A rhizobium for promoting the production of beardless peas and its application

Abstract

The invention belongs to the technical field of agricultural microorganisms, and discloses a rhizobium for promoting the production of beardless bean tip peas and an application thereof. The strain number of the rhizobium R.fabae for promoting the production of beardless bean tip peas is P68-1, which was deposited in the China Center for Type Culture Collection in Wuhan University, Wuhan City, Hubei Province, China on September 4, 2018, and the deposit number is CCTCC NO:M 2018590. The invention widely collects pea nodules, separates and obtains more than 40 rhizobia, and conducts hydroponic tests and field tests with the main cultivated variety of Sichuan bean tip peas-beardless bean tip No. 1 peas, and conducts stress resistance, growth promotion and matching analysis on the strains screened out that have good matching with beardless bean tip peas and good field application effects of Sichuan beardless bean tip peas, so as to screen out high-efficiency pea rhizobia, and provide technical support for the high-yield, high-efficiency, high-quality and ecological and environmentally friendly production of Sichuan beardless bean tip peas.

Description

Technical Field

[0001] The invention belongs to the technical field of agricultural microorganisms, and in particular relates to a rhizobium for promoting the production of beardless peas and an application thereof. Background Art

[0002] At present, pea tips are popular high-end vegetables in winter and spring, and are deeply loved by consumers. "Beardless pea tips" belong to the edible seedling or tender pea tip type pea variety. It has thick leaves, tall stems, white flowers, thick stems, and compound leaves without tendrils, so it is named beardless peas. The produced bean tips have no tendrils, are more refreshing, tender and juicy, fragrant and delicious, and are of better quality than ordinary bean tips. There is no need to process and remove the whiskers, which will not cause new wounds to the bean tips, which is conducive to preservation. In addition, they grow vigorously and sell in large quantities around the Chinese New Year. Especially around the Chinese New Year, the price often exceeds the price of pork. It can be seen that beardless bean tips have the characteristics of high quality, delicious taste, high yield, and high economic value. They are very popular among growers and consumers and are widely planted in southern regions such as Sichuan, Guizhou, and Shanghai. Among them, the No. 1 beardless bean tip pea bred by the Sichuan Academy of Agricultural Sciences is superior to the domestic bean tip pea varieties. The average yield of fresh bean tips can reach 1,000 kg / mu, and the production cost is low. It is widely planted in the plains, hilly areas and mountainous areas of Chengdu, Sichuan Province, and tastes delicious. Fresh bean tips contain 43.72% crude protein, 4.67% crude fat, and a variety of amino acids. It is rich in nutrition and is widely used in the catering industry in Sichuan Province, with a high annual demand. In addition to being eaten, the remaining plant part of the beardless bean tip pea after harvesting the fresh bean tips of vegetables can also be used as an excellent green manure or feed. It is cold-resistant, drought-resistant, and has a wide adaptability. It plays an important role in preventing soil erosion and improving the quality of cultivated land.

[0003] However, in recent years, the national pea planting area and total output have declined year by year, and there is still a large gap in output compared with similar Western countries, which seriously restricts the development of the pea industry. The daily consumption of fresh bean tips in the catering industry in Sichuan Province is not proportional to the daily supply capacity, and there is a phenomenon of supply exceeding demand. It can be seen that beardless bean tip peas have great development potential. Beardless bean tip peas are generally sown in October of the previous year, and the bean tips are picked from November to April of the following year. They can be picked more than 6 times. In order to obtain high yield, in production, in addition to applying base fertilizer (organic fertilizer and mineral phosphorus and potassium fertilizer), topdressing (mainly nitrogen fertilizer) should be applied after each tip picking. However, peas are leguminous crops, and the pea-rhizobium nitrogen fixation system can provide 50% to 90% of nitrogen nutrition for peas. If the biological nitrogen fixation of rhizobia can be fully utilized, the application of nitrogen fertilizer can be greatly reduced and high yield, high quality, cost saving, and ecological and environmental protection can be achieved.

[0004] At present, the screening research on pea rhizobia is mostly seen in spring-sown pea areas such as Gansu, Liaoning, and Hebei. Pan Tingting et al. isolated 18 pea rhizobia from peas in saline-alkali soil in Hebei, and screened out 2 strains that efficiently nodulated and fixed nitrogen with the local variety of mosaic pea; Ning Guozan et al. collected pea nodules from many places across the country and isolated more than 90 pea rhizobia with nodulation and nitrogen fixation capabilities, screened out 5 strains that matched well with peas, and compiled them into the "China Agricultural Bacteria Catalog" and "China Bacteria Catalog"; Xie Junhong et al. conducted field trials on the 5 pea rhizobia included in the Chinese Bacteria Catalog and the main local pea varieties in Gansu to study their nitrogen fixation, nodulation effects and yields. The results showed that 2 of them had good nodulation and nitrogen fixation effects, and the yield increased by 36.1% to 66.3% compared with the uninoculated control, and the difference was significant compared with the other strains (P<0.05), indicating that the selected strains can promote the growth of the local main pea varieties. Guo Lizhuo et al. inoculated two excellent pea rhizobia, ACCC16101 and ACCC16103, selected by Ning Guozan et al., on spring-sown peas in Gansu. The peas inoculated with ACCC16103 had a significantly higher yield than CK, while ACCC16101 slightly reduced the yield of peas. The above-mentioned pea rhizobia screening was all for varieties of harvested dry peas, and mainly in the spring-sown areas in the north. However, there are no reports on the screening of efficient rhizobia matching the vegetable-type beardless bean tip pea variety. Generally speaking, the distribution of pea rhizobia has geographical differences and variety adaptability. The rhizobia adapted to peas in different ecological zones are not the same. Therefore, attention should be paid to the compatibility of peas and rhizobia in this ecological zone or ecological zones with similar conditions. There are few reports on the screening of efficient matching pea nodules in southwestern regions such as Sichuan and Chongqing. At present, there are no reports on the research of rhizobia suitable for efficient matching of beardless bean tip peas.

[0005] Existing studies have shown that a few rhizobia also have growth-promoting properties such as solubilizing phosphate and secreting growth hormones. Zhao Longfei and others collected, isolated and screened 324 soybean rhizobia from different regions of Henan Province and found that 36 rhizobia had the ability to solubilize phosphate, of which 20 had strong phosphate solubility. The rhizobium strain with the strongest phosphate solubility was DD291, which also promoted the growth of soybeans, showing potential application prospects.

[0006] Through the above analysis, the problems and defects of the prior art are as follows: currently, there is no report on the relevant technical solutions for the efficient screening of rhizobia matching vegetable-type beardless pea varieties. Summary of the invention

[0007] In view of the problems existing in the prior art, the present invention provides a rhizobium for promoting the production of beardless pea tips and application thereof.

[0008] The present invention is achieved by providing a rhizobium for promoting the production of beardless bean tip peas, the strain number of the rhizobium Rhizobiumfabae for promoting the production of beardless bean tip peas is P68-1, and it was deposited in the China Type Culture Collection Center in Wuhan University, Wuhan City, Hubei Province, China on September 4, 2018, and the preservation number is CCTCC NO:M 2018590.

[0009] Another object of the present invention is to provide a method for identifying rhizobia for promoting the production of beardless peas, the method comprising the following steps:

[0010] Step 1, separation, purification and preservation of rhizobia;

[0011] Step 2, using a hydroponic inoculation test to determine the initial screening strains of rhizobia;

[0012] Step 3, using field inoculation test to determine the rhizobium re-screening strains;

[0013] Step 4, using a matching test to determine the matching of the re-screened strain with other pea varieties;

[0014] Step 5, using a cross-nodulation test to determine if other host rhizobia are poorly compatible with pea;

[0015] Step 6: rescreen the strains for stress resistance and growth promotion;

[0016] Step seven, conduct multi-locus gene phylogenetic analysis on the re-screened rhizobium strains to determine the taxonomic status of the strains.

[0017] Furthermore, in step 1, rhizobia are isolated and purified from pea nodules, and strains having typical rhizobia colony characteristics and Gram-negative cells as shown by Gram staining are selected.

[0018] Furthermore, in step 2, a hydroponic inoculation test is carried out on the strains of step 1 using peas without beard tips, and strains with strong nodulation ability and good symbiotic nitrogen fixation effect under hydroponic conditions are preliminarily selected as the initial screening strains.

[0019] Furthermore, in step three, the initially screened strains are made into rhizobium agents and applied to the target areas, thereby obtaining re-screened strains that have strong nodulation and nitrogen fixation abilities under field conditions, the highest yield of fresh bean tips, and high yield of green manure or forage after harvesting the bean tips.

[0020] Furthermore, in step 4, a matching test is conducted between the re-screened strains and the main cultivated pea varieties mainly harvested from fresh green bean seeds or tender pods in the target area to clarify the matching of the strains with other pea varieties.

[0021] Furthermore, in step five, the re-screened rhizobium strain P68-1 and the highly efficient rhizobia of other major legume plants (hosts) authorized by Sichuan are simultaneously inoculated with a main pea variety in Sichuan, i.e., a cross-nodulation test is conducted to compare P68-1 to evaluate whether the rhizobia of other legume plants in Sichuan are also suitable for Sichuan peas.

[0022] Further, in step six, the acid-base resistance, salt resistance, IAA secretion ability, and growth promotion ability of the rescreened rhizobium strain P68-1 are analyzed;

[0023] Total DNA was extracted from strain P68-1, and the 16S rRNA gene and three housekeeping genes, recA, atpD and gInII, were sequenced to construct a phylogenetic tree and clarify the taxonomic status of strain P68-1.

[0024] Another object of the present invention is to provide a bacterial agent for promoting the production of beardless bean tip peas, wherein the bacterial agent for promoting the production of beardless bean tip peas contains the rhizobium for promoting the production of beardless bean tip peas.

[0025] In combination with the above technical solutions and the technical problems solved, the advantages and positive effects of the technical solutions to be protected by the present invention are as follows:

[0026] First, the present invention widely collects pea nodules in Sichuan Province, isolates and obtains more than 40 rhizobia, conducts hydroponic tests (preliminary screening) and field tests (rescreening) with the main cultivated variety of Sichuan bean tip peas - beardless bean tip No. 1 pea, and then conducts stress resistance and growth promotion analysis on the strains screened out that have good matching with beardless bean tip peas and good field application effects of Sichuan beardless bean tip peas, to explore their stress resistance and other growth promotion functions; and simultaneously inoculates the same Sichuan pea variety with efficient rhizobia of other legumes in Sichuan, evaluates whether the existing rhizobia of other plants are suitable for peas, thereby evaluating the importance of rescreening strains; and simultaneously uses multi-site gene sequence analysis to perform classification status analysis and matching analysis with other pea varieties in Sichuan, aiming to screen out efficient pea rhizobia with the best matching with Sichuan beardless bean tip peas, good matching with other pea varieties, strong stress resistance and growth promotion, and the best field application, so as to provide technical support for the high-yield, high-efficiency, high-quality, ecological and environmentally friendly production of Sichuan beardless bean tip peas.

[0027] The present invention provides a rhizobium R.fabae P68-1 that is suitable for the ecological environment of Sichuan, has good compatibility with the main cultivated variety "beardless bean tip pea" in Sichuan, and has good field application effect, and its promotion and application in Sichuan. The key technical points that can bring beneficial effects to the present invention are as follows: ① The strain R.fabae P68-1 is a specific and efficient strain that has good affinity with the main cultivated variety "beardless bean tip pea" in Sichuan and has the best field application effect. ② The strain R.fabae P68-1 not only has efficient nitrogen fixation, but also has the ability to dissolve inorganic phosphorus and organic phosphorus, and has the growth-promoting effects such as secreting plant growth hormone (IAA), and has strong acid and alkali resistance. ③ The strain R.fabae P68-1 is an excellent rhizobium suitable for the growth and development of beardless bean tip peas in the Sichuan habitat. In the production of beardless bean tip peas, the strain R.fabae is inoculated. After P68-1, the plant dry weight, nodule number, SPAD value, bean tip yield, and the accumulation of nitrogen, phosphorus and potassium nutrients in green manure or forage produced after bean tip harvest were significantly higher than those of the non-inoculated control, and there was a significant yield-increasing effect. The yield of fresh bean tip increased by 23.8% compared with the non-inoculated CK, the green manure yield increased by 45.7% compared with the CK, and was 3.5% to 26.6% higher than that of the other strains; the forage yield was 37.3% higher than that of the CK, and was 1.5% to 26.6% higher than that of the other strains. 31.9%; the total nitrogen content of the green manure or forage drying base is 27.7% higher than that of CK and 2.9% to 33.6% higher than that of the other strains; the total nitrogen accumulation is 75.2% higher than that of CK and 7.7% to 76.1% higher than that of the other strains; the total phosphorus accumulation is 56.9% higher than that of CK and 15.9% to 46.1% higher than that of the other strains; the total potassium accumulation is 60.7% higher than that of CK and 1.2% to 42.8% higher than that of the other strains. In summary, the pea rhizobium R.fabae P68-1 provided by the present invention can be promoted and applied in the production of Sichuan beardless bean tip peas.

[0028] Second, the present invention provides a pea rhizobium P68-1 that is specific and efficient in nitrogen fixation for the main pea variety grown in Sichuan - beardless bean tip pea. The present invention provides the application effect of a specific and efficient nitrogen fixation pea rhizobium P68-1 in the production of beardless bean tip pea, the main pea variety grown in Sichuan. At the same time, the present invention also provides the stress resistance and growth promotion effect of the efficient nitrogen fixation pea rhizobium, as well as the classification status of the efficient nitrogen fixation rhizobium.

[0029] Third, the expected benefits and commercial value after the transformation of the technical solution of the present invention are as follows: P68-1 can be developed into a rhizobium agent suitable for the cultivation of Sichuan bean tip peas, which can greatly increase the yield of pea tips and thus improve the economic value; at the same time, the agent can be developed into a commercial agent to replace chemical fertilizers in the production process of bean tip peas, saving costs. The developed agent commodity has economic value, and the harvest of higher-yield and high-quality pea tips (as vegetables) also increases the economic value.

[0030] At the same time, after harvesting the bean tip peas, the remaining plants are still green and can be used as green manure or feed. If used as fertilizer, it can also reduce the amount of nitrogen, phosphorus and potassium fertilizers used in the big spring crops to a certain extent, that is, it has the effect of reducing weight and increasing efficiency for the next big spring crops such as corn. It not only saves fertilizer costs in the production of the next crop, but also, as is known, green manure can effectively improve soil fertility and improve soil structure. Therefore, while having economic value, it also has a good ecological environment effect. If dried and used as feed, after inoculation with rhizobia, the nitrogen content of the dry plants increases and the quality is enhanced. As feed, it can reduce the use of other commercial feeds and create economic value accordingly.

[0031] The technical solution of the present invention fills the technical gaps in the industry at home and abroad: A: The excellent rhizobia of other legumes in this region, such as the southwest region, cannot replace the pea rhizobia of the present invention. Because the rhizobia of legumes have certain host specificity, as in Example 6 of this patent, the patented excellent rhizobia of soybeans, purple vetch, arrow peas, and broad beans in Sichuan, some do not nodulate when inoculated with peas, and some form a small number of invalid nodules. Only P68-1 is separated and screened from peas. When inoculated with peas, the number of nodules is large, which significantly promotes the growth of peas. B: The excellent rhizobia isolated and screened in other regions are not suitable for the ecological environment of Sichuan. Because the most effective rhizobia in a certain area often come from strains in this region or regions with similar conditions to this region. Therefore, the excellent rhizobia screened must pay attention to the regionality of the application of the microbial agent. The pea rhizobia screened in the southwest region are suitable for the southwest region, while the excellent pea rhizobia screened from other regions with large differences in ecological environment from the southwest region are often not suitable for Sichuan. C: There is no report on pea rhizobium with field application value in the southwest region. In summary, the strain P68-1 of the present invention fills the gap of excellent pea rhizobium with field application value in Sichuan. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] In order to more clearly illustrate the technical solutions of the embodiments of the present invention, the following briefly introduces the drawings required for use in the embodiments of the present invention. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0033] Figure 1 This is a flow chart of a method for identifying rhizobia that promotes the production of beardless pea tips provided by an embodiment of the present invention;

[0034] Figure 2 is a phylogenetic diagram of the 16S rRNA gene sequence of the beardless pea rhizobium strain P68-1 provided in an embodiment of the present invention;

[0035] Figure 3It is a phylogenetic diagram jointly constructed by the three housekeeping genes recA, atpD and gInII of the beardless pea rhizobium strain P68-1 provided in an embodiment of the present invention. DETAILED DESCRIPTION

[0036] In order to make the purpose, technical solution and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with the embodiments. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0037] In view of the problems existing in the prior art, the present invention provides a rhizobium for promoting the production of beardless peas and its application. The present invention is described in detail below in conjunction with the accompanying drawings.

[0038] The strain number of the rhizobium Rhizobiumfabae for promoting the production of beardless bean tip peas provided in the embodiment of the present invention is P68-1, which was deposited in the China Type Culture Collection Center in Wuhan University, Wuhan City, Hubei Province, China on September 4, 2018, and the deposit number is CCTCC NO: M 2018590.

[0039] like Figure 1 As shown, the method for identifying rhizobia that promotes the production of beardless peas provided in the embodiment of the present invention comprises the following steps:

[0040] S101, isolation, purification and preservation of rhizobia;

[0041] S102, using hydroponic inoculation test to determine the initial screening strains of rhizobia;

[0042] S103, using field inoculation experiments to determine the rhizobium rescreening strains;

[0043] S104, using matching test to determine the matching of rescreened strains with other pea varieties

[0044] S105, cross-nodulation test confirmed that rhizobia from other leguminous crops in Sichuan are not suitable for Sichuan pea

[0045] S106: Rescreening of strains for stress resistance and growth promotion

[0046] S107: Housekeeping gene amplification and phylogenetic analysis of multiple screening strains to determine taxonomic status

[0047] As a preferred embodiment, the method for identifying rhizobia that promotes the production of beardless peas provided in the embodiment of the present invention specifically comprises the following steps:

[0048] (1) isolating and purifying rhizobia from pea nodules, and selecting strains with typical rhizobia colony characteristics and Gram-negative cells in the form of small rods as determined by Gram staining;

[0049] (2) performing a hydroponic inoculation test on the strains obtained in step (1) using peas without beard tips, and preliminarily selecting strains with strong nodulation ability and good symbiotic nitrogen fixation effect under hydroponic conditions as primary screening strains;

[0050] (3) The primary screened strains were made into rhizobium inoculants and applied to the Chengdu Plain, the main production area of ​​beardless peas in Sichuan, to screen out secondary screened strains with strong nodulation and nitrogen fixation ability under field conditions, the highest yield of fresh bean tips, and high yield of green manure or forage after harvesting bean tips;

[0051] (4) Conduct a compatibility test between the rescreened strains and the main pea varieties grown in Sichuan, mainly fresh green bean seeds or tender pods, to clarify the compatibility of the strains with other pea varieties;

[0052] (5) Cross-nodulation experiments determined that the excellent rhizobia of other legumes in Sichuan were not suitable for Sichuan peas;

[0053] (6) Analyze the acid-base and salt resistance, IAA secretion ability and phosphate solubilization growth-promoting property of the rescreened rhizobium strain P68-1;

[0054] (7) Total DNA was extracted from strain P68-1, and the 16S rRNA gene and three housekeeping genes, recA, atpD, and gInII, were sequenced to construct a phylogenetic tree and clarify the taxonomic status of strain P68-1.

[0055] No.1 Rhizobium leguminosarum P68-116S rRNA gene sequence:

[0056]

[0057] No. 2 recA gene sequence:

[0058] aaactcggctccaacgagaatgttgtcgagatcgaaacgatttcgaccggctcgcttggcctcgatattgcactcggcgttggtggcctgccgaggggccgcatcatcgagatctacgggccggaaagctcgggtaaaacgacgcttgctttgcagaccattgccgaagcgcagaagaagggtggcatctgcgccttcgtcgatgccgaacatgcgctcgatccggtctatgcccgcaagcttggcgtcgatctgcagaaccttctgatctcacagcccgataccggcgaacaggcgcttgaaattaccgatacgctggtgcgctccggcgccgtcgacgtccttgtcgtcgactcggtcgccgcgctgacgccacgcgccgaaatcgaaggcgagatgggcgacagccttcccggcctgcaggcccgcctgatgagccaggcgctgcgcaagctcaccgcttcgatctcgaagtcgaacaccatggtcatcttcatcaaccagatcc

[0059] No. 3 atpD gene sequence:

[0060] gacctcaacgtcatcggcgagcccgtcgacgaagccggtccgctggtcaccgctcacaagcgcgccattcaccaggatgcgccgtcttacgttgagcagtcgacggaagcgcagatcctcgttaccggcatcaaggtcgtcgatcttctcgctccttacgcacgcggcggcaagatcggcctcttcggcggcgccggcgtcggcaagacggttctgatcatggaactgatcaacaacgtcgctaaggcgcatggtggttattcggttttcgcaggcgtcggtgaacgtacccgcgaaggcaacgacctttaccacgaaatgatcgaatcgaacgtcaacaagcacggcggcggcgaaggctccaaggctgcgctcgtttacggccagatgaacgaaccgccgggcgcccgcgcccgcgtcgctctgacgggtctgactgtcgccgaacacttccgcgaccagggccaggacgttctgttcttcgtcgacaacatcttccgcttcacg

[0061] No. 4 glnII gene sequence:

[0062] cgatgggtacactccggtaccgaacctgcgtggcaagacgcagatcaaggaatttgacgtattcccgacgctggaacagcttccgctctggggctttgacggctcctcgacgatgcaggccgaaggccgcagctccgattgcgtgctgaagcccgtcgc catctatcccgacccggcccgcaccaacggcgcgctcgtcatgtgcgaagtcatgatgcccgatggcgtcacgccgcacgcatcgaatgcccgcgccaccatcctcgacgacgaagatgcctggttcggcttcgagcaggaatatttcttctatcagaa cggccgtccgctcggcttccccgagcagggctacccggctccgcagggtccttactacaccggcgtcggctattctaacgtcggcgacgtcgcccgcgaaatcgtcgaagaacatctcgacctctgcctggctgccggcatcaaccacgaaggcatcaa tgctgaagtggccaagggccagtgggaattccagattttcggcaagggctccaagaaggccgccgaccagatctggatggctcgctacctgctgcagcgcctgaccgaaaagtacggcatcgacatcgagtatcattgcaagccgctcggcgacaccgac

[0063] The application embodiment of the present invention provides a bacterial agent for promoting the production of beardless bean tip peas, and a rhizobium bacterial agent for promoting the production of beardless bean tip peas.

[0064] The application embodiment of the present invention provides an application of rhizobium for promoting the production of beardless bean tips peas and / or a bacterial agent for promoting the production of beardless bean tips peas in the preparation of a product for promoting the production of beardless bean tips peas.

[0065] Example 1: Isolation, purification and preservation of rhizobia

[0066] The embodiment of the present invention mainly selects large and full red nodules on the main roots of pea plants in the flowering period from peas grown in nearly 20 cities and counties across Sichuan Province, cleans the nodules, picks them with part of the root bark, smears them dry with paper and puts them in a small tube filled with anhydrous calcium chloride and covered with absorbent cotton. The collected nodules were soaked in sterile water for swelling, treated with 95% ethanol for 5 minutes, and surface sterilized with 0.1% mercuric chloride for 5 minutes, then rinsed with sterile water for 6 times. Under sterile operation, a single nodule was broken with a clip and streaked on YMA medium (mannitol 10 g, yeast powder 0.8 g, KH2PO4 0.25 g, MgSO4·7H2O 0.2 g, CaCl2·6H2O 0.1 g, NaCl 0.1 g, sodium molybdate (1%) 2 mL, boric acid (1%) 2 mL, Congo red (1%) 2.5 mL, pH 6.8-7.0, agar 18-20 g, water 1000 mL), and cultured in an incubator at 28°C.

[0067] After the colonies grow, select the colonies that do not absorb red and look like rhizobia from the plate, dilute and streak them on the plate for culture. Observe the colony morphology for about 3 days, and continue to observe for about 15 days, repeat the dilution and streaking separation until purification. Preliminary judgment of whether it is rhizobia is based on the following two aspects: (1) Colony morphology on YMA medium with Congo red: no absorption of red, round, milky white, raised colonies, neat edges that do not spread, smooth surface, relatively viscous and relatively moist. Those that grow colonies after 3 to 5 days of culture are fast-growing rhizobia, and those that grow colonies after 5 to 10 days of culture are slow-growing rhizobia. (2) Cell morphology: Mark the confirmed rhizobia colonies, prepare slides for Gram staining, and the microscopic examination results of rhizobia are small rod-shaped cells with uniform morphology, no spores, and cells often contain β-hydroxybutyric acid in the form of rings. Gram-negative (G - ). If the above-mentioned marked colony has the above-mentioned two characteristics, the colony is inoculated into a test tube slant culture of YMA medium for preservation.

[0068] A total of 43 pea rhizobia strains were obtained by separation and purification provided in the embodiment of the present invention, all of which were fast-growing rhizobia. When cultured on YMA medium with Congo red, the bacteria did not absorb red, and the colonies were small, round, milky white, viscous, with a high degree of protrusion and no turbidity. Gram staining microscopy showed that the strains were G - , in the shape of a small rod. Twelve strains with high efficiency were selected from the nodulation test results of pea without beard tip. These 12 strains were used as test strains for further analysis. The information of these 12 strains is shown in Table 1.

[0069] Table 1 Basic information of the tested strains

[0070]

[0071] Note: a- hydroponic inoculation test (primary screening); b- field verification test (rescreening); c- matching test; d- stress resistance and growth promotion test; e- phylogenetic analysis.

[0072] Example 2: Hydroponic inoculation test of rhizobia (preliminary screening)

[0073] The pea variety used in the above-mentioned pea rhizobium inoculation test is the main variety in the southwest, "No. 1 Bean Tip without Beard". In a light room (temperature control 22-24°C, light intensity 2700-3000 lux, sunshine time 10-12h / d), the isolated and purified target strain (see Table 1) was inoculated with "No. 1 Bean Tip without Beard", and the control was not inoculated with pea rhizobium, and sterile nitrogen-free nutrient solution was regularly supplemented. Harvest after 50 days of planting. After harvesting, the number of pea nodules, plant dry fresh weight, and plant height were used to evaluate the inoculation effect of pea rhizobium. Strains with strong nodulation ability and good symbiotic nitrogen fixation effect were preliminarily screened.

[0074] (1) Bacterial liquid culture: The above-mentioned Rhizobium leguminosarum (see Table 1) was inoculated into YMA liquid culture medium and cultured on a shaker at 120 rpm / min at 28°C until the logarithmic growth phase (about 3 days).

[0075] (2) Seed germination: Select large, plump and undamaged pea seeds. Use sterilized tweezers to place the seeds in sterilized sawdust. Place the seeds in a 25°C incubator for germination for 3 to 4 days. Sow the seeds when the taproot grows to 4 to 5 cm in length and fibrous roots have not yet grown.

[0076] (3) Preparation of hydroponic device: Use a 250 mL narrow-necked bottle (glass infusion bottle used in hospitals) as a hydroponic device. First, prepare nitrogen-free nutrient solution, inject the prepared nitrogen-free hydroponic nutrient solution into the cleaned bottle, cover the bottle mouth with a layer of kraft paper, make a small hole (about 1 cm in diameter) in the center of the bottle mouth, plug the hole with cotton, cover it with a layer of high-temperature resistant plastic film, and sterilize it at 121°C for later use.

[0077] (4) Inoculation of rhizobia, sowing, and measuring indicators: First, sow CK and insert the roots into the small holes of the hydroponic container, one plant per bottle.

[0078] Take one slant bacterial test tube each, add 4 mL of sterile water, scrape and wash the bacterial moss to make a bacterial suspension, dip the roots into the bacterial suspension, and insert them into the small hole of the hydroponic device, 1 plant per bottle. Use a sterile pipette to add 1 mL of bacterial solution to each bottle. Cultivate in a light room (temperature control 22-24°C, light intensity 2700-3000 lux, sunshine time 10-12h / d) for 50 days, and replenish nutrient solution in time during the cultivation period. Repeat each treatment three times. After harvesting, count the number of nodules, measure the plant height, and weigh the dry weight of the part above the root (first kill at 105°C for 10 minutes, then dry at 65°C to constant weight). The results of the hydroponic test are listed in Table 2.

[0079] The results in Table 2 show that the 12 strains used for inoculation in No. 1 beardless bean tip all nodulate, while CK does not nodulate, indicating that these 12 strains are pea rhizobia. The number of nodules is 13 to 35 per strain, indicating that these strains have good nodulation ability for No. 1 beardless bean tip, but there are differences between different strains. The plant height varies greatly, and the height of peas inoculated with 50% of the strains is less than that of CK. The dry weight of the plant is also closely related to the inoculated strain. The dry weight of 3 / 12 strains is lower than that of CK, and they are called invalid strains in the present invention; strains with an increase of ≤20% in plant dry weight compared with CK are called inefficient strains in the present invention; strains with an increase of >20% in plant dry weight compared with CK are called primary screening efficient strains in the present invention. As can be seen from Table 2, for the 12 isolated pea rhizobia, for the No. 1 beardless bean tip variety, 58% of the ineffective and inefficient strains are 58%, and the primary screening efficient strains are 42%. In summary, the highly efficient strains initially screened out in the hydroponic inoculation test are P38-1, P52-2, P64-1, P68-1, and P76-1, but these strains still need to be verified by field inoculation tests.

[0080] Table 2 Results of hydroponic experiment on pea rhizobium and pea without beard tip No. 1

[0081]

[0082]

[0083] Note: The above data are the average values ​​of 3 replicates.

[0084] Example 3: Field inoculation effect (rescreening)

[0085] The field inoculation test of the strain provided in the embodiment of the present invention was carried out in Chongzhou City in the Chengdu Plain area.

[0086] The five highly efficient strains P38-1, P52-2, P64-1, P68-1, and P76-1 initially screened by the above hydroponic backgrafting were used as test strains. The bean variety selected was the bean variety "Wushu Doujian No. 1", which is mainly cultivated in Sichuan. No chemical fertilizers or organic fertilizers were applied. The field random block arrangement was adopted. The experiment was carried out from October 2016 to April 2017. The prepared rhizobium inoculant (viable bacteria count 230 million CFU / g inoculant) was mixed with pea seeds, dried in the shade and sown in holes, 3 seeds per nest, 2 seedlings were fixed, and the area of ​​the plot was 8.4m 2, the nest spacing is 23cm, the row spacing is 23cm, and CK is sown first when sowing to avoid the influence of CK treatment on inoculated rhizobia. The bean tips are picked at 64d, 76d, and 95d of the growth period to determine the fresh yield of bean tips; the plants after picking the bean tips can be used as high-quality green manure and forage. The present invention uses the fresh and living plants of the aboveground part as green manure and the aboveground plants after drying as forage. The samples are collected in the late flowering period of the plants (about 20d before sowing summer corn), and the plant height, nodule number, chlorophyll SPAD value, green manure yield (fresh weight of the aboveground part) and forage yield (dry weight of the aboveground part) are determined, and the nitrogen, phosphorus, potassium nutrient content and nutrient accumulation of the aboveground plants are determined. Field management is carried out according to the conventional method of planting peas by local farmers.

[0087] Table 3 Field test results of pea rhizobium and beardless pea

[0088]

[0089] Table 4 Effects of rhizobium inoculation on nutrient content and accumulation of green manure or forage after tip removal of beardless pea

[0090]

[0091] Note: The above data are the average values ​​of 3 repeated drying samples.

[0092] As shown in Tables 3 and 4, the number of nodules, SPAD value, bean tip yield, green manure yield, forage yield and the accumulation of nitrogen, phosphorus and potassium in green manure and forage of P68-1 treatment were significantly higher than those of CK and the other five strains. The number of nodules per plant of P68-1 treatment was 2.3 times higher than that of CK and 0.6-2.5 times higher than that of the other strains; the chlorophyll SPAD value was 21.2% higher than that of CK and 1.7%-14.7% higher than that of the other strains; the yield of fresh bean tip was 23.8% higher than that of CK and 6.9%-14.6% higher than that of the other strains; the green manure yield was 45.7% higher than that of CK and 3.5%-26.6% higher than that of the other strains; the forage yield was 37.3% higher than that of CK and 1.5%-31.9% higher than that of the other strains; the total nitrogen content of green manure or forage drying base was 27.6% higher than that of CK and 2.5% higher than that of the other strains. %~33.6%; total nitrogen content was 27.7% higher than CK and 2.9%~33.6% higher than other strains; total nitrogen accumulation was 75.1% higher than CK and 7.7%-76.1% higher than other strains; total phosphorus content was 14.4% higher than CK and 10.8%~22.6% higher than other strains; total phosphorus accumulation was 56.9% higher than CK and 15.9%~46.1% higher than other strains; total potassium content was 17.6% higher than CK and -3.7%~22.7% higher than other strains; total potassium accumulation was 60.7% higher than CK and 1.2%~42.8% higher than other strains. It shows that P68-1 is the rhizobium with the best matching performance with beardless pea and the best field application effect, and has application and promotion value.

[0093] Example 4: Compatibility of Rhizobium P68-1 with Snow Peas and Chinese Pea No. 6

[0094] The strain P68-1 with the best match with beardless pea and the best field application among the above isolated strains was used as the test strain to investigate the match between this strain and the main varieties of snow pea and Zhongwan No. 6 in Sichuan, which are harvested as vegetables with tender pods and fresh seeds. Seeds with basically the same seed coat color for each pea variety were selected and surface disinfected. For Zhongwan No. 6, which is harvested as fresh seeds, the seeds were soaked in sterile water overnight and sown on sterilized vermiculite for germination (25°C). Sterile water was added in time during the period. The seeds that had just grown radicles were planted in the upper plastic cups of double-layer pots, one plant per cup, and inoculated with the test strain P68-1 (cultured in a shaker at 28°C, 120r / min with YMA liquid culture to the logarithmic growth phase), and the treatment without inoculation of rhizobia was used as the control (CK). Each treatment was repeated 3 times. The plants were harvested after 42 days of cultivation in a light room (temperature 22-24°C, light intensity of about 3500 lux, daylight time 12h / d). Sterile low-nitrogen nutrient solution was regularly added during the cultivation period, and plant height, number of nodules and dry weight of the plants were measured after harvest. The snow pea variety was cultivated using the hydroponic method, the same method as the previous grafting test, and the same light room. Therefore, the temperature, light intensity, daylight time, etc. of the light room were the same as the previous hydroponic grafting test, and the snow pea was cultivated for 50 days.

[0095] Table 5 Compatibility test results of pea rhizobium P68-1

[0096]

[0097] Note: Data are the average of three replicates.

[0098] The matching results are listed in Table 5. From Tables 3 to 5, it can be seen that P68-1 not only has the best matching and field application with the beardless pea, but also has a good matching with the snow pea, which is mainly harvested as a vegetable with fresh pods, and the Zhongwan No. 6, which is harvested as a vegetable with fresh beans. Compared with the uninoculated CK, the plant dry weight increased by 48.5% to 82.7%, and the nodulation ability was strong, with 58.7 to 88.0 nodules per plant.

[0099] Example 5: Cross-nodulation test of Sichuan other bean species rhizobia and Sichuan pea

[0100] Can the patented strains of efficient rhizobia of soybean, broad bean, legume green manure purple vetch and arrow pea, which are suitable for Sichuan habitat, form nodules with peas and efficiently fix nitrogen? To this end, the typical patented strains of these bean species and the strain P68-1 were used as test strains, and a matching test was conducted with another main cultivated variety "Taiwan Changshouren" that is commonly used in Sichuan to harvest fresh seeds as vegetables in recent years. The seeds of "Taiwan Changshouren" peas with basically the same grain size and seed coat color were selected and surface disinfected; then the seeds were soaked in sterile water overnight and sown on sterilized vermiculite for germination (25℃), and sterile water was added in time during the period. The seeds that had just grown radicles were planted in the upper plastic cups of double-layer pots, one plant per cup, and the P68-1 test strain was inoculated (cultured to the logarithmic growth phase using YMA liquid culture in a shaker at 28℃, 120r / min), and the treatment without rhizobia inoculation was used as the control (CK). Each treatment was repeated 3 times. The plants were harvested after 36 days of cultivation in a light room (temperature 22-24°C, light intensity of about 3500 lux, daylight hours 12 h / d). Sterile low-nitrogen nutrient solution was regularly added during the cultivation period. Plant height, nodule number and plant dry weight were measured after harvest. The test results are listed in Table 6.

[0101] Table 6 Results of cross-nodulation tests between P68-1 and other Sichuan soybean varieties and the main patented strains and pea

[0102]

[0103] The results in Table 6 show that when peas were inoculated with 4 soybean rhizobia, no nodules were formed on the peas and the nodules were ineffective for the growth of the peas; 4 broad bean rhizobia could nodulate the peas, but the number of nodules was small and the nodule formation was inefficient or ineffective for the growth of the peas; 6 arrowroot pea rhizobia had a nodulation rate of 0 to 23 per plant, two strains slightly increased the dry weight of the pea plants, and 4 strains reduced the dry weight of the pea plants by 1.9% to 14.3%, which were all inefficient and ineffective; 3 purple vetch rhizobia had a nodulation rate of 0 to 18.9 per plant, two strains reduced the dry weight of the pea plants by 2.1% to 25.7%, and 1 strain slightly increased the dry weight of the pea plants by 4.3%. This means that the soybean, broad bean, arrow pea and purple vetch rhizobia of these patented rhizobia applicable to Sichuan are not compatible with peas, that is, they are invalid or inefficient strains for peas, and are strains that do not match peas. Only strains isolated and screened from peas can be highly effective for the growth of peas.

[0104] Example 6: Stress resistance of Rhizobium P68-1

[0105] The strain P68-1, which was screened out in the primary and secondary screening and had the best match with the beardless pea and the best field application, was tested for acid, alkali and salt resistance. YMA medium was used as the basic medium, and the colonies grown on the YMA plate cultured at pH 7 and 28℃ for 7 days were used as positive controls.

[0106] The YMA slant culture of P68-1 was scraped and washed with sterile water for later use. The spot inoculation method was used and repeated 3 times. YMA medium was used as the basic medium for acid and alkali resistance determination, and the pH value was adjusted with HCl and NaOH. The pH values ​​were 4.0, 5.0, 6.0, 8.0, 9.0, 10.0, and 11.0, respectively.

[0107] The salt tolerance test also used YMA medium as the basic medium, and the strain was inoculated on a plate containing NaCl, and the mass volume fraction of NaCl was 0.2%, 0.4%, 0.6%, 1%, 1.5%, 2.5%, 3.5%, and 4.5%. The plates for acid and alkali resistance and salt resistance tests were cultured at 28°C for 7 days and the results were observed and recorded.

[0108] The test results show that the test rhizobium P68-1 can grow on plates with a pH of 4 to 11, but the colonies on the plates with excessive acidity or alkalinity are smaller than the positive control at pH 7, indicating that excessive acidity or alkalinity has a certain inhibitory effect on P68-1; P68-1 can grow on YMA plates with a NaCl content of 0.2% to 0.6%, and has a certain salt tolerance.

[0109] Example 7: Growth-promoting ability of Rhizobium P68-1

[0110] The growth-promoting ability of P68-1 was mainly examined in terms of its ability to secrete auxin (IAA) and its ability to solubilize phosphate.

[0111] (1) Determination of the ability to secrete auxin

[0112] The performance of rhizobium secreting auxin was determined by colorimetry, using a modified Congo red liquid medium, the formula of which was: 1.0 g yeast powder, 10.0 g mannitol, 0.2 g MgSO4·7H2O, 0.5 g K2HPO4·3H2O, 0.1 g NaCl, 100 mg / L L-tryptophan, 10 mL Congo red (0.25%), 1000 mL distilled water, pH 6.8-7.2. The colorimetric solution formula was: 1 mL 0.5 M FeCl3, 30 mL concentrated H2SO4, and 50 mL distilled water.

[0113] The strain was inoculated into a triangular flask containing 50 mL of modified Congo red liquid medium, placed on a constant temperature shaker at 160 rpm / min and cultured at 28 ° C for 12 days, centrifuged at 8000 rpm / min for 10 min, 10 mL of supernatant was taken, 10 mL of colorimetric solution was added, and the mixture was protected from light for 30 min. The OD value was measured using an ultraviolet spectrophotometer at a wavelength of 530 nm. Preparation of standard curve: IAA stock solution was used to prepare a series of standard solutions of 0, 5, 10, 20, and 40 μg / mL as working solutions. Then the IAA content of strain P68-1 was converted according to the standard curve. The results showed that rhizobium P68-1 secreted 19.08 μg / mL of IAA, indicating that rhizobium P68-1 has a strong ability to secrete IAA.

[0114] (2) Ability to dissolve organic and inorganic phosphorus

[0115] The organic phosphorus source is lecithin, and the three inorganic phosphorus sources (calcium phosphate, iron phosphate, and aluminum phosphate) are all commercially available analytically pure reagents. NBRIP medium: glucose 10 g, KCl 0.2 g, MgCl2·2H2O 5 g, (NH4)2SO4 0.1 g, MgSO4·7H2O 0.25 g, Ca3(PO4)2 (or FePO4·2H2O, AlPO4·2H2O, lecithin) 5 g, deionized water 1000 mL, pH 7.2.

[0116] 1 mL of bacterial suspension (10 8 CFU / mL) was inoculated into a triangular flask containing 50ml NBRIP liquid culture medium, and an equal amount of inactivated bacterial suspension was inoculated as a control, and each treatment was repeated 3 times. After culturing in a shaking incubator at 28℃ and 140r / min for 7 days, the culture solution was treated with an ultrasonic cell disruptor for 15min, centrifuged at 4℃ and 10000r / min for 10min, 10mL of the supernatant obtained by centrifugation was appropriately diluted several times, and the effective phosphorus content in the culture solution was determined by the molybdenum antimony colorimetric method.

[0117] The results showed that the rhizobium P68-1 had a certain solubility for both inorganic phosphorus and organic phosphorus substances, and the solubility of calcium phosphate, iron phosphate, aluminum phosphate and organic phosphorus were 26.9, 6.3, 6.9 and 1.7 mg / L respectively.

[0118] Example 8: Amplification and phylogenetic analysis of the 16S rRNA gene and other housekeeping genes recA, atpD, gInII of Rhizobium P68-1

[0119] The total DNA of the test strain P68-1 was extracted, and the PCR reaction was performed using the Bio-RAD MyCyclerTM instrument. The PCR amplification products were detected on 1.0% agarose gel electrophoresis and then sent to Chengdu Qingke Zixi Biotechnology Co., Ltd. for determination. The gene sequence similarity was calculated using the software DNAman7.0.

[0120] (1) Amplification of 16S rRNA and construction of phylogenetic tree

[0121] Using total DNA as template, universal primers P1 (5'-AGAGTTTGATCCTGGCTCAGAACGAACGCT-3') and P6 (5'-TACGGCTACCTTGTTACGACTTCACCCC-3') were used to amplify the 16S rRNA gene. PCR reaction system (25μL): 2×PCR Mix 12.5μL, forward primer P11μL, reverse primer P61μL, DNA template (50ng / mL) 1μL, ddH2O supplemented to 25μL. Amplification program: 95℃ initial denaturation 5min, 94℃ denaturation 1min, 55℃ renaturation 1min, 72℃ extension 2min, 30 cycles, 72℃ final extension 6min, 4℃ storage. The amplified product was detected by 1% agarose gel electrophoresis (150V, 20min), purified and sent to Chengdu Qingke Zixi Biotechnology Co., Ltd. for sequencing, and the sequence result is as SEQ ID No.1.

[0122] The obtained 16S rRNA gene sequence results were compared in EzTaxon (http: / / www.ezbiocloud.net / eztaxon), and the model strain with high similarity was selected as the reference strain. The sequences of the test strain and the reference strain were compared using MEGA 7.0, and the phylogenetic tree was constructed using the neighbor-joining method. The Bootstrap value was set to 1000. The phylogenetic tree is shown in Figure 2 .from Figure 2 It can be seen that pea rhizobium P68-1 is a strain of the genus Rhizobium.

[0123] (2) Construction of a joint phylogenetic tree of multi-locus gene sequences

[0124] To further determine the taxonomic status of P68-1, the housekeeping genes recA, atpD and glnII sequences at three loci were selected for the construction of a joint phylogenetic tree.

[0125] Primers recAF3 (5'-TTCGGCAAGGGM CGKTSATG-3') and recAR3 (5'-GCATGAAGATCGGRGTSA GT-3') were used to amplify recA, primers atpDF3 (5'-GCTSGGCCGCATCMTSAACGTC-3') and atpDR (5'-CAGGCNGGTTCGGAAGTGTCGGC-3') were used to amplify atpD, and primers GSII-5 (5'-YAAGCTCGAGTACATYTGGCT-3') and GSII-6 (5'-TGCATGCCSGAGCCGTTCCA-3') were used to amplify glnII. The reaction system (50 μL) was as follows: 2×PCRMix 25 μL; 10 mM forward primer and reverse primer 0.5 μL each; DNA template 1 μL; ddH2O 23 μL.

[0126] The PCR amplification procedure is as follows:

[0127]

[0128]

[0129] The amplified products were tested according to the above method and sent to Chengdu Qingke Zixi Biotechnology Co., Ltd. for sequencing. Bidirectional sequencing was performed on each gene (sequences of the forward and reverse primers), and then the forward and reverse primer sequences were spliced ​​using DNAman7.0 software. The sequence results were SEQ ID No.2, SEQ ID No.3, and SEQ ID No.4, respectively.

[0130] Each gene sequence result was compared with the National Center for Bioinformatics (NCBI) in the United States, and the model strain with high sequence similarity to the housekeeping genes of the three loci recA, atpD and glnII of P68-1 was found as the reference strain for tree construction.

[0131] Construction of the joint phylogenetic tree of three genes (recA, atpD and glnII): First, the sequences of the recA, atpD and glnII genes were aligned with the corresponding gene sequences of the reference strains using MEGA7.0, and the sequences were trimmed to the minimum length. The trimmed sequences were saved in FASTA format. The lengths of the three gene sequences after trimming were 356nt, 260nt and 503nt respectively. The three sequences were opened in Notepad format and spliced ​​together. The neighbor-joining method in MEGA7.0 software was used to construct the joint phylogenetic tree. The bootstrap value was 1000. The joint phylogenetic tree of recA, atpD and glnII is as follows: Figure 3 shown.

[0132] DNAman6.0 was used to calculate the similarity between each gene and the reference strain. The results showed that the sequences of three housekeeping genes, recA, atpD, and glnII, of P68-1 were similar to those of R. fabae CCBAU 33202. T The similarity of the model strain was the highest, at 98.0%, 99.8%, and 99.7%, respectively. The combined sequence of the three housekeeping genes of P68-1 was the most similar model strain R. fabae CCBAU33202. T The similarity is 99.0%. Internationally, 97% similarity is generally used as the standard for species identification, and the strain is similar to the model strain R. fabae CCBAU 33202 T The similarity was greater than 97%, indicating that strain P68-1 belonged to R. fabae.

[0133] The above description is only a specific implementation mode of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principle of the present invention should be covered by the protection scope of the present invention.

Claims

1. A rhizobium for promoting the production of beardless peas, characterized in that: The classification name of the rhizobium that promotes the production of beardless bean tip pea is Rhizobiumfabae, the strain number of the rhizobium that promotes the production of beardless bean tip pea is P68-1, and it was deposited in the China Type Culture Collection Center in Wuhan University, Wuhan City, Hubei Province, China on September 4, 2018, and the preservation number is CCTCC NO:M 2018590.

2. A bacterial agent for promoting the production of beardless peas, characterized in that: The microbial agent for promoting the production of beardless pea contains the rhizobium for promoting the production of beardless pea as claimed in claim 1.

3. Use of the rhizobium for promoting the production of beardless bean tips peas as claimed in claim 1 or the bacterial agent for promoting the production of beardless bean tips peas as claimed in claim 2 in the preparation of a product for promoting the production of beardless bean tips peas.

Images