derived cells, placental cells, and embryonic cells. Additionally, adult stem cells derived from various tissues may be used, such as stem cells derived from fat, uterus, bone marrow, muscle, placenta, umbilical cord blood, or skin (epithelial tissue). Non-human host embryos may typically be embryos at the 2-cell, 4-cell, 8-cell, 16-cell, 32-cell, 64-cell stages, aborted embryos, or blastocysts.

[0042] The cells can be obtained from mammals.

[0043] Preferably, the cells used in this application can be obtained from bovine animals.

[0044] Engineered cells can express promyosin protein having the amino acid sequence represented by SEQ ID NO: 30.

[0045] This application provides compositions for modifying the myostatin gene.

[0046] To modify the myostatin gene, the composition may contain:

[0047] Guide RNA or DNA encoding the guide RNA, the guide RNA comprising a guide sequence complementary to the target sequence;

[0048] And the Cas protein or the nucleic acid sequence encoding the Cas protein.

[0049] The target sequence may include one or more selected from SEQ ID NO: 38 to SEQ ID NO: 60.

[0050] The guide sequence may include one or more selected from SEQ ID NO: 624 to SEQ ID NO: 84.

[0051] The Cas protein can be selected from one of the following groups: Cas9 protein from *Streptococcus pyogenes*, Cas9 protein from *Staphylococcus aureus*, or Cas 12a protein (formerly known as CPF1: *Prevotella* and *Francisella* 1). The nucleic acid encoding the Cas protein can be selected from any of the following groups: Cas9 protein encoding *Streptococcus pyogenes*, Cas9 protein from *Staphylococcus aureus*, or nucleic acid encoding Cas 12a protein (formerly known as CPF1: *Prevotella* and *Francisella* 1).

[0052] The composition can exist in a plasmid vector in the form of DNA encoding guide RNA and Cas protein.

[0053] The composition can exist in a viral vector in the form of DNA encoding guide RNA and Cas protein.

[0054] At this time, the viral vector may be selected from one or more of the following groups: retroviral vector, lentiviral vector, adenovirus vector, adeno-associated virus (AAV) vector, vaccinia virus vector, poxvirus vector and herpes simplex virus vector.

[0055] Gene manipulation compositions can be in the form of a complex (RNP: ribonucleoprotein) containing guide RNA and Cas protein.

[0056] In addition, this application provides a method for preparing cells or embryos having an artificially modified myostatin gene modified with the above-described composition.

[0057] The method for producing myostatin-engineered cells or embryos as described in this application

[0058] This may include contacting cells or embryos with the composition. The contact step may be performed in vivo or in vitro.

[0059] The contact step can be performed by one or more methods selected from the following: autoinjection, electroporation, liposomes, plasmids, viral vectors, nanoparticles, and protein translocation domain (PTD) fusion protein methods.

[0060] In addition, this application provides a method for preparing animals with an artificially modified myostatin gene.

[0061] The method disclosed herein for producing myostatin transgenic animals may include the following steps: producing transgenic embryos having artificially modified genes by contacting embryos with the composition described above, and transferring the transgenic embryos to a mother.

[0062] Animals produced using the above methods express less myostatin mRNA than wild-type animals.

[0063] Animals can be mammals other than humans.

[0064] Beneficial effects

[0065] Due to the low expression level of myostatin mRNA, the myostatin transgenic animals of this application can increase muscle mass compared with wild-type animals.

[0066] Therefore, it is possible to provide high-quality meat with low fat and high protein content.

[0067] Conventional transgenic animals with myostatin mutations have various side effects (such as short lifespan), but this application can provide healthy transgenic animals with myostatin mutations without such various side effects.

[0068] Furthermore, the composition provided in this application is capable of modifying the myostatin gene and may increase muscle mass when injected into animal tissues. Attached Figure Description

[0069] Figure 1 A diagram showing the location of modifications in the myostatin gene is provided, and the original spacer sequence used in one example of this disclosure is listed.

[0070] Figure 2 This is a schematic diagram of a method for producing transgenic embryos with an artificially modified myostatin gene, wherein 12 base pairs of the second exon of the myostatin gene are deleted.

[0071] Figure 3 The modification of myostatin in an engineered embryo, confirmed by T7E1 assay, is shown. The engineered embryo has a myostatin gene in which 12 base pairs are missing in the second exon.

[0072] Figure 4The original spacer sequence of the myostatin gene is shown, and Sanger sequencing of myostatin-engineered embryos with guide RNA containing a sequence that binds to its complementary target sequence reveals multiple variants.

[0073] Figure 5 Different amounts of Cas9 mRNA or guide RNA are shown for driving the deletion of 12 base pairs in the second exon of the myostatin gene to determine the most suitable guide RNA and the amount of Cas9 mRNA for this application.

[0074] Figure 6 The image shows a cow with a deletion of the myostatin gene in the second exon, which was photographed monthly for appearance inspection from one to four months after birth.

[0075] Figure 7 The modification of myostatin in cattle, confirmed by T7E1 assay, is shown. The cattle have a myostatin gene in which 12 base pairs are missing in the second exon.

[0076] Figure 8 Five sequences related to potential off-target sites, identified by T7E1 assay, are shown to confirm off-target effects that can be generated by CRISPR / Cas9. With or without wild-type DNA contamination, it was confirmed that neither hetero-knockout nor homo-knockout occurred at any of the five off-target sites.

[0077] Figure 9 It shows that it will be passed Figure 2 Deep sequencing results from 17 cows born after embryos produced by this method were implanted into the mother's uterus confirmed the deletion of 12 base pairs in the myostatin gene.

[0078] Figure 10 The deep sequencing results of wild-type cattle are listed, serving as a negative control for cattle with a 12-base-pair deletion of the myostatin gene in the second exon.

[0079] Figure 11 The deep sequencing results of cow number 6 are listed, which has a myostatin gene with a 12-base-pair deletion in the second exon.

[0080] Figure 12 The deep sequencing results of cow number 14 are listed, which has a myostatin gene with a 12-base-pair deletion in the second exon.

[0081] Figure 13The deep sequencing results of cow number 17 are listed, which has a myostatin gene with a 12-base-pair deletion in the second exon.

[0082] Figure 14 The expression levels of myostatin mRNA in cattle 14 and 17 are shown. These cattle have a myostatin gene with a 12-base-pair deletion in the second exon.

[0083] Figure 15 This image shows the validation of germline transmission in MSTN-mutant females, the generation of MSTN-mutant blastocysts derived from MSTN-mutant bovine oocytes, and a representative photograph of pregnancy diagnosis performed by ultrasound on day 30.

[0084] Figure 16 These are somatic cell images derived from follicular fluid obtained during OPU.

[0085] Figure 17 The results of T7E1 assays and sequencing data from blastocysts of MSTN mutant females are shown.

[0086] Figure 18 The results of T7E1 assays and sequencing data from somatic cells derived from follicular fluid are shown.

[0087] Figure 19 This paper presents a summary of semen analysis from the male founder of MSTN using computer-aided semen analysis.

[0088] Figure 20 A photograph of a representative blastocyst is shown as a validation result of germline transmission from an MSTN mutant bull.

[0089] Figure 21 The mutation rate of the MSTN gene in blastocysts derived from MSTN-mutant bull semen obtained through in vitro fertilization is shown. Detailed Implementation

[0090] Implementation of the invention

[0091] To describe the content disclosed herein, several terms will be defined. In addition to these terms, other terms are defined elsewhere in this application where necessary. Unless otherwise expressly defined herein, industry terms used herein shall have their generally accepted meanings in their respective fields. In case of conflict, the definitions herein shall prevail.

[0092] Definition of general terms

[0093] Conserved region of the myostatin gene

[0094] The conserved region of the myostatin gene refers to the unmodified common reserved region of the amino acid sequence encoding myostatin that has been passed across species during evolution.

[0095] In this application, the term "conserved region of the myostatin gene according to species" includes the nucleic acid sequence encoding amino acids in the order of leucine, tryptophan, isoleucine and tyrosine in the conserved region of myostatin (see Table 3).

[0096] While the conserved regions of myostatin may share the same amino acid sequence across species, several codons corresponding to the amino acid sequence may exist, depending on the species. That is, the nucleic acid sequence encoding leucine can be one of 5'-CTT-3', 5'-CTC-3', 5'-CTA-3', or 5'-CTG-3'; the nucleic acid sequence encoding tryptophan can be one of 5'-TGG-3'; the nucleic acid sequence encoding isoleucine can be one of 5'-ATT-3', 5'-ATC-3', or 5'-ATA-3'; and the nucleic acid sequence encoding tyrosine can be one of 5'-TAT-3' or 5'-TAC-3'.

[0097] Therefore, the nucleic acid sequence of the "conserved region of the myostatin gene according to species" in this application may differ for each species. In this application, the "conserved region of the myostatin gene" is sometimes abbreviated as "conserved region".

[0098] Genetically modified animals

[0099] In this application, the term "transgenic animal" means an animal that possesses an artificially modified myostatin gene.

[0100] In this application, the "transgenic animal" has an artificially modified myostatin gene with 12 base pairs missing in the second exon and expresses a mature myostatin protein with the same sequence as that of the wild-type animal.

[0101] The trait of the artificially modified myostatin gene in the transgenic animals of this application is inherited by offspring.

[0102] The F0 generation, as the first-generation animal, possesses an artificially modified myostatin gene. F0 can produce F1 progeny. The myostatin gene contained in F1 and its sub-F1 progeny has the same nucleotide sequence as the artificially modified myostatin gene. The term "transgenic animal" in this application includes F0, F1, and its sub-F1 progeny. In other words, when an animal F1 possesses the modified myostatin gene, it is considered a transgenic animal under this application, even if no direct artificial manipulation for transformation is applied during or after the production of F1.

[0103] animal

[0104] The animals in this application include non-human animals.

[0105] Animals include mammals.

[0106] Mammals include ungulates.

[0107] Hoofed animals include even-toed ungulates. Even-toed ungulates can include, but are not limited to, pigs, deer, cattle, sheep, and goats.

[0108] Mammals can include rodents. Rodents can include mice and rats, but are not limited to these.

[0109] target area

[0110] The term "target region" in this application means a region in which genes will be artificially manipulated to produce the wild-type genome of a transgenic animal, and includes, as shown below, a region containing the protospacer sequence and the target sequence.

[0111] Protospacer sequence

[0112] The term "protospacer sequence" in this application refers to the 20 sequences adjacent to the PAM sequence in the target region of this application. The protospacer sequence and the target sequence are complementary sequences. That is, this means that the guide sequence that binds complementary to the target sequence is the same sequence. However, the guide sequence may have a sequence in which T (thymine) is replaced by U (uracil) in the protospacer sequence.

[0113] target sequence

[0114] The term "target sequence" in this application refers to a sequence contained within the target region of this application, and is a sequence that binds complementary to the original spacer sequence. The target sequence may bind complementary to the guide sequence.

[0115] The meanings of A, T, C, G, and U

[0116] As used herein, the symbols A, T, C, G, and U are interpreted in the manner understood by one of ordinary skill in the art. Depending on the context and the art, each of these symbols may be appropriately interpreted as a base, nucleoside, or nucleotide on DNA or RNA. For example, when the symbols refer to a base, A, T, C, G, and U may be interpreted as adenine (A), thymine (T), cytosine (C), guanine (G), or uracil (U), respectively. When the symbols refer to a nucleoside, A, T, C, G, and U may be interpreted as adenosine (A), thymine (T), cytosine (C), guanine (G), or uridine (U), respectively. When representing nucleotides in a sequence, the symbols A, T, C, G, and U represent nucleotides containing nucleosides.

[0117] This application is described in detail below.

[0118] This application relates to transgenic animals having an artificially modified myostatin gene, wherein 12 base pairs of the second exon of the myostatin gene are deleted.

[0119] Myostatin

[0120] The transgenic animal described in this application is characterized by containing an artificially modified myostatin gene.

[0121] The structure and function of myostatin will be described in detail below.

[0122] Structure of myostatin

[0123] The somatostatin gene in higher organisms known to date is characterized by having three exons and two introns. It is known that the somatostatin gene is primarily found in muscle.

[0124] Myostatin mRNA produces myostatin protein, which consists of approximately 375 amino acids and is divided into three parts: a signal peptide region, a prodomain region (28 kDa, N-terminus), and a maturation region (12 kDa, C-terminus).

[0125] The structure of promyosostatin (precursor protein) consists of two identical subunits, and the mature regions form disulfide bonds with each other, thus maintaining the form of a homodimeric protein.

[0126] Function and signal transduction pathway of myostatin maturation protein

[0127] Regarding the signaling pathway of myostatin, after the precursor myostatin is initially cleaved by furin, it is divided into a propeptide region and a maturation region. Following cleavage, the propeptide region non-covalently binds to the maturation region within the latent complex. Then, upon secretion from the cell after a second cleavage via BMP / Tolloid, the mature myostatin region is phosphorylated by binding to the activin type II receptor. The signal is then relayed to the activin type I receptor and subsequently to the receptor regulatory proteins Smad 2 and Smad 3, which combine with co-Smad 4 to regulate the transcription of target genes. As a result of this signaling pathway, mature myostatin protein is expressed.

[0128] Routine modification of the myostatin gene

[0129] In routine studies related to the myostatin gene, investigations have been conducted to study the non-expression of mature myostatin protein. By inhibiting the expression of mature myostatin protein, studies have been conducted to produce animals that generate significant muscle mass and reduce fat. Furthermore, by investigating the non-expression of mature myostatin protein, research is underway to study the signaling pathway of myostatin, with the aim of applying it to diseases characterized by rapid muscle loss (such as advanced cancer patients) and muscle fiber regeneration.

[0130] In many cases of myostatin transgenic animals, the myostatin gene is modified so that the myostatin protein, which inhibits muscle growth, is expressed in small amounts in somatic cells. In other words, it is a form of inhibiting the expression of mature myostatin protein by modifying the cleavage region in the mature myostatin protein signaling pathway described above. Compared to wild-type animals, animals cloned via somatic cell nuclear transfer have twice the muscle mass.

[0131] However, transgenic animals with myostatin gene modification obtained through the conventional methods described above have short lifespans. Therefore, there are drawbacks, including reproductive problems and potentially fatal health issues, especially in large animals.

[0132] This application relates to transgenic animals that minimize the side effects caused by conventional myostatin gene modification and highlight the advantages of myostatin gene modification.

[0133] Specifically, by targeting a specific region of exon 2 to delete 12 base pairs (which is not a cleavage site of the signaling pathway of mature myostatin protein), the present invention provides animals with repressed expression of mature myostatin protein compared to wild-type animals, rather than no expression.

[0134] Transgenic animals with myostatin

[0135] One aspect of this application is a myostatin transgenic animal possessing an artificially modified myostatin gene. In one embodiment, it may be an ungulate, such as a bovine animal.

[0136] In the following text, this disclosure will be described in detail using a bovine animal (cattle) that has the artificially modified myostatin gene of this application as an example.

[0137] Feature 1 - Genetic modifications to the genome of transgenic animals

[0138] The transgenic animals of this application may have a myostatin genome composition that differs from that of wild-type animals in terms of myostatin genome composition.

[0139] The genetic modification in this application refers to a nucleic acid sequence that lacks a sequence of four amino acids (in the order of leucine, tryptophan, isoleucine, and tyrosine) from a specific conserved region of the amino acid sequence encoding myostatin protein.

[0140] The transgenic animal of this application has a myostatin gene with 12 base pairs missing in the second exon, the 12 base pairs being a nucleic acid sequence encoding the conserved amino acid sequence.

[0141] When the transgenic animal is a bovine, pig, or human, the deletion of 12 base pairs can be the deletion of the 93rd to 104th base pairs in the sequence encoding the second exon of the wild-type myostatin gene (in 5' to 3' order).

[0142] When the transgenic animal is a mouse, the deletion of 12 base pairs can be the deletion of base pairs 94 to 105 of the sequence encoding the second exon of the wild-type myostatin gene.

[0143] Feature 2 - Changes in the expression level and mRNA composition of the myostatin gene in transgenic animals

[0144] The transgenic animals of this application can have a different myostatin mRNA morphology than wild-type animals. The transgenic animals of this application have myostatin mRNA with a 12-base deletion.

[0145] In one embodiment of this application, the expression level of myostatin mRNA in transgenic animals can be measured.

[0146] In one specific embodiment, the expression level of myostatin mRNA in the transgenic animals of this application is at least 60% lower than the expression level of myostatin mRNA in wild-type animals. Preferably, the expression level of myostatin mRNA in the transgenic animals of this application is lower than the expression level in wild-type animals, but this does not mean that the expression is absent.

[0147] Feature 3 - Changes in the protein composition of the myostatin gene and inhibition of mature muscle growth in transgenic animals expression of phytoproteins

[0148] The 12 missing base pairs in the transgenic animal of this application are nucleic acids encoding a conserved amino acid sequence that has remained unchanged in each species during the evolution of the myostatin gene. The conserved amino acid sequence is the sequence of leucine, tryptophan, isoleucine, and tyrosine.

[0149] Therefore, the transgenic animals of this application express myostatin protein, wherein, compared with wild-type tropomyostatin protein, four amino acids in the order of leucine, tryptophan, isoleucine and tyrosine are missing.

[0150] The four amino acid-deficient promyosotherm protein may be one of SEQ ID NO: 30 to SEQ ID NO: 33.

[0151] The promyosothermic protein of transgenic animals may have modifications in some sequences, but may have more than 90% homology with one of SEQ ID NO: 30 to SEQ ID NO: 33.

[0152] For example, when the transgenic animal is a bovine animal (cow), it can express the promyosothermic protein of SEQ ID NO: 30 with four amino acids missing.

[0153] For example, when the transgenic animal is a pig, it can express the promyosothermic protein of SEQ ID NO: 31 with four amino acids missing.

[0154] For example, when the transgenic animal is a mouse, it can express the promyosothermic protein of SEQ ID NO: 32 with four amino acids missing.

[0155] For example, when the transgenic animal is a human, it can express the promyosothermic protein of SEQ ID NO: 33 with four amino acids missing.

[0156] [Table 1]

[0157]

[0158]

[0159] The four amino acids to be deleted do not overlap with the region of promyosotherm protein that is cleaved during the formation of mature myostatin protein.

[0160] Since the region where the cleavage occurs does not contain sites of amino acid deletion, the protomyosin protein becomes mature myostatin protein through normal signal transduction. In other words, the deletion of specific amino acids in this application does not affect the normal formation process of mature myostatin protein.

[0161] Therefore, the mature myostatin protein expressed by the myostatin transgenic animals of this application is identical to the wild-type mature myostatin protein. That is, it is characterized by having the same amino acid sequence as the wild-type mature myostatin protein.

[0162] In one embodiment, the mature myostatin protein of the transgenic animal may be one of SEQ ID NO: 34 to SEQ ID NO: 37.

[0163] The mature myostatin protein of transgenic animals may have modifications in some sequences, but may have more than 90% homology with one of SEQ ID NO: 34 to SEQ ID NO: 37.

[0164] For example, when the transgenic animal is a bovine animal (cattle), it can express the same mature myostatin protein as the mature myostatin protein of wild-type bovine animals, SEQ ID NO: 34.

[0165] For example, when the transgenic animal is a pig, it can express the same mature myostatin protein as SEQ ID NO: 35 of wild-type pigs.

[0166] For example, when the transgenic animal is a mouse, it can express the same mature myostatin protein as the mature myostatin protein of wild-type mice, SEQ ID NO: 36.

[0167] For example, when the transgenic animal is a human, it can express the same mature myostatin protein as wild-type human with SEQ ID NO: 37.

[0168] [Table 2]

[0169]

[0170] Mature myostatin protein can exist in the blood in monomeric or dimeric forms. The transgenic animals of this application can express the same mature myostatin protein as the wild type. That is, the mature myostatin protein of the transgenic animals of this application has the same amino acid sequence as the mature myostatin protein of the wild type animals.

[0171] In one embodiment of this application, the mature myostatin protein of transgenic animals can be compared and identified with wild-type mature myostatin protein by mass spectrometry.

[0172] In one embodiment of this application, the expression level of mature myostatin protein in the transgenic animals of this application may be lower than the expression level in wild-type animals. This result can also be seen from the fact that the expression level of myostatin mRNA in the transgenic animals of this application is reduced compared to the expression level of myostatin mRNA in wild-type animals (see...). Figure 14 ).

[0173] Feature 4 - Increased muscle mass

[0174] Compared to wild-type animals, the transgenic animals disclosed herein exhibit a myopathic phenotype due to reduced expression of myostatin mRNA and mature myostatin protein. The myopathic phenotype refers to phenotypes such as increased muscle mass, increased number of muscle cells, increased muscle cell size, and increased muscle cell differentiation rate.

[0175] In specific embodiments, compared with wild-type animals, the transgenic animals of this disclosure may have an increase in muscle mass of at least 1%, 5%, 10%, 15%, 20%, 25%, 30%, 35% or 40%.

[0176] Feature 5 - No side effects (e.g., shortened lifespan)

[0177] It is known that conventional myostatin transgenic animals are associated with shortened lifespan and health abnormalities.

[0178] Unlike conventional myostatin transgenic animals, the transgenic animals of this application do not lack expression of myostatin mRNA and mature myostatin protein. In other words, compared with wild-type animals that do not lack expression of myostatin mRNA and mature myostatin protein, the expression of myostatin mRNA and mature myostatin protein is reduced.

[0179] Therefore, unlike the shortened lifespan and health abnormalities that can result from the lack of expression of myostatin mRNA and mature myostatin protein, health may not be abnormal.

[0180] In a specific embodiment, bovine animals (cattle) with the myostatin gene missing 12 base pairs as described in this application were found to be healthy and without any health abnormalities.

[0181] In one embodiment, cattle with the 12-base-pair-deficient myostatin gene of this application can reproduce offspring through fertilization.

[0182] Myostatin transgenic cells

[0183] Another aspect of this application is engineered cells having an artificially modified myostatin gene.

[0184] Engineered cells can be embryonic cells, somatic cells, or stem cells.

[0185] In some embodiments, the cells include, but are not limited to, oocytes, epithelial cells, fibroblasts, nerve cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, macrophages, monocytes, muscle cells, B lymphocytes, T lymphocytes, embryonic stem cells, embryonic germ cells, fetal-derived cells, placental cells, and embryonic cells. Furthermore, adult stem cells derived from various tissue sources can be used, such as stem cells derived from adipose tissue, uterus, bone marrow, muscle, placenta, umbilical cord blood, or skin (epithelial tissue). Non-human host embryos can typically be embryos at the 2-cell, 4-cell, 8-cell, 16-cell, 32-cell, 64-cell stages, aborted embryos, or blastocysts.

[0186] The engineered cells of this application have the same characteristics as those of the transgenic animals described above, from characteristics 1 to 3.

[0187] In summary, the engineered cells have the myostatin gene with 12 base pairs missing from the second exon.

[0188] The genetic modification of engineered cells refers to the deletion of four amino acid sequences (in the order of leucine, tryptophan, isoleucine, and tyrosine) in a specific conserved region of the amino acid sequence encoding myostatin. Therefore, engineered cells possess the myostatin gene with 12 base pairs (the amino acid sequence encoding the conserved region) missing from the second exon.

[0189] Engineered cells can have a different morphology of myostatin mRNA than wild-type cells. The engineered cells of this application have myostatin mRNA with a 12-base deletion.

[0190] The expression level of myostatin mRNA in engineered cells was lower than that in wild-type animal cells.

[0191] Prepro-myostatin protein must undergo a cleavage process to become the active, mature myostatin protein.

[0192] Since the region where the cleavage occurs does not include the positions of the four amino acids missing in the transgenic cells, the original myostatin protein becomes the mature myostatin protein through normal signal transduction. In other words, the deletion of specific amino acids in this application does not affect the formation process of the normal mature myostatin protein.

[0193] In other words, the mature myostatin protein expressed by engineered cells lacking 12 base pairs of the myostatin gene of this application has the same amino acid sequence as the mature myostatin protein of wild-type cells.

[0194] Compositions for gene manipulation

[0195] According to another aspect of the disclosure provided in this application, a composition for genetic manipulation that modifies the myostatin gene is provided.

[0196] To modify the myostatin gene, the composition used for gene manipulation may include:

[0197] Guide RNA or DNA encoding said guide RNA, said guide RNA comprising a guide sequence complementary to a target sequence of the myostatin gene; and

[0198] The Cas protein or the nucleic acid sequence encoding the Cas protein.

[0199] The target sequence is a sequence complementary to the original spacer sequence, which is targeted by the composition and contained within the target region.

[0200] The target sequence is located in the second exon (exon 2) of the myostatin gene.

[0201] target sequence

[0202] The composition of this application targets the myostatin gene to modify the myostatin gene.

[0203] The portion that can be targeted by the composition is called the target area.

[0204] The target region is located in the second exon (exon 2) of the myostatin gene.

[0205] The target region includes the target sequence and the original spacer sequence. The sequence that binds to the guide sequence of the composition in a complementary manner is called the target sequence.

[0206] In this application, since there are genetic sequence differences between species, it may be easy to target nucleic acids that target conserved regions of the amino acid sequence encoding myostatin protein as target regions of compositions for genetic manipulation.

[0207] Therefore, the target sequence is configured to contain part or all of a sequence encoding a conserved amino acid sequence encoding myostatin protein according to the species, as described below.

[0208] The conserved amino acid sequence of promyosin protein according to species is described in detail below. In one embodiment, the conserved amino acid sequence is described relative to bovine animals compared to humans, pigs, or mice. Animals possessing the conserved amino acid sequence are not limited thereto.

[0209] The following section provides a comparison of the sequences of protomyosin proteins from bovine, human, swine, and mouse [Table 3]. The amino acid sequences at positions 156 to 159 of each protomyosin protein are conserved, and the conserved amino acid sequences below are in the order of leucine, tryptophan, isoleucine, and tyrosine (see the bold column in the table below).

[0210] [Table 3]

[0211] 152 153 154 155 156 157 158 159 160 161 162 163 164 165 Bovidae V K A Q L W I Y L R P V E T people " " " " " " " " " " " " K " pig " " " " " " " " " " " " K " 153 154 155 156 157 158 159 160 161 162 163 164 165 166 mice V K A Q L W I Y L R P V K T

[0212] The specific amino acid deletion position of the original myostatin protein in this application is such a conserved amino acid sequence, namely the amino acid sequence of myostatin protein from position 156 to 159.

[0213] These amino acid sequences are located at positions 157 to 160 of the myostatin protein in mice, but the amino acid sequences in mice are the same as those of leucine, tryptophan, isoleucine, and tyrosine.

[0214] The region targeted by the composition of this application may include part or all of the region encoding a conserved amino acid sequence. The target sequence may be designed around one strand of the DNA double helix containing the conserved region.

[0215] The target sequence may comprise part or all of the following sequences: 5'-CTT-3', 5'-CTC-3', 5'-CTA-3', or 5'-CTG-3' encoding leucine in the amino acid sequence; 5'-TGG-3' encoding tryptophan in the amino acid sequence; 5'-ATT-3', 5'-ATC-3', or 5'-ATA-3' encoding isoleucine in the amino acid sequence; 5'-TAT-3' or 5'-TAC-3' encoding tyrosine in the amino acid sequence; or part or all of complementary sequences of such sequences. In one embodiment of this application, the target sequence may comprise SEQ ID NO: 28-5′-ATATATCCACAG-3′. In another embodiment of this application, the target sequence may comprise SEQ ID NO: 29-5′-CTGTGGATATAT-3′.

[0216] To design target sequences, the PAM sequence in the target region should be considered. The PAM sequence can vary depending on the origin of the Cas protein.

[0217] The PAM sequence and its adjacent sequence are called the protospacer sequence. Excluding the PAM sequence, the protospacer sequence consists of fewer than 20 bases. The protospacer sequence and the target sequence are complementary sequences.

[0218] In one instance, the target sequence of the myostatin gene may be selected from SEQ ID NO: 38 to SEQ ID NO: 60 in [Table 4].

[0219] For example, SEQ ID NO: 38 to SEQ ID NO: 43 could be target sequences of the myostatin gene in bovine animals.

[0220] For example, SEQ ID NO: 42, SEQ ID NO: 43 and SEQ ID NO: 45 to SEQ ID NO: 48 may be target sequences of the porcine myostatin gene.

[0221] For example, SEQ ID NO: 49 to SEQ ID NO: 55 may be target sequences of the human myostatin gene.

[0222] For example, SEQ ID NO: 56 to SEQ ID NO: 60 may be target sequences of the mouse myostatin gene.

[0223] [Table 4]

[0224] target sequence CGGAGTCTATATAGGTGTCA (SEQ ID NO: 38) GGAGTCTATATAGGTGTCAA (SEQ ID NO: 39) GGGTTGACACCTATATAGAC (SEQ ID NO: 40) CCGGAGTCTATATAGGTGTC (SEQ ID NO: 41) TCCGGGTTGACACCTATATA (SEQ ID NO: 42) CTATATAGGTGTCAACCCGG (SEQ ID NO: 43) GTGTCACCCGGAAATGATC (SEQ ID NO: 44) CAGAGTCTATATAGGTGTCA(SEQ ID NO:45) AGAGTCTATATAGGTGTCAA (SEQ ID NO: 46) CCAGAGTCTATATAGGTGTC (SEQ ID NO: 47) GTGTCACCCGGAAATGATG (SEQ ID NO: 48) CAGAGTTTATATAGGTATCA (SEQ ID NO: 49) AGAGTTTATATAGGTATCAA (SEQ ID NO: 50) TACCTATATAAACTCTGGGC (SEQ ID NO: 51) TCCGGGTTGATAACCTATATAA (SEQ ID NO: 52) CCAGAGTTTATATAGGTATC (SEQ ID NO: 53) TTATATAGGTATCAACCCGG (SEQ ID NO: 54) GTATCACCCGGAAATGATG (SEQ ID NO: 55) CAGACTCTATATAGGTGTCA (SEQ ID NO: 56) AGACTCTATATAGGTGTCAA((SEQ ID NO: 57) CCAGACTCTATATAGGTGTC(SEQ ID NO:58) TCTATATAGGTGTCAACCCG(SEQ ID NO:59) GTGACAACCCGAAAATGATG(SEQ ID NO:60)

[0225] In one embodiment, the composition of this application comprises guide RNA or DNA encoding guide RNA, the guide RNA comprising a guide sequence complementary to a target sequence; and a CAS protein or a nucleic acid sequence encoding a CAS protein.

[0226] Guide RNA or DNA encoding guide RNA

[0227] The guide RNA of this application contains a guide sequence complementary to the target sequence described above.

[0228] The guide RNA may contain a first sequence and a second sequence, wherein the first sequence is a guide sequence that can complementarily bind to the target sequence, and the second sequence participates in the formation of a complex through interaction with the Cas protein.

[0229] The first sequence of the guide RNA of this application is the same as the original spacer sequence, which is complementary to the designed target sequence, and is an RNA sequence in the original spacer sequence consisting of U (uracil) instead of T (thymine).

[0230] In another aspect, the first sequence of this application may be a portion of crRNA, and the second sequence may contain another portion of crRNA and / or tracrRNA. For example, the guide RNA may be a first sequence and a second sequence consisting only of crRNA, and again, for example, the guide RNA may be a first sequence and a second sequence containing both crRNA and tracrRNA.

[0231] In this case, the first sequence can be determined based on the target sequence, and a portion of the second sequence can be determined based on the type of microorganism from which the Cas protein originates.

[0232] For example, in the case of a guide RNA that binds to a Cas protein derived from Streptococcus pyogenes, the first sequence may be part of a crRNA sequence and the second sequence may contain tracrRNA.

[0233] In one implementation, when the guide RNA binds to the Streptococcus pyogenes protein, the second sequence may include...

[0234] 5'-GUUUUAGUCCCUGAAAAGGGACUAAAAUAAAGAGUUUGCGGGACUCUGCGGGGUUACAA

[0235] UCCCCUAAAACCGCUUUU-3' (SEQ ID NO: 61).

[0236] Meanwhile, the guide RNA of this application can be in the form of a single sequence, wherein the first sequence and the second sequence are linked together. Alternatively, the guide RNA can consist of two separate sequences, which are composed of a sequence containing the first sequence and a sequence containing a portion of the second sequence, and they can be composed of crRNA and tracrRNA, respectively.

[0237] Below, examples of guide sequences that may be used in one embodiment of this application are shown in the table. The guide sequences listed in [Table 5] are RNA sequences that can bind complementary to the target sequence of the myostatin gene.

[0238] The guide sequences listed in Table 5 are guide sequences that can target the sequences in Table 2 respectively.

[0239] The guide sequence of this application may be a sequence selected from SEQ ID NO: 62 to SEQ ID NO: 84.

[0240] For example, SEQ ID NO: 62 to SEQ ID NO: 68 are guide sequences that can bind complementary to the target sequence of the bovine myostatin gene.

[0241] For example, SEQ ID NO: 66, SEQ ID NO: 67 and SEQ ID NO: 69 to SEQ ID NO: 72 are guide sequences that can bind complementary to the target sequence of the porcine myostatin gene.

[0242] For example, SEQ ID NO: 73 to SEQ ID NO: 79 are guide sequences capable of binding complementary to the target sequence of the human myostatin gene. For example, SEQ ID NO: 80 to SEQ ID NO: 84 are guide sequences capable of binding complementary to the target sequence of the mouse myostatin gene.

[0243] In one embodiment of this disclosure, a complex of guide RNA and Cas protein (ribonucleoprotein particle: RNP) comprising the above-described guide sequence can be injected into cells or embryos.

[0244] [Table 5]

[0245] Guide sequence 5′-GCCUCAGAUAUAUCCACAGU-3′(SEQ ID NO:62) 5′-CCUCAGAUAUAUCCACAGUU-3′(SEQ ID NO:63) 5′-CCCAACUGUGGAUAUAUCUG-3′(SEQ ID NO:64) 5′-GGCCUCAGAUAUAUCCACAG-3′(SEQ ID NO:65) 5′-AGGCCCAACUGUGGAUAUAU-3′(SEQ ID NO:66) 5′-GAUAUAUCCACAGUUGGGCC-3′(SEQ ID NO:67) 5′-CACAGUUGGGCCUUUACUAG-3′(SEQ ID NO:68) 5′-GUCUCAGAUAUAUCCACAGU-3′(SEQ ID NO:69) 5′-UCUCAGAUAUAUCCACAGUU-3′(SEQ ID NO:70) 5′-GGUCUCAGAUAUAUCCACAG-3′(SEQ ID NO:71) 5′-CACAGUUGGGCCUUUACUAC-3′(SEQ ID NO:72) 5′-GUCUCAAAUAUAUCCAUAGU-3′(SEQ ID NO:73) 5′-UCUCAAAUAUAUCCAUAGUU-3′(SEQ ID NO:74) 5′-AUGGAUAUAUUUGAGACCCG-3′(SEQ ID NO:75) 5′-AGGCCCAACUAUGGAUAUAU-3′(SEQ ID NO:76) 5′-GGUCUCAAAUAUAUCCAUAG-3′(SEQ ID NO:77) 5′-AAUAUAUCCAUAGUUGGGCC-3′(SEQ ID NO:78) 5′-CAUAGUUGGGCCUUUACUAC-3′(SEQ ID NO:79) 5′-GUCUGAGAUAUAUCCACAGU-3′(SEQ ID NO:80) 5′-UCUGAGAUAUAUCCACAGUU-3′(SEQ ID NO:81) 5′-GGUCUGAGAUAUAUCCACAG-3′(SEQ ID NO:82) 5′-AGAUAUAUCCACAGUUGGGC-3′ (SEQ ID NO: 83) 5′-CACAGUUGGGCUUUUACUAC-3′ (SEQ ID NO: 84)

[0246] Meanwhile, in another aspect, this application may provide DNA encoding guide RNA. In this case, the DNA sequence encoding guide RNA is a sequence encoding a first sequence (guide sequence) and includes the same DNA sequence as the target sequences represented by SEQ ID NO: 38 to SEQ ID NO: 60 respectively; and a DNA sequence encoding a second sequence.

[0247] Cas protein or nucleic acid encoding Cas protein

[0248] The Cas protein in this application may be selected from the group consisting of: Cas9 protein derived from *Streptococcus pyogenes*, Cas9 protein derived from *Campylobacter jejuni*, Cas9 protein derived from *Streptococcus thermophilus*, Cas9 protein derived from *Staphylococcus aureus*, Cas9 protein derived from *Neisseria meningitidis*, and Cas12a (Cpf1) protein. In this application, the Cas protein may be wild-type or a mutant form thereof.

[0249] In this application, the Cas protein or the nucleic acid encoding the Cas protein may further include elements typically used for delivery into the nucleus of eukaryotic cells, such as nuclear localization sequences (NLS).

[0250] In one embodiment, the Cas protein may be the Cas9 protein derived from Streptococcus pyogenes, the Cas9 protein derived from Staphylococcus aureus, or the Cas12a (Cpf1) protein.

[0251] The PAM sequence may vary depending on the Cas protein. In one embodiment, SpCas9 has an NGG PAM sequence. In one embodiment, SaCas9 has an NNGRR or NNGRRRT PAM sequence. In one embodiment, Cas12a (Cpf1) has a TTTN PAM sequence. N is any one of A, T, G, or C. R is A or G.

[0252] Forms of compositions for gene manipulation

[0253] The composition for gene manipulation of myostatin of this application may comprise: guide RNA or nucleic acid encoding guide RNA; and Cas protein or nucleic acid encoding Cas protein, each independently or together.

[0254] The guide RNA of this application can be delivered to cells in the form of RNA or DNA encoding the guide RNA. The guide RNA can be in the form of standalone RNA, RNA contained in a viral vector, or encoded in a vector.

[0255] The Cas protein of this application can be delivered into cells in the form of RNA or DNA encoding RNA. The Cas protein can be in the form of standalone RNA, RNA contained in a viral vector, or encoded in a vector.

[0256] At this time, the viral vector may be selected from the group consisting of: retroviral vectors, lentiviral vectors, adenovirus vectors, adeno-associated virus (AAV) vectors, vaccinia virus vectors, poxvirus vectors, and herpes simplex virus vectors.

[0257] In one implementation, the guide RNA and Cas protein can be configured as plasmid DNA containing sequences encoding the respective RNAs and promoters, and plasmid DNA containing sequences encoding the proteins and promoters.

[0258] In another implementation, the guide RNA and Cas protein can be configured to contain a sequence encoding RNA or protein and a promoter in a plasmid DNA.

[0259] As another form, guide RNA and Cas proteins can be configured to be in the form of viral vectors rather than plasmid DNA.

[0260] In another embodiment, the guide RNA and Cas protein can be configured as mRNA. In this case, the guide RNA can be prepared by in vitro transcription using any in vitro transcription system known in the art.

[0261] The guide RNA and Cas protein of this application can preferably be configured in the form of a ribonucleoprotein (RNP) complex, wherein the guide RNA and Cas protein bind.

[0262] In another embodiment, the guide RNA and the Cas protein can be configured in different forms. For example, the guide RNA can be configured as a standalone RNA, and the Cas protein can be configured as a vector containing the sequence encoding the protein and a promoter.

[0263] Furthermore, the composition can be configured in various forms. Therefore, there is no limitation as those skilled in the art can appropriately utilize methods known in the art.

[0264] Methods for producing engineered cells containing an artificially modified myostatin gene.

[0265] Another aspect of the disclosure provided in this application relates to a method for producing engineered cells having a myostatin gene, wherein the composition described above is used to delete 12 base pairs of the second exon.

[0266] The cells can be embryonic cells, somatic cells, or stem cells.

[0267] In some embodiments, the cells include, but are not limited to, oocytes, epithelial cells, fibroblasts, nerve cells, keratinocytes, hematopoietic cells, melanocytes, chondrocytes, macrophages, monocytes, muscle cells, B lymphocytes, T lymphocytes, embryonic stem cells, embryonic germ cells, fetal-derived cells, placental cells, and embryonic cells. Furthermore, adult stem cells derived from various tissue sources can be used, such as stem cells derived from adipose tissue, uterus, bone marrow, muscle, placenta, umbilical cord blood, or skin (epithelial tissue). Non-human host embryos can typically be embryos at the 2-cell, 4-cell, 8-cell, 16-cell, 32-cell, 64-cell stages, aborted embryos, or blastocysts.

[0268] Preferably, the cell may be an embryonic cell.

[0269] Cells can be derived from animals.

[0270] Animals include mammals.

[0271] Mammals include ungulates.

[0272] Ungulate animals can include, but are not limited to, bovines and pigs.

[0273] Mammals include rodents.

[0274] Rodents can include, but are not limited to, mice.

[0275] The method of this application for producing engineered cells comprising an artificially modified myostatin gene.

[0276] This may include contacting cells with the composition. The contacting step may be performed in vivo or in vitro.

[0277] For example, but not limited to, contact steps can be used to introduce nucleic acids into cells through transient transfection, microinjection, transduction, cell fusion, calcium phosphate precipitation, liposome-mediated transfection, DEAE-mediated transfection, polybrene-mediated transfection, electroporation, gene gun, and other known methods for introducing nucleic acids into cells.

[0278] Through the introduced composition, insertions and deletions (indels) occur in the cell's genome.

[0279] "Insertion-deletion" is a general term for mutations that insert or delete nucleotides in the middle of a DNA nucleotide sequence. Insertion-deletions can be introduced into target sequences during the cleavage and repair of nucleic acids (DNA, RNA) using a guide RNA-CRISPR complex.

[0280] As a result of the insertion / deletion, the engineered cells of this application have the myostatin gene, wherein 12 base pairs in the second exon are deleted by the composition.

[0281] Furthermore, according to the method described above for producing engineered cells containing an artificially modified myostatin gene, the engineered cells of this application have genetic modifications that cause in-frame deletions.

[0282] The impact of missing content within the box is described below.

[0283] Impact of missing frames

[0284] Engineered cells containing the myostatin gene with 12 base pairs missing from the second exon of this application have gene modifications that cause in-frame deletion.

[0285] "In-frame deletion" requires the deletion of at least three (usually multiples of three) DNA bases to cause the deletion of the entire corresponding codon, which can lead to the deletion of the corresponding amino acid in the resulting protein.

[0286] Since this application is characterized by the deletion of 12 bases in the myostatin gene, the deletion is in-frame deletion and no frameshift modification occurs.

[0287] As a result of in-frame deletion, the protein exists in a form where four amino acids are missing, and there is no translation to other amino acids or change in the stop codon (which can occur in general frameshift modifications). That is, apart from the four missing amino acids, the remaining amino acids can be normally translated into the protein via transcription in the myostatin gene.

[0288] Methods for producing transgenic animals containing an artificially modified myostatin gene.

[0289] Another aspect of the disclosure provided in this application relates to methods for producing animals using engineered cells. Specifically, this application relates to methods for producing animals with a myostatin gene containing a 12-base-pair deletion in the second exon.

[0290] In any embodiment, a production method is performed by transferring an embryonic cell containing a myostatin gene with a 12-base-pair deletion in the second exon into a mother to produce a transgenic animal with an artificially modified myostatin gene containing a 12-base-pair deletion in the second exon.

[0291] In another embodiment, the production method relates to a method of producing animals with transgenic tissues or organs by injecting the composition into animal tissues or organs.

[0292] Animals include mammals.

[0293] Mammals include ungulates.

[0294] Ungulate animals can include, but are not limited to, bovines and pigs.

[0295] Mammals include rodents.

[0296] Rodents may include, but are not limited to, mice.

[0297] Methods for producing transgenic animals using engineered cells

[0298] The method of producing transgenic animals containing an artificially modified myostatin gene, as described in this application,

[0299] In one embodiment, the method may include transferring engineered cells generated in the above steps to a parent organism, the engineered cells having an artificially modified myostatin gene in which 12 base pairs of the second exon are missing.

[0300] The general description of each step can be understood by referring to methods known in the art for producing transgenic animals.

[0301] In this application, embryonic cells can be produced by the method described in the above-described "Method for producing engineered cells containing an artificially modified myostatin gene", wherein the step of contacting the cells with the composition is completed.

[0302] Embryonic cells can develop into blastocysts during in vitro culture.

[0303] By transferring the blastocyst to the mother, it is possible to produce an animal with the myostatin gene missing 12 base pairs in the second exon.

[0304] In one embodiment of this disclosure, an embryo with an artificially modified myostatin gene having 12 base pairs missing from the second exon is transplanted to produce an animal having an artificially modified myostatin gene having 12 base pairs missing from the second exon, preferably a bovine animal (bovine) having a myostatin gene having 12 base pairs missing from the second exon.

[0305] Transgenic animals can be chimeric or homologous transgenic animals.

[0306] The method of producing transgenic animals containing an artificially modified myostatin gene, as described in this application,

[0307] For another specific instance, it can include

[0308] The process involves obtaining engineered somatic cells containing the artificially modified myostatin gene described above; preparing enucleated oocytes by removing the nucleus from animal eggs; microinjecting the nucleus of the engineered somatic cells into the enucleated oocytes and fusing them; activating the fused oocytes; and transferring the activated oocytes into the mother.

[0309] The general description of each step can be understood by referring to methods for preparing transgenic animals using conventional somatic cell nuclear transfer techniques known in the art.

[0310] Transgenic animals can be prepared by transferring somatic cells or their nuclei containing an artificially modified myostatin gene according to the above method into enucleated oocytes using the SCNT (somatic cell nuclear transfer) method. The transgenic animals can be homologous transgenic animals.

[0311] In another embodiment, as a method for producing homologous transgenic animals, first transgenic animals having a myostatin gene with 12 base pairs missing in the second exon can be hybridized to produce homologous transgenic animals.

[0312] Transgenic animals obtained through hybridization can contain the same myostatin gene as the myostatin gene with a 12-base-pair deletion in the genome of the first transgenic animal.

[0313] Methods for producing animals with partially transgenic tissues

[0314] The transgenic animal of this application may be an animal that has an artificially modified myostatin gene with 12 base pairs of its second exon missing in a portion of its tissues.

[0315] The tissue can be epithelial tissue, connective tissue, or muscle tissue, but preferably it can be muscle tissue containing the myostatin gene.

[0316] This method may include the step of introducing the composition described above into animal tissues.

[0317] When the composition is introduced into animal tissues, the animals can be tissue-specifically engineered to have a modified myostatin gene within the tissue.

[0318] Introduction can be done through injection, implantation, or transplantation.

[0319] Introduction can be administered via a selected route: subretinal, subcutaneous, intradermal, intraocular, vitreous, intratumoral, intraductal, intramedullary, intramuscular, or...

[0320] intraperitoneally.

[0321] Use of myostatin transgenic animals in this application

[0322] Improved breeds of animals

[0323] Animals possessing a myostatin gene with a 12-base deletion in the second exon can be used as improved breeds. Improved breeds can be, but are not limited to, bovine, swine, mouse, or rat animals with a 12-base deletion in the myostatin gene. Improved breeds can be those with more developed muscles compared to wild-type animals. Improved breeds can be those with less fat compared to wild-type animals.

[0324] Animals used in disease model research

[0325] Animals possessing an artificially modified myostatin gene with a 12-base deletion in its second exon can be used as disease model animals. Disease model animals can be, but are not limited to, bovine, pig, mouse, or rat animals with a 12-base deletion in the myostatin gene. Disease models can include studies of muscle atrophy, sarcopenia, and myofibril reduction, but are not limited to these.

[0326] Disease-resistant animals

[0327] Animals possessing the myostatin gene with a 12-base deletion in its second exon can be used as disease-resistant animals. Disease-resistant animals can be, but are not limited to, bovine, swine, mouse, or rat animals with a 12-base deletion in the myostatin gene. The disease can be, but is not limited to, studies involving muscle atrophy, sarcopenia, and myofibril reduction.

[0328] Uses of by-products

[0329] Meat, organs, skin, hair, and body fluids from transgenic animals possessing a myostatin gene with a 12-base deletion in its second exon can be used, but are not limited to these. Transgenic animals can be bovine, pig, mouse, or rat animals with a 12-base deletion in their myostatin gene, but are not limited to these. Compared to wild-type animals, transgenic animals can have lower fat content and higher muscle content. Therefore, high-quality meat with low fat content and high muscle content can be obtained as a byproduct of animal husbandry.

[0330] Use of the composition for genetic manipulation in this application

[0331] Another aspect of the disclosure provided in this application relates to the use of the compositions of this application for genetic manipulation.

[0332] The composition described above can be used for the purpose of increasing muscle mass, but is not limited thereto.

[0333] At this time, the subject to whom the composition may be administered may be a mammal, including primates (e.g., humans and monkeys), rodents (e.g., mice and rats), and ungulates (e.g., bovids, pigs, and horses).

[0334] Another aspect of the disclosure provided in this application may provide a method for increasing the muscle of a given tissue, the method comprising the step of administering the composition of this application for genetic manipulation.

[0335] The composition can be administered to a specific body part of the subject to which it is given.

[0336] Specific body parts can be located around tissues that require muscle growth.

[0337] A specific body part can be the tissue surrounding which the muscles are not developed in an infant.

[0338] It can be administered by injection, infusion, implantation, or transplantation.

[0339] Administration can be administered via a selected route: subcutaneously, intradermally, intramuscularly, or intraperitoneally.

[0340] A single dose (the effective amount to achieve the predetermined desired effect) of the myostatin gene manipulation composition may be selected from any integer value within the following range, for example, but not limited to, 10 kg per kilogram of subject body weight. 4 Up to 10 9 Cells, for example, 10 5 Up to 10 6 Cells / kg (body weight), and may be administered appropriately taking into account the subject's age, health condition and weight.

[0341] When the myostatin gene is artificially manipulated using methods or compositions disclosed in some embodiments of this application, effects such as muscle gain can be obtained.

[0342] The present application will be described in more detail below through examples.

[0343] These embodiments are intended only to explain this application in more detail, and it will be apparent to those skilled in the art to which this application pertains that the scope of this application is not limited by these embodiments.

[0344] [Example]

[0345] [Example 1] Design of single-guide RNA (sgRNA)

[0346] sgRNAs containing sequences complementary to each of the 12 base pairs of myostatin on each single strand were designed using the CHOPCHOP software (https: / / chopchop.cbu.uib.no / ). The sgRNAs included the aforementioned complementary binding sequences and were designed for use within the PAM sequences of CRISPR / SpCas9, CRISPR / SaCas9, or CRISPR / Cpf1 for the myostatin gene. The sgRNAs used in the experiments were designed to contain at least one of the guide sequences listed in Table 2.

[0347] Figure 1 This shows one of the protospacer sequences of the myostatin gene.

[0348] pass Figure 1 The sequence binds the guide RNA to the complementary sequence (target sequence) of the sequence, and the binding sequence of the guide RNA can be predicted in the sequence.

[0349] [Example 2] In vitro maturation of oocytes

[0350] Ovaries were collected from local slaughterhouses and transported to the laboratory within two hours. The ovaries transferred from the slaughterhouse were aspirated using an 18-gauge syringe to obtain the cumulus-oocyte complex (COC) from follicles ranging from 2 to 8 mm in diameter. The COC was classified as being surrounded by more than three layers of cumulus cells and evenly distributed cytoplasm. During in vitro maturation, COCs were cultured in a humid atmosphere of 5% CO2 at 38.5°C in chemically defined TCM-199 medium containing 0.005 AU / mL FSH (Antrin, Teikoku, Cat. No. F2293), 1 μg / mL 17β-estradiol (Sigma-Aldrich, Cat. No. E4389), 100 μM cysteine ​​(Sigma-Aldrich, Cat. No. M6500), and 10% FBS (Gibco, Cat. No. GIB-16000-044).

[0351] [Example 3] Sperm purification, in vitro fertilization and in vitro embryo culture

[0352] Motile sperm were purified using the Percoll gradient method. Sperm from thawed semen at 35°C was filtered by centrifugation at 1500 rpm for 15 min at a discontinuous Percoll gradient (45% to 90%). To prepare a 45% Percoll solution, 1 mL of TALP was added to 1 mL of 90% Percoll. Sperm pellets were centrifuged at 1500 rpm for 5 min and washed twice with 3 mL of TALP. Motile sperm purified by the Percoll gradient method were used for fertilization. Under a humid atmosphere of 5% CO2, 1 × 10⁻⁶ sperm were added to 45 μL of IVF-TALP medium covered with mineral oil (Nidacon, Cat. No. NO-100). 6 Up to 2×10 6 A certain number of motile sperm per mL were cultured with mature oocytes. Eighteen hours after in vitro fertilization, cumulus cells were removed from the zygote. The zygote was then cultured at 38.5°C in a medium protected with two levels of chemically defined mineral oil under an atmosphere of 5% O2, 5% CO2, and 90% N2. The zygote was then cultured into embryos.

[0353] [Example 4] Microinjection

[0354] When performing microinjection, Cas9 mRNA and sgRNA were divided into four groups to determine the optimal concentrations. (CB;TE microinjection only, RNA1X; Cas9 mRNA: 100 ng / μL, sgRNA: 50 ng / μL, RNA2X; Cas9 mRNA: 200 ng / μL, sgRNA: 100 ng / μL, RNA4X; Cas9 mRNA: 400 ng / μL, sgRNA: 200 ng / μL). Eighteen hours after in vitro fertilization, sgRNA and Cas9 mRNA (sigma-Aldrich, Cat. No. CAS9mRNA) were synthesized using the GeneArt Precision gRNA Synthesis Kit (Thermofisher, Cat. No. A29377) and microinjected using an Eppendorf microinjector. The microinjection was injected into the zygote. Seven days after microinjection, preimplantation embryos were collected and observed for myostatin deficiency or implantation into the mother's uterus.

[0355] Microinjection Figure 2 As shown in the image.

[0356] exist Figure 5 The diagram illustrates the experimental results by dividing Cas9 mRNA and sgRNA into four groups.

[0357] Based on the above results, the proportion of blastocysts in both RNA1X and RNA2X groups was similar to that of wild-type blastocysts. When observing the modification rate, the RNA2X group showed a significantly higher modification rate compared to the other RNA1X and RNA4X groups. Therefore, the optimal concentration of RNA2X was determined, and experiments were then conducted using the concentrations of Cas9 mRNA: 200 ng / μL and sgRNA: 100 ng / μL used in the RNA2X group.

[0358] exist Figure 3 and Figure 4 In this study, myostatin modification was observed in embryos after microinjection.

[0359] Figure 3 The results showed that when the myostatin gene in embryos was modified by T7E1 assay, an additional band below 530 bp was observed, which was different from the wild type but the same as the positive control. These results confirm that the myostatin gene was modified in the embryos.

[0360] Figure 4 This is a view showing the results of myostatin modification in embryos obtained through Sanger sequencing.

[0361] The results above show that in the embryo, there are deletions of 1, 2, 3, 10, and 12 base pairs in the second exon of the myostatin gene, as well as insertions of one base pair in the second exon of the myostatin gene.

[0362] In this way, it was demonstrated that, unlike animals, embryos can have various modified forms, including those lacking only 12 base pairs of the second exon of the myostatin gene due to insertion / deletion. However, the engineered cells in this application refer only to engineered cells having the myostatin gene with 12 base pairs of the second exon missing.

[0363] [Example 5] Embryo transfer and pregnancy diagnosis

[0364] The blastocysts were stored in PBS supplemented with 20% FBS. Around day 7 (estrus = day 0 = fusion day), the blastocysts were transferred non-surgically to the uterus of each mother via the cervix. Fifty days post-estrus, the mothers were examined by rectal palpation and ultrasound to assess embryo viability and pregnancy status. Thereafter, pregnant cows were regularly examined by rectal palpation and ultrasound.

[0365] After birth, in order to confirm Figure 6 The appearance of cow No. 17 in the series was photographed at one-month intervals from one month after birth to four months of age.

[0366] As can be seen from the above photos, cow number 17 is a cow with 12 base pairs missing from the second exon of the myostatin gene, and muscle development is visible, with a more obvious appearance of muscle development after 3 months.

[0367] [Example 6] T7E1 Measurement

[0368] Genomic DNA was extracted from transgenic primary cells using a DNA extraction kit (DNeasy Blood & Tissue kit, Qiagen, Cat. No. 69504). MSTN primers were designed using PRIMER3 software. PCR conditions were performed for 35 to 40 cycles at 94°C for 5 minutes, 94°C for 20 seconds, 57°C for 30 seconds, 72°C for 35 seconds, and 72°C for 5 minutes.

[0369] exist Figure 7 In this study, the results of 12 base pairs of the myostatin gene in cow number 17 of the cows born in Example 5 were confirmed by T7E1 assay.

[0370] The above results, as part of the T7E1 assay, confirm that, unlike the wild type, cattle No. 17 have a different location of the cleavage band, and therefore, cattle No. 17 possess a modified myostatin gene.

[0371] [Example 7] Gene expression via real-time PCR

[0372] use Total RNA was extracted from primary cultured cells using a Mini Kit (Qiagen, Cat. No. 74106), and complementary DNA was synthesized from 1 μg of RNA using the RNA-to-cDNA EcoDry Premix (Oligo dT) (Takara, Cat. No. 639543). Gene expression analysis was performed using the SYBR Green method in a QuantStudio 3 (Applied Biosystems, Model A28132), and the relative cycle threshold (CT) values ​​were normalized using GAPDH. The primers used in the above examples are listed in SEQ ID NO: 87 to SEQ ID NO: 90.

[0373] [Table 6]

[0374]

[0375] [Example 8] MSTN Off-Target Effect Analysis

[0376] Potential off-target effects attributable to CRISPR / Cas9 in three MSTN mutant calves were scanned using Cas-OFFinder software, a rapid and versatile algorithm for searching for potential off-target sites of endonucleases derived from Cas9 RNA. In this experiment, the number of mismatches in the MSTN target sites was set to 3, and five base sequences were identified across the entire bovine genome. Primers targeting each of these five base sequences were named SEQ ID NO: 89 to SEQ ID NO: 100, and off-target effects based on primer position were confirmed by T7E1 analysis.

[0377] exist Figure 8 In this study, primer sequences were used as potential off-target sites for T7E1 determination.

[0378] The results show that, unlike the positive control, no truncated bands were identified at any of the five sites to confirm off-target effects. Therefore, the results confirm that CRISPR / Cas9 does not exhibit off-target effects at potential off-target sites, and that the guide RNA and Cas9 mRNA used in one embodiment of this application function specifically to their targets.

[0379] [Table 7]

[0380]

[0381] [Example 9] Targeted Deep Sequencing

[0382] Following the manufacturer's protocol, the target sites were first amplified to approximately 500 bp from the extracted genomic DNA using KAPA HiFi HotStart DNA polymerase (Roche, Cat. No. #KK2502). The amplicons were then re-amplified to a size up to 230 bp and amplified again using TruSeq HT dual-index primers to add adapters and index sequences from the Illumina sequencing platform to each sample. The primers used in this study are listed in SEQ ID NO: 101 and SEQ ID NO: 102. The merged PCR amplicons were purified using a PCR purification kit (MGmed) and sequenced using a paired-end sequencing system (2 x 150 bp) in MiniSeq (Illumina). The insertion / deletion rate in the deep sequencing data was quantified using Cas-Analyzer.

[0383] Targeted deep sequencing results can be Figures 9 to 13 This has been confirmed.

[0384] Figure 9The results of targeted deep sequencing of 17 cattle and wild-type cattle born from the transplantation of engineered embryos containing the modified myostatin gene of this application into their mothers are shown. These results show that, unlike wild-type cattle, the insertion / deletion rates in cattle 6, 14, and 17 are 10.45%, 45.4%, and 99.98%, respectively.

[0385] List in more detail Figure 9 The results can be found Figures 10 to 13 This has been confirmed.

[0386] refer to Figure 10 This confirmed that the base pairs of the second exon of the myostatin gene were not modified in wild-type cattle. The gray box indicates the PAM sequence. The underlined sequence is the original spacer sequence. Figures 10 to 13 The same gray boxes and underlines are used in the middle.

[0387] exist Figure 11 The study confirmed the deletion of 12 base pairs in the second exon of bovine myostatin gene #6. The deletion rate was confirmed at 10.45%, and read results were also confirmed.

[0388] exist Figure 12 In the case of cow number 14, it can be seen that the relationship with... Figure 11 The same 12 base pairs in the second exon of the myostatin gene. The insertion / deletion rate in cow 14 was 45.4%.

[0389] exist Figure 13 The study confirmed a 12-base pair deletion in the second exon of the myostatin gene in cow 17. This confirmed an insertion / deletion rate of 99.98% in cow 17.

[0390] Based on the above results, in this application, targeted deep sequencing of cattle born after induction of myostatin exon 2 modification confirmed that the myostatin exon 2 bases were not modified in these cattle. However, it has been confirmed that in all three cattle where the modification was confirmed, only 12 base pairs of exon 2 were missing.

[0391] [Table 8]

[0392]

[0393] [Example 10] Primary cell culture

[0394] Primary cells derived from bovine ear skin were obtained using a biopsy pore-forming instrument. The ear shells obtained from the bovine skin were cut into small pieces using a sterile scalpel, washed several times, and cultured at 38°C in HANK balanced salt solution (Gibco, Cat. No. 14175095) supplemented with collagenase (type I collagenase, Gibco, Cat. No. 17-017) for 4 to 18 hours. After overnight incubation, the dispersed cells were washed several times in DMEM (Gibco, Cat. No. 21068028) medium and supplemented with 10% fetal bovine serum (Gibco, Cat. No. GIB-11150-059), 1% penicillin / streptomycin (Gibco, Cat. No. 15140148), 1% non-essential amino acids (Gibco, Cat. No. 11140050) and 100 mM β-mercaptoethanol (Sigma-Aldrich, Cat. No. M3418).

[0395] exist Figure 7 In this case, the T7E1 assay was performed during the process described in the above example, after primary cell culture.

[0396] exist Figure 14 In this study, after culturing primary cells from cattle 14 and 17 born in this application, the expression levels of myostatin mRNA in wild-type cattle were compared and illustrated with those in cattle 14 and 17.

[0397] The results above show that the expression of myostatin mRNA in the primary cells of cattle No. 14 and No. 17 was reduced by more than 60% (in cattle No. 14) and 80% (in cattle No. 17).

[0398] Therefore, it was confirmed that, compared with wild-type cattle, the expression of myostatin mRNA was reduced in cattle with a 12-base pair deletion in the second exon of the myostatin gene in this application.

[0399] [Example 11] Reproductive Transmission in MSTN-Knockout Bodies

[0400] Experimental methods

[0401] 1) Donor management and oocyte retrieval (Ovum Pick Up, OPU)

[0402] 2.0 mg of estradiol benzoate was injected intramuscularly into MSTN mutant donor cattle with random estrous cycles and implanted vaginal progesterone devices (Repro360, Cue-mate). On days 4 and 5, the donor was given four doses of 200 mg FSH (Kawasaki Pharm, Antonin R-10) every 12 hours (57 mg, 57 mg, 43 mg, and 43 mg). The P4 device was removed immediately on day 7, prior to OPU.

[0403] For OPU, the donor cow was restrained in a cattle crush cage. Epidural anesthesia was administered with 5 mL of 2% lidocaine (Daihan, DAIHAN Lidocaine, South Korea). The ovary was fixed and positioned on the probe of an ultrasound device via transrectal manipulation. A trained OPU technician performed the OPU procedure using an ultrasound device (Esaote, MyLab One) coupled with a 7.5 MHz transrectal transducer probe equipped with a follicular aspiration guide (WTA, catalog number 10283). Follicular puncture was performed using an 18G OPU threaded needle (WTA, catalog number 17927), and follicular fluid was collected in a 50 mL tube. Oocytes were collected from the follicular fluid under a stereomicroscope for in vitro fertilization. Remaining follicles were... The fragments are used for primary culture.

[0404] 2) Semen collection

[0405] Semen was collected from MSTN mutant bulls using electrojaculation (3 times per bull). Before collection, the foreskin was circumcised, the orifice was rinsed with water, and then dried with clean paper towels to minimize contamination. A manually controlled ElectroJac6 semen collector was used. Instruments Neogen Corporation, Lansing, MI, USA, performed electrostimulation semen collection using a device with an additional 6.5 cm diameter rectal probe and three abdominal electrodes spaced approximately 1 cm apart, fully inserted into the rectum facing the abdomen. The number of electrical stimulations was increased until the bull ejaculated. Each stimulation lasted 8 to 10 seconds, with a pause of approximately 2.0 seconds before the next stimulation. When the semen became cloudy, a collection tube was placed on the penis to collect the semen. The ejaculated semen was transported to the laboratory within 30 minutes at 25°C.

[0406] 3) Semen cryopreservation and thawing

[0407] Semen samples exhibiting more than 60% general motility are used for cryopreservation. They are stored at 37°C. (IMV Technologies) Increased semen sample volume. The increased semen volume was equilibrated at 4°C for 3 hours and then placed in a 0.5 mL pipette. The filled pipette was placed on a special support 5 cm above liquid nitrogen and exposed to liquid nitrogen vapor for 15 minutes, then placed in a cryogenic storage tank filled with liquid nitrogen (-196°C). The cryopreserved sperm was thawed in a water bath at 37°C for 45 seconds.

[0408] 4) Sperm motility testing

[0409] To analyze and quantify sperm motility, the IVOS-II CASA (Computer-Aided Sperm Analysis Procedure) system was used according to the manufacturer's instructions. In short, the frozen semen was thawed, incubated, and purified using the same protocol as used for IVF. Then, 3 μL of sperm was loaded into the sperm analysis chamber (Leja slide) and analyzed via CASA. Cryopreserved pipettes from three different bulls were used. To eliminate technical errors, each semen sample was analyzed three times, and the average CASA results were used for statistical evaluation.

[0410] 5) In vitro fertilization and culture

[0411] As previously described, motile sperm were selected using the Percoll gradient method. In short, frozen-thawed semen from F0 bulls at 35°C was filtered by centrifugation at 1680 rpm for 15 minutes at a discontinuous Percoll gradient (45% to 90%). To generate a 45% Percoll solution, 1 mL of sperm capacitation-Tyrode's albumin lactate pyruvate (TALP) medium was added to 1 mL of 90% Percoll. Sperm clumps were washed twice with 3 mL of volumetric-TALP medium and centrifuged at 1680 rpm for 5 minutes. The washed motile sperm were used for IVF. Sperm (1 × 10⁻⁶) 6 Up to 2×10 6 Sperm / mL) and mature oocytes were cultured for 18 hours in 50 μL IIVF-TALP medium covered with mineral oil (Nidacon, catalog number NO-100) under a 5% humid atmosphere. After co-incubation at 38.5°C and CO2 for 18 hours, cumulus cells were removed from the putative zygotes. Zygotes were then cultured at 38.5°C in a two-stage chemically defined medium covered with mineral oil under an atmosphere of 5% O2, 5% CO2, and 90% N2.

[0412] Experimental results

[0413] 1) Reproductive lineage transmission in MSTN mutant cows

[0414] After OPU, a total of 45 oocytes (n=3) were collected. Following in vitro fertilization with wild-type frozen-thawed sperm, the 45 oocytes were cultured, resulting in 5 blastocysts (12.5±10.9%). Figure 15 A). Selected blastocysts were transferred to 5 recipients. Pregnancy was confirmed in one recipient by rectal palpation and ultrasound. Figure 15 B). Furthermore, MSTN mutations were confirmed by culturing follicular fluid obtained during OPU (Ovulation End-Stage). Figure 16 T7E1 assays and Sanger sequencing confirmed the same mutation in both residual embryos and cells derived from follicular fluid as in F0 females. Figure 17 and Figure 18 These results demonstrate successful germline transmission in MSTN mutant cattle using the OPU procedure.

[0415] Figure 15 The results of germline transmission in MSTN-mutant females are shown, including the generation of MSTN-mutant blastocysts derived from MSTN-mutant bovine oocytes (A), and a representative photograph (B) taken on day 30 using ultrasound for pregnancy diagnosis.

[0416] Figure 16 These are somatic cell images derived from follicular fluid obtained through the OPU process ((a): MSTN mutant female, (b): wild type).

[0417] Figure 17 The results of T7E1 assays (a) and sequencing data (b) for MSTN mutant female blastocysts are shown (M: marker; WT: wild type; 1: MSTN mutant female; N: negative control; P: T7E1 positive control).

[0418] Figure 18 The results of T7E1 assay (a) and sequencing data of somatic cells from follicular fluid (b) are shown (1: MSTN mutant female (no wild type); 2: MSTN mutant female (no wild type)).

[0419] 2) Germline transmission of MSTN mutant males

[0420] Semen was collected from male bulls (F0) with a 10.5% mutation rate by electrostimulation. Samples were frozen for in vitro fertilization and thawed for sperm motility testing. Significant differences in forward cells (%), VCL, ALH, and BCF were observed between F0 and wild-type samples. However, no significant differences were observed in LIN and STR between F0 and wild-type samples. Figure 19Furthermore, when semen samples were used for in vitro fertilization, no adverse effects on embryonic development and fertility were observed. Oocytes collected from slaughterhouses were fertilized with freeze-thawed semen and cultured to form blastocysts. A total of 335 oocytes were used (replication count = 3). Of these, 261 oocytes (78.9 ± 10.8%) were cut, and 166 blastocysts (50.5 ± 6.8%) formed. Figure 20 The total cell count was 81.3 ± 20.6 (n = 20). Mutations were analyzed in 117 blastocysts, and 15 blastocysts showed MSTN mutations (12.7 ± 3.1%). Figure 21 ).

[0421] Figure 19 This paper presents a summary of semen analysis from male first-time semen producers at MSTN using computer-aided semen analysis.

[0422] Figure 20 Photographs of representative blastocysts (blastocysts produced in vitro by fertilization with semen from MSTN mutant bulls) are shown as validation results of germline transfer from MSTN mutant bulls.

[0423] Figure 21 The mutation rate of the MSTN gene in blastocysts derived from MSTN-mutant bull semen obtained through in vitro fertilization is shown (1 to 6: randomly selected blastocysts). The upper subplot (a) shows the T7E1 results, and the lower subplot (b) shows the sequencing results of the MSTN target site. <110> LART BIO <120> Transgenic animals with a modified myostatin gene <130> CP20-156 <160> 104 <170> KoPatentIn 3.0 <210> 1 <211> 60 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence (original spacer sequence) <400> 1 atacaataaa ctagtaaagg cccaactgtg gatatatctg aggcctgtca agactcctgc 60 60 <210> 2 <211> 47 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence (original spacer sequence) <400> 2 aaactagtaa aggcccaact gtggatatat ctgaggcctg tcaagac 47 <210> 3 <211> 46 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence (original spacer sequence) <400> 3 aaactagtaa aggcccaact gtggatatac tgaggcctgt caagac 46 <210> 4 <211> 45 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence (original spacer sequence) <400> 4 aaactagtaa aggcccaact gtggatatct gaggcctgtc aagac 45 <210> 5 <211> 44 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence (original spacer sequence) <400> 5 aaactagtaa aggcccaact gtggatatcg aggcctgtca agac 44 <210> 6 <211> 37 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence (original spacer sequence) <400> 6 aaactagtaa aggcccaact ctgaggcctg tcaagac 37 <210> 7 <211> 35 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence (original spacer sequence) <400> 7 aaactagtaa aggcccaact gaggcctgtc aagac 35 <210> 8 <211> 48 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence (original spacer sequence) <400> 8 aaactagtaa aggcccaact gtggatatat tctgaggcct gtcaagac 48 <210> 9 <211> twenty three <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 9 cccaactgtg gatatatctg agg 23 <210> 10 <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 10 tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> 11 <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 11 tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaaat gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> 12 <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 12 tttaaattta gcgctaagat acaatacaat aaactagtaa aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> 13 <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 13 tttaaattta gctctaagat acaatacaat aaactagtga aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> 14 <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 14 tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgttcaaa tcctgagact catcaaaccc 120 120 <210> 15 <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 15 tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> 16 <211> 108 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 16 tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaact gaggcctgtc 60 aagactcctg cgacagtgtt tgtgcaaatc ctgagactca tcaaaccc 108 <210> 17 <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 17 tttaaattta gcgctaagat acaatacaat aaactagtaa aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> 18 <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 18 tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaaat gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> 19 <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 19 tttaaattta gctctaagat acaatacaaa aaactagtaa aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> 20 <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 20 tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> twenty one <211> 108 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> twenty one tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaact gaggcctgtc 60 aagactcctg cgacagtgtt tgtgcaaatc ctgagactca tcaaaccc 108 <210> twenty two <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> twenty two tttaaattta gctctaagat acaatacaat aaattagtaa aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> twenty three <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> twenty three tttaaattta gctctaagat acaatacaat aaactagtga aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> twenty four <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> twenty four tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaagccc 120 120 <210> 25 <211> 120 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 25 tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaact gtggatatat 60 ctgaggcctg tcaagactcc tgcgacagtg tttgtgcaaa tcctgagact catcaaaccc 120 120 <210> 26 <211> 108 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 26 tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaact gaggcctgtc 60 aagactcctg cgacagtgtt tgtgcaaatc ctgagactca tcaaaccc 108 <210> 27 <211> 108 <212> DNA <213> Artificial sequence <220> <223> Artificial sequence <400> 27 tttaaattta gctctaagat acaatacaat aaactagtaa aggcccaact gtggcctgtc 60 aagactcctg cgacagtgtt tgtgcaaatc ctgagactca tcaaaccc 108 <210> 28 <211> 12 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 28 atatatccac ag 12 <210> 29 <211> 12 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 29 ctgtggatat at 12 <210> 30 <211> 371 <212> PRT <213> Artificial sequence <220> <223> Protomyosin <400> 30 Met Gln Lys Leu Gln Ile Ser Val Tyr Ile Tyr Leu Phe Met Leu Ile 1 5 10 15 Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn 20 25 30 Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Leu Trp Arg Glu Asn Thr 35 40 45 Thr Ser Ser Arg Leu Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu 50 55 60 Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln Leu 65 70 75 80 Leu Pro Lys Ala Pro Pro Leu Leu Glu Leu Ile Asp Gln Phe Asp Val 85 90 95 Gln Arg Asp Ala Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His 100 105 110 Ala Arg Thr Glu Thr Val Ile Thr Met Pro Thr Glu Ser Asp Leu Leu 115 120 125 Thr Gln Val Glu Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser 130 135 140 Lys Ile Gln Tyr Asn Lys Leu Val Lys Ala Gln Leu Arg Pro Val Lys 145 150 155 160 Thr Pro Ala Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met 165 170 175 Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp Met 180 185 190 Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu 195 200 205 Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly Ile Glu Ile Lys 210 215 220 Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr Phe Pro Glu Pro 225 230 235 240 Gly Glu Asp Gly Leu Thr Pro Phe Leu Glu Val Lys Val Thr Asp Thr 245 250 255 Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser 260 265 270 Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala 275 280 285 Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr 290 295 300 Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr 305 310 315 320 His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys 325 330 335 Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Glu 340 345 350 Gly Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys 355 360 365 Gly Cys Ser 370 <210> 31 <211> 371 <212> PRT <213> Artificial sequence <220> <223> Protomyosin <400> 31 Met Gln Lys Leu Gln Ile Tyr Val Tyr Ile Tyr Leu Phe Met Leu Ile 1 5 10 15 Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn 20 25 30 Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Met Trp Arg Gln Asn Thr 35 40 45 Lys Ser Ser Arg Leu Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu 50 55 60 Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln Leu 65 70 75 80 Leu Pro Lys Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val 85 90 95 Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His 100 105 110 Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Leu Leu 115 120 125 Met Gln Val Glu Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser 130 135 140 Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Arg Pro Val Lys 145 150 155 160 Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met 165 170 175 Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp Met 180 185 190 Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu 195 200 205 Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly Ile Glu Ile Lys 210 215 220 Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr Phe Pro Gly Pro 225 230 235 240 Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr 245 250 255 Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser 260 265 270 Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala 275 280 285 Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr 290 295 300 Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr 305 310 315 320 His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys 325 330 335 Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys 340 345 350 Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys 355 360 365 Gly Cys Ser 370 <210> 32 <211> 372 <212> PRT <213> Artificial sequence <220> <223> Protomyosin <400> 32 Met Met Gln Lys Leu Gln Met Tyr Val Tyr Ile Tyr Leu Phe Met Leu 1 5 10 15 Ile Ala Ala Gly Pro Val Asp Leu Asn Glu Gly Ser Glu Arg Glu Glu 20 25 30 Asn Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Ala Trp Arg Gln Asn 35 40 45 Thr Arg Tyr Ser Arg Ile Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys 50 55 60 Leu Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Ala Ile Arg Gln 65 70 75 80 Leu Leu Pro Arg Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp 85 90 95 Val Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr 100 105 110 His Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe 115 120 125 Leu Met Gln Ala Asp Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser 130 135 140 Ser Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Arg Pro Val 145 150 155 160 Lys Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro 165 170 175 Met Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp 180 185 190 Met Ser Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val 195 200 205 Leu Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly Ile Glu Ile 210 215 220 Lys Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr Phe Pro Gly 225 230 235 240 Pro Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Val Thr Asp 245 250 255 Thr Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His 260 265 270 Ser Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu 275 280 285 Ala Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Gly Tyr Lys Ala Asn 290 295 300 Tyr Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His 305 310 315 320 Thr His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys 325 330 335 Cys Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly 340 345 350 Lys Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg 355 360 365 Cys Gly Cys Ser 370 <210> 33 <211> 371 <212> PRT <213> Artificial sequence <220> <223> Protomyosin <400> 33 Met Gln Lys Leu Gln Leu Cys Val Tyr Ile Tyr Leu Phe Met Leu Ile 1 5 10 15 Val Ala Gly Pro Val Asp Leu Asn Glu Asn Ser Glu Gln Lys Glu Asn 20 25 30 Val Glu Lys Glu Gly Leu Cys Asn Ala Cys Thr Trp Arg Gln Asn Thr 35 40 45 Lys Ser Ser Arg Ile Glu Ala Ile Lys Ile Gln Ile Leu Ser Lys Leu 50 55 60 Arg Leu Glu Thr Ala Pro Asn Ile Ser Lys Asp Val Ile Arg Gln Leu 65 70 75 80 Leu Pro Lys Ala Pro Pro Leu Arg Glu Leu Ile Asp Gln Tyr Asp Val 85 90 95 Gln Arg Asp Asp Ser Ser Asp Gly Ser Leu Glu Asp Asp Asp Tyr His 100 105 110 Ala Thr Thr Glu Thr Ile Ile Thr Met Pro Thr Glu Ser Asp Phe Leu 115 120 125 Met Gln Val Asp Gly Lys Pro Lys Cys Cys Phe Phe Lys Phe Ser Ser 130 135 140 Lys Ile Gln Tyr Asn Lys Val Val Lys Ala Gln Leu Arg Pro Val Glu 145 150 155 160 Thr Pro Thr Thr Val Phe Val Gln Ile Leu Arg Leu Ile Lys Pro Met 165 170 175 Lys Asp Gly Thr Arg Tyr Thr Gly Ile Arg Ser Leu Lys Leu Asp Met 180 185 190 Asn Pro Gly Thr Gly Ile Trp Gln Ser Ile Asp Val Lys Thr Val Leu 195 200 205 Gln Asn Trp Leu Lys Gln Pro Glu Ser Asn Leu Gly Ile Glu Ile Lys 210 215 220 Ala Leu Asp Glu Asn Gly His Asp Leu Ala Val Thr Phe Pro Gly Pro 225 230 235 240 Gly Glu Asp Gly Leu Asn Pro Phe Leu Glu Val Lys Val Thr Asp Thr 245 250 255 Pro Lys Arg Ser Arg Arg Asp Phe Gly Leu Asp Cys Asp Glu His Ser 260 265 270 Thr Glu Ser Arg Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala 275 280 285 Phe Gly Trp Asp Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr 290 295 300 Cys Ser Gly Glu Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr 305 310 315 320 His Leu Val His Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys 325 330 335 Thr Pro Thr Lys Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys 340 345 350 Glu Gln Ile Ile Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys 355 360 365 Gly Cys Ser 370 <210> 34 <211> 108 <212> PRT <213> Artificial sequence <220> <223> Mature muscle somatostatin protein <400> 34 Phe Gly Leu Asp Cys Asp Glu His Ser Thr Glu Ser Arg Cys Cys Arg 1 5 10 15 Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp Trp Ile Ile 20 25 30 Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu Cys Glu Phe 35 40 45 Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His Gln Ala Asn 50 55 60 Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys Met Ser Pro 65 70 75 80 Ile Asn Met Leu Tyr Phe Asn Gly Glu Gly Gln Ile Ile Tyr Gly Lys 85 90 95 Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser 100 105 <210> 35 <211> 95 <212> PRT <213> Artificial Sequence <220> <223> Mature Myostatin Protein <400> 35 Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp 1 5 10 15 Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu 20 25 30 Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His 35 40 45 Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys 50 55 60 Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile 65 70 75 80 Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser 85 90 95 <210> 36 <211> 95 <212> PRT <213> Artificial sequence <220> <223> Mature muscle somatostatin protein <400> 36 Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp 1 5 10 15 Trp Ile Ile Ala Pro Lys Gly Tyr Lys Ala Asn Tyr Cys Ser Gly Glu 20 25 30 Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His 35 40 45 Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys 50 55 60 Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile 65 70 75 80 Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser 85 90 95 <210> 37 <211> 95 <212> PRT <213> Artificial sequence <220> <223> Mature muscle somatostatin protein <400> 37 Cys Cys Arg Tyr Pro Leu Thr Val Asp Phe Glu Ala Phe Gly Trp Asp 1 5 10 15 Trp Ile Ile Ala Pro Lys Arg Tyr Lys Ala Asn Tyr Cys Ser Gly Glu 20 25 30 Cys Glu Phe Val Phe Leu Gln Lys Tyr Pro His Thr His Leu Val His 35 40 45 Gln Ala Asn Pro Arg Gly Ser Ala Gly Pro Cys Cys Thr Pro Thr Lys 50 55 60 Met Ser Pro Ile Asn Met Leu Tyr Phe Asn Gly Lys Glu Gln Ile Ile 65 70 75 80 Tyr Gly Lys Ile Pro Ala Met Val Val Asp Arg Cys Gly Cys Ser 85 90 95 <210> 38 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 38 cggagtctat ataggtgtca 20 <210> 39 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 39 ggagtctata taggtgtcaa 20 <210> 40 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 40 gggttgacac ctatatagac 20 <210> 41 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 41 ccggagtcta tataggtgtc 20 <210> 42 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 42 tccgggttga cacctatata 20 <210> 43 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 43 ctatataggt gtcaacccgg 20 <210> 44 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 44 gtgtcaaccc ggaaatgatc 20 <210> 45 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 45 cagagtctat ataggtgtca 20 <210> 46 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 46 agagtctata taggtgtcaa 20 <210> 47 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 47 ccagagtcta tataggtgtc 20 <210> 48 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 48 gtgtcaaccc ggaaatgatg 20 <210> 49 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 49 cagagtttat ataggtatca 20 <210> 50 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 50 agagtttata taggtatcaa 20 <210> 51 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 51 tacctatata aactctgggc 20 <210> 52 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 52 tccgggttga tacctatata 20 <210> 53 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 53 ccagagttta tataggtatc 20 <210> 54 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 54 ttatataggt atcaacccgg 20 <210> 55 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 55 gtatcaaccc ggaaatgatg 20 <210> 56 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 56 cagactctat ataggtgtca 20 <210> 57 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 57 agactctata taggtgtcaa 20 <210> 58 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 58 ccagactcta tataggtgtc 20 <210> 59 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 59 tctatatagg tgtcaacccg 20 <210> 60 <211> 20 <212> DNA <213> Artificial sequence <220> <223> target sequence <400> 60 gtgacaaccc gaaaatgatg 20 <210> 61 <211> 77 <212> RNA <213> Artificial sequence <220> <223> guide RNA of Streptococcus pyogenes <400> 61 guuuuagucc cugaaaaggg acuaaaauaa agaguuugcg ggacucugcg ggguuacaau 60 ccccuaaaac cgcuuuu 77 <210> 62 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 62 gccucagaua uauccacagu 20 <210> 63 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 63 ccucagauau auccacaguu 20 <210> 64 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 64 cccaacugug gauauaucug 20 <210> 65 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 65 ggccucagau auauccacag 20 <210> 66 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 66 aggcccaacu guggauauau 20 <210> 67 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 67 gauauaucca caguugggcc 20 <210> 68 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 68 cacaguuggg ccuuuacuag 20 <210> 69 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 69 gucucagaua uauccacagu 20 <210> 70 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 70 ucucagauau auccacaguu 20 <210> 71 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 71 ggucucagau auauccacag 20 <210> 72 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 72 cacaguuggg ccuuuacuac 20 <210> 73 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 73 gucucaaaua uauccauagu 20 <210> 74 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 74 ucucaaauau auccauaguu 20 <210> 75 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 75 auggauauau uugagacccg 20 <210> 76 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 76 aggcccaacu auggauauau 20 <210> 77 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 77 ggucucaaau auauccauag 20 <210> 78 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 78 aauauaucca uaguugggcc 20 <210> 79 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 79 cauaguuggg ccuuuacuac 20 <210> 80 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 80 gucugagaua uauccacagu 20 <210> 81 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 81 ucugagauau auccacaguu 20 <210> 82 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 82 ggucugagau auauccacag 20 <210> 83 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 83 agauauaucc acaguugggc 20 <210> 84 <211> 20 <212> RNA <213> Artificial sequence <220> <223> Wizard sequence <400> 84 cacaguuggg cuuuuacuac 20 <210> 85 <211> 20 <212> DNA <213> Artificial sequence <220> <223> MSTN F primers <400> 85 aacagcgagc agaaggaaaa 20 <210> 86 <211> 20 <212> DNA <213> Artificial sequence <220> <223> MSTN R primers <400> 86 ccaggcgaag tttactgagg 20 <210> 87 <211> 20 <212> DNA <213> Artificial sequence <220> <223> GAPDH F primer <400> 87 ggcgtgaacc acgagaagta 20 <210> 88 <211> 54 <212> DNA <213> Artificial sequence <220> <223> GAPDH R primers <400> 88 gtgactggag ttcagacgtg tgctcttccg atcttgctct gccaaatacc agtg 54 <210> 89 <211> 20 <212> DNA <213> Artificial sequence <220> <223> MSTN F primers <400> 89 gaggtgttcg ttcgtttttc 20 <210> 90 <211> 20 <212> DNA <213> Artificial sequence <220> <223> MSTN R primers <400> 90 ctaccagttt cctgtgctta 20 <210> 91 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Off-target F primer <400> 91 tcagcacaga aaaggtgagg 20 <210> 92 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Off-target R primer <400> 92 gagacggaca caactgagca 20 <210> 93 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Off-target F primer <400> 93 tgagccccta ctttgtggac 20 <210> 94 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Off-target R primer <400> 94 gttttctggt aaggggtgca 20 <210> 95 <211> twenty two <212> DNA <213> Artificial sequence <220> <223> Off-target F primer <400> 95 ttgaaaacct agtggggaaa aa 22 <210> 96 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Off-target R primer <400> 96 gcactctcaa acactgtggc 20 <210> 97 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Off-target F primer <400> 97 tccttgcacc ttccaaaatc 20 <210> 98 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Off-target R primer <400> 98 atctgcgtgt aactccagcc 20 <210> 99 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Off-target F primer <400> 99 tcacccattc cagtccattt 20 <210> 100 <211> 20 <212> DNA <213> Artificial sequence <220> <223> Off-target R primer <400> 100 cctctaatgc cctcttgcag 20 <210> 101 <211> 20 <212> DNA <213> Artificial sequence <220> <223> MSTN-1 F primers <400> 101 gaggtgttcg ttcgtttttc 20 <210> 102 <211> 20 <212> DNA <213> Artificial sequence <220> <223> MSTN-1 R primers <400> 102 taagcacagg aaactggtag 20 <210> 103 <211> 53 <212> DNA <213> Artificial sequence <220> <223> MSTN-2 F primers <400> 103 acactctttc cctacacgac gctcttccga tctaacgcaa gtggaaggaa aac 53 <210> 104 <211> 54 <212> DNA <213> Artificial sequence <220> <223> MSTN-2 R primers <400> 104 gtgactggag ttcagacgtg tgctcttccg atcttgctct gccaaatacc agtg 54

Claims

1. An engineered cell comprising an artificially modified myostatin gene, in, The artificial modification is located in the second exon of the myostatin gene. The modification involves the deletion of 12 base pairs in the region corresponding to the amino acid sequence encoding leucine, tryptophan, isoleucine, and tyrosine in the second exon, compared to the amino acid sequence of wild-type prosomal somatostatin. The artificially modified myostatin gene encodes an engineered prosopakinone protein composed of amino acid sequences selected from SEQ ID NO: 30 to SEQ ID NO:

33. The engineered cells are adult stem cells or somatic cells of animals, and The engineered cells express the engineered promyosotherm protein.

2. The engineered cell as described in claim 1, wherein, The expression level of myostatin mRNA in the engineered cells was lower than that in the wild-type cells.

3. The engineered cell as described in claim 1, wherein, Compared to the amino acid sequence of wild-type tropomyostatin, the engineered tropomyostatin lacks the amino acid sequence LWIY.

4. An engineered cell comprising nucleic acid encoding an engineered prosopakinone protein consisting of an amino acid sequence selected from SEQ ID NO: 30 to SEQ ID NO:

33. in, The engineered cells are adult stem cells or somatic cells of animals, and The engineered protomyositis protein lacks the amino acid sequence LWIY compared to the amino acid sequence of the wild-type protomyositis protein.

5. A nucleic acid encoding an engineered prosopakinone protein composed of an amino acid sequence selected from SEQ ID NO: 30 to SEQ ID NO:

33. in, Compared to the amino acid sequence of wild-type tropomyostatin, the amino acid sequence of the engineered tropomyostatin lacks the amino acid sequence LWIY.

6. An engineered prosopakinone protein, wherein, Compared to wild-type troponin, the result was a deletion of four amino acids in the sequence leucine, tryptophan, isoleucine, and tyrosine. The amino acid sequence of the engineered promyosotherm protein is the sequence of SEQ ID NO: 30 to SEQ ID NO: 33.

Images