Edible vegetable blend oil and method for preparing the same

Abstract

The application discloses a kind of edible plant blend oil and its preparation method, the content of the lipid companion in the finished product of the blend oil, including, polyphenol 20-70, squalene 100-300, 2350-5700 of glucosinolate, 1600-4550 of beta-sitosterol, 700-2100 of rapeseed sterol, 300-750 of stigmasterol, 40-95 of lanosterol, 30-165 of brassicasterol, 90-240 of alpha-tocopherol, 275-850 of gamma-tocopherol.The application provides a kind of edible plant blend oil, the content of each kind of fatty acid in the blend oil is reasonably matched, and contain a variety of oil-specific trace nutrients, more comprehensive nutrition, utilize the synergistic effect, so that food plant blend oil can achieve better effect of reducing high blood lipids and high cholesterol, can satisfy the nutritional needs of different population.

Description

Technical Field

[0001] This invention belongs to the field of oil processing, specifically relating to an edible vegetable blended oil and its preparation method. Background Technology

[0002] With the improvement of people's living standards, the incidence of hyperlipidemia is gradually increasing. Hyperlipidemia is a chronic disease caused by lipid metabolism disorders leading to excessively high blood lipid levels, which can cause cardiovascular diseases such as atherosclerosis, coronary heart disease, and myocardial infarction. Currently, the main method for lowering blood lipids is drug treatment, which is not only expensive but may also produce side effects with long-term use. Food nutrition science advocates consuming foods containing natural active ingredients to reduce the risk of chronic diseases. The intake of lipid nutrients is increasingly becoming a research hotspot in the field of nutrition.

[0003] The 2013 edition of the "Chinese Dietary Reference Intakes (DRIs)" no longer specifies requirements for fatty acid ratios. Instead, it revises the guidelines based on changes in the disease spectrum and dietary structure of Chinese residents, as well as the latest research findings in nutrition both domestically and internationally, providing a comprehensive overview of the various nutrients required by the Chinese body. It also introduces concepts such as "dietary prevention for chronic diseases" and "the role of plant compounds" for the first time. Currently, there are numerous types of edible oils on the market, each with distinct characteristics. However, single-variety edible oils rarely meet the recommended fatty acid requirements and often lack a rich variety of accompanying nutrients. Blended oils, made from two or more types of edible oils, offer a more balanced fatty acid composition and a richer variety of nutrients compared to single-variety oils. They also possess flavors not found in single-variety oils and are considered to have advantages over single-variety oils.

[0004] The relationship between edible oils and elevated blood lipids and cholesterol is not only closely related to fatty acid composition but also influenced by trace byproducts in the oils. Currently, most patents concerning blended vegetable oils focus on the fatty acid composition. For example, Chinese patent CN201910519374.7 discloses a nutritionally balanced blended vegetable oil, but this method only considers the composition of saturated fatty acids, monounsaturated fatty acids, and polyunsaturated fatty acids, and provides a blended oil with linoleic acid and α-linolenic acid in a reasonable ratio, ignoring the content and proportion of trace byproducts in the vegetable oil. Chinese patent CN201910954456.4 discloses a nutritionally balanced blended oil and its preparation method. The blended oil obtained by this method has a balanced fatty acid composition and a rich variety and content of beneficial lipid byproducts, but it does not limit the content and distribution of lipid byproducts in the blended oil. Furthermore, the edible vegetable oils produced by these patents have not shown any effect in reducing hyperlipidemia. Chinese Patent 202211488764.0 discloses a blended vegetable oil and its application, but it only describes the oil from the perspective of fatty acids and does not restrict the lipid byproducts. Furthermore, the blended oil obtained by blending safflower seed oil and flaxseed oil has no significant lipid-lowering effect. Although Chinese Patent 202010890967.7 discloses an edible blended vegetable oil that can lower blood lipids and cholesterol, it only restricts the fatty acid composition and the content of certain oil byproducts, and the blended oil obtained by this method also has a poor lipid-lowering effect. Summary of the Invention

[0005] The purpose of this section is to outline some aspects of embodiments of the present invention and to briefly describe some preferred embodiments. Simplifications or omissions may be made in this section, as well as in the abstract and title of this application, to avoid obscuring the purpose of these documents; however, such simplifications or omissions should not be construed as limiting the scope of the invention.

[0006] In view of the problems existing in the above and / or prior art, the present invention is proposed.

[0007] Therefore, the purpose of this invention is to overcome the shortcomings of the prior art and provide an edible vegetable oil.

[0008] To solve the above-mentioned technical problems, the present invention provides the following technical solution: an edible vegetable blended oil, wherein the content of trace accompanying substances in the finished product of the blended oil, calculated in mg / kg oil, includes: polyphenols 20-70, squalene 100-300, oryzanol 2350-5700, β-sitosterol 1600-4550, campesterol 700-2100, stigmasterol 300-750, lanosterol 40-95, rapeseed sterol 30-165, α-tocopherol 90-240, and γ-tocopherol 275-850; the percentage of various fatty acids in the blended oil as a percentage of total fatty acids includes: saturated fatty acids 5%-15%, monounsaturated fatty acids 15%-43%, and polyunsaturated fatty acids 28%-79%, of which n-3 polyunsaturated fatty acids are 13%-37%, n-6 polyunsaturated fatty acids are 11%-31%, and punicic acid is 3%-11%.

[0009] As a preferred embodiment of the edible vegetable blended oil of the present invention, the polyphenols, squalene, oryzanol, β-sitosterol, campesterol, stigmasterol, lanosterol, α-tocopherol and γ-tocopherol trace adjuncts contained in the vegetable blended oil are all non-exogenous additions.

[0010] As a preferred embodiment of the edible vegetable blended oil of the present invention, the edible vegetable blended oil includes one or more of chia seed oil, pomegranate seed oil, rice bran oil, rapeseed oil and tea oil.

[0011] As a preferred embodiment of the blended edible vegetable oil of the present invention, the edible vegetable oil comprises, by weight, 20-55% chia seed oil, 5-15% pomegranate seed oil, 15-35% rice bran oil, 5-25% rapeseed oil and 5-10% tea oil.

[0012] As a preferred embodiment of the edible vegetable blended oil of the present invention, wherein the saturated fatty acids are derived from one or both of C16:0 and C18:0.

[0013] As a preferred embodiment of the edible vegetable blended oil of the present invention, the total sterol content of the blended oil is not specified, but the numerical ranges of β-sitosterol 3400.15 mg / kg, campesterol 1523.95 mg / kg, stigmasterol 662.45 mg / kg, lanosterol 65.90 mg / kg, and campesterol 32.05 mg / kg are defined.

[0014] As a preferred embodiment of the edible vegetable blended oil of the present invention, the total tocotrienol content is not specified, but the numerical range of α-tocopherol 185.70 mg / kg and γ-tocopherol 670.70 mg / kg is defined.

[0015] As a preferred embodiment of the blended vegetable oil of the present invention, the blended vegetable oil comprises, by weight percentage, 40% chia seed oil, 15% pomegranate seed oil, 35% rice bran oil, 5% rapeseed oil and 5% tea oil.

[0016] Another objective of this invention is to overcome the shortcomings of the prior art and provide a method for preparing edible vegetable blended oil, comprising mixing chia seed oil, pomegranate seed oil, rice bran oil, rapeseed oil and tea oil, stirring and filtering to obtain the edible blended oil.

[0017] In a preferred embodiment of the method for preparing blended vegetable oil according to the present invention, the stirring is carried out at a temperature of 20-30°C, a stirring time of 25-35 min, and a stirring speed of 60-90 r / min.

[0018] In a preferred embodiment of the method for preparing blended edible oil according to the present invention, the filtration is performed using a 350-mesh screen.

[0019] Beneficial effects of this invention:

[0020] (1) This invention provides an edible vegetable blended oil, the content of trace accompanying substances in the finished product, calculated in mg / kg oil, includes polyphenols 20-70, squalene 100-300, oryzanol 2350-5700, β-sitosterol 1600-4550, campesterol 700-2100, stigmasterol 300-750, lanosterol 40-95, campesterol 30-165, α-tocopherol 90-240, γ-tocopherol 275-850; and various fatty acids The percentage of total fatty acids by mass is as follows: saturated fatty acids 5%-15%, monounsaturated fatty acids 15%-43%, and polyunsaturated fatty acids 28%-79%, of which n-3 polyunsaturated fatty acids 13%-37%, n-6 polyunsaturated fatty acids 11%-31%, and pomegranate acid 3%-11%. Among them, trace amounts of polyphenols, squalene, oryzanol, β-sitosterol, campesterol, stigmasterol, lanosterol, α-tocopherol, and γ-tocopherol are all non-exogenous additives.

[0021] (2) The present invention provides an edible vegetable blended oil. The various fatty acids in the blended oil are reasonably proportioned and contain a variety of micronutrients unique to oils, making it more nutritious. By utilizing the synergistic effect between them, the edible vegetable blended oil can achieve better results in reducing high blood lipids and high cholesterol, and can meet the nutritional needs of different groups of people. Attached Figure Description

[0022] To more clearly illustrate the technical solutions of the embodiments of the present invention, the drawings used in the description of the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort. Wherein:

[0023] Figure 1 This diagram illustrates the effect of blended oil on intracellular lipid levels in an embodiment of the present invention. A represents the effect on triglyceride levels, B represents the effect on cholesterol levels, C represents the effect on high-density lipoprotein cholesterol levels, and D represents the effect on low-density lipoprotein cholesterol levels.

[0024] Figure 2 This diagram illustrates the effect of blended oil on intracellular oxidative stress levels in embodiments of the present invention. Specifically, A represents the effect on superoxide dismutase content, B represents the effect on catalase content, C represents the effect on glutathione peroxidase content, and D represents the effect on malondialdehyde content.

[0025] Figure 3 This diagram illustrates the effect of blended oil on intracellular transaminase release levels in an embodiment of the present invention. Figure A shows the effect on aspartate aminotransferase (AST) levels, and figure B shows the effect on alanine aminotransferase (ALT) levels.

[0026] Figure 4 This diagram illustrates the regulatory effects of blended oil on the expression of key lipid metabolism genes in this embodiment of the invention. Specifically, A represents the effect on the relative expression levels of AMPK mRNA, B on SREBP-1C mRNA, C on PPARα mRNA, D on FAS mRNA, E on ACC mRNA, F on SCD mRNA, G on CPT-1 mRNA, H on HMGCR mRNA, and I on CYP7A1 mRNA. Detailed Implementation

[0027] To make the above-mentioned objects, features and advantages of the present invention more apparent and understandable, the specific embodiments of the present invention will be described in detail below with reference to the examples in the specification.

[0028] Many specific details are set forth in the following description in order to provide a full understanding of the invention. However, the invention may also be practiced in other ways different from those described herein, and those skilled in the art can make similar extensions without departing from the spirit of the invention. Therefore, the invention is not limited to the specific embodiments disclosed below.

[0029] Secondly, the term "one embodiment" or "embodiment" as used herein refers to a specific feature, structure, or characteristic that may be included in at least one implementation of the present invention. The phrase "in one embodiment" appearing in different places in this specification does not necessarily refer to the same embodiment, nor is it a single or selective embodiment that is mutually exclusive with other embodiments.

[0030] This invention uses high-quality edible vegetable oils. Each type of vegetable oil is added to a mixing tank in a certain proportion and stirred at 20-30°C and a stirring speed of 60-90 r / min for 25-35 minutes. After filtration, the edible vegetable blended oil of this invention is obtained. The filtration is done through a 350-mesh screen. The vegetable oil raw materials used in this invention are all common commercially available products.

[0031] The specific method for evaluating the blood lipid and cholesterol content of oils using a cell model in this invention is as follows:

[0032] (1) Basic cell culture

[0033] HepG2 cells were seeded in T25 culture flasks, and complete culture medium (DMEM medium containing 15% fetal bovine serum and 1% penicillin-dextrose antibodies) was added. The flasks were then incubated in a cell culture incubator. After 2 days of culture, the original culture medium was removed, and the cells were washed twice with PBS. The same culture medium was then added again for further culture. Cells were passaged when they reached approximately 90% confluence.

[0034] (2) Cell passage culture

[0035] Once cell confluence reached 90%, the culture medium was removed, and the cells were washed twice with PBS. After removing the PBS, 1 mL of trypsin was added for digestion for 2 min. Cells were observed to detach in a granular manner. Under an inverted microscope, increased intercellular spaces and cytoplasmic retraction were observed. Complete culture medium was then added to stop digestion. Cells were gently pipetted to completely detach from the culture dish and transferred to 15 mL centrifuge tubes. After centrifugation at 1200 rpm for 2 min, the supernatant was immediately removed. Cells were resuspended in 1 mL of complete culture medium, counted using a hemocytometer, and then re-seeded into culture flasks for basal culture.

[0036] (3) Cell cryopreservation and thawing

[0037] After cell passage, collect the cells to be cryopreserved, add cryopreservation solution (55% basal medium + 40% FBS + 5% DMSO), and aliquot into 1 mL cryovials, ensuring that each vial contains at least 10 cells. 6 -10 7 The cells / mL are stored in liquid nitrogen.

[0038] The cells to be revived were quickly removed from the liquid nitrogen tank, placed in a 37°C water bath for rapid thawing, and then transferred to a 15 mL sterile centrifuge tube containing complete culture medium. The tube was centrifuged at 1000 r / min for 3 min, the supernatant was removed, 1 mL of the above culture medium was added for resuspending, and then transferred to complete culture medium for basal culture.

[0039] (4) Cell viability (MTT) test

[0040] Cells at 10 4 Cells were seeded at a density of [number] cells / well in 96-well plates and cultured in a cell culture incubator for 24 h. Afterward, the complete culture medium was removed, and the cells were washed twice with PBS (100 μL per well), then the PBS was removed again. 100 μL of serum-free DMEM medium containing different concentrations of lipid digestion products was added to each well. A control group consisted of normal cells without any digestion products, while a blank group contained only serum-free DMEM medium. After 24 h of culture, MTT solution was added, and after another 4 h of culture, DMSO was added. The cells were incubated in the 96-well plates with shaking for 10 min, and the absorbance was measured at 570 nm.

[0041] Cell viability = [(Absorbance of sample group - Absorbance of blank group) / (Absorbance of control group - Absorbance of blank group)] × 100%

[0042] (5) Experiment on the treatment of cells by lipid digestion products

[0043] Different edible oils were dissolved in n-hexane to prepare an oil solution with a concentration of 100 mg / mL. 300 μL of the solution was taken into a 15 mL centrifuge tube, and 7 mL of pH 7.6 Tris-HCl buffer solution was added. The mixture was then thoroughly mixed using a vortex mixer.

[0044] Then add 1.75 mL of cholate solution (0.05%) and 0.7 mL of CaCl2 solution (2.2%) in sequence, and mix thoroughly.

[0045] Then, 30 mg of pancreatic lipase was added, mixed thoroughly, and reacted in a 37°C water bath with a constant temperature shaker for 1 h. The mixture was then removed and vortexed for 30 s. This reaction-vortexing treatment was repeated three times. The reaction solution was rapidly cooled to room temperature, 2 mL of diethyl ether was added, and the mixture was thoroughly mixed. The solution was centrifuged at 4000 g for 10 min, and the supernatant was collected in a 10 mL centrifuge tube. The solution was dried under nitrogen, dissolved in 0.5 mL of DMSO, and then 4.5 mL of 10% BSA solution was added. After mixing at 55°C for 30 min, the edible oil digest was obtained and stored at -20°C for later use.

[0046] Cells at 10 6Cells were seeded at a density of cells / well in 6-well plates and cultured in a cell culture incubator for 24 hours. After that, the complete culture medium was removed, and the cells were washed twice with PBS and then the PBS was removed. The model group was cultured in high-glucose medium containing oleic acid. The sample group was cultured in serum-free DMEM medium containing different concentrations of lipid digestion products in each well. The control group consisted of normal cells without the addition of digestion products. The cells were cultured for another 24 hours.

[0047] (6) Determination of relevant intracellular biochemical parameters

[0048] After washing the cells treated in part (5) with PBS, 200 μL of RIPA lysis buffer containing the protein protectant PMSF (final concentration 1 mM) was added to each well. After lysis for 30 min, the cells were transferred to centrifuge tubes and centrifuged at 12000 r / min for 2 min at 4°C. Cell protein concentration was determined according to the kit instructions. The absorbance was measured using an ELISA reader according to the instructions of the triglyceride (TG), cholesterol (TC), high-density lipoprotein cholesterol (HDL-C), and low-density lipoprotein cholesterol (LDL-C) kits. The levels of superoxide dismutase (SOD), catalase (CAT), glutathione peroxidase (GPx), and malondialdehyde (MDA) were detected according to the corresponding enzyme kits. AST (aspartate aminotransferase) and ALT (alanine aminotransferase) were also detected using the kits.

[0049] (7) Cell RNA extraction and qRT-PCR analysis

[0050] After washing the cells treated in part (5) with PBS, total RNA was extracted from the treated cells using the EZ-press RNA Purification Kit. cDNA was synthesized using the HiScript III All-in-one RT SuperMix Perfectfor qPCR Kit and amplified using the ChamQ Universal SYBR qPCR Master Mix Kit. Using 2 -ΔΔCt Using GAPDH as an internal reference, data were normalized to GAPDH expression and further normalized to a control. Gene primer sequences are shown in Table 1.

[0051] Table 1. Gene Primer Sequence List

[0052] Gene Forward primer (5′-3′) Reverse primer (5′-3′) GAPDH AACGGATTTGGTCGTATTGGGC TTGACGGTGCCATGGAATTTGC AMPK TAAAAACAGGCTCCACGAAGG GGGCCTGCATACAATCTTCCT SREBP-1C CACTGGTCGTAGATGCGGAGAA TCATTGATGGAGGAGCGGTAGC FAS CACAGGGACAACCTGGAGTT ACTCCACAGGTGGGAACAAG ACC ATGGGCGGAATGGTCTCTTTC TGGGGACCTTGTCTTCATCAT SCD CGACGTGGCTTTTTCTTCTC CCTTCTCTTTGACAGCTGGG PPARα CTGGAAGCTTTGGCTTTACG ACCAGCTTGAGTCGAATCGT CPT-1 TGTCCAGCCAGACGAAGAAC ATCTTGCCGTGCTCAGTGAA HMGCR TGTTCATGCTCACAGTCGCT GCCAGAGGGAAACACTTGGT CYP7A1 CATTTGGGCACAGAAGCATTG AGGCAGCGGTCTTTGAGTTAG Example 1

[0053] Blended oil: Select 40% high-quality edible chia seed oil, 15% pomegranate seed oil, 35% rice bran oil, 5% rapeseed oil and 5% tea oil and add them to the reaction vessel.

[0054] The mixture was mixed at room temperature (25°C) and stirred for 30 minutes at a stirring speed of 75 r / min. After stirring, the mixture was filtered through a 350-mesh screen to obtain the mixed oil. Example 2

[0055] Blended oil: Select 20% high-quality edible chia seed oil, 15% pomegranate seed oil, 35% rice bran oil, 20% rapeseed oil and 10% tea oil and add them to the reaction vessel.

[0056] The mixture was mixed at room temperature (25°C) and stirred for 30 minutes at a stirring speed of 75 r / min. After stirring, the mixture was filtered through a 350-mesh screen to obtain the mixed oil, which was then subjected to in vitro digestion to obtain the digestion product. Example 3

[0057] Blended oil: Select 55% high-quality edible chia seed oil, 5% pomegranate seed oil, 25% rice bran oil, 10% rapeseed oil and 5% tea oil and add them to the reaction vessel.

[0058] The mixture was mixed at room temperature (25°C) and stirred for 30 minutes at a stirring speed of 75 r / min. After stirring, the mixture was filtered through a 350-mesh screen to obtain the mixed oil, which was then subjected to in vitro digestion to obtain the digestion product. Example 4

[0059] Blended oil: Select 45% high-quality edible chia seed oil, 10% pomegranate seed oil, 15% rice bran oil, 25% rapeseed oil and 5% tea oil and add them to the reaction vessel.

[0060] The mixture was mixed at room temperature (25°C) and stirred for 30 minutes at a stirring speed of 75 r / min. After stirring, the mixture was filtered through a 350-mesh screen to obtain the mixed oil. Example 5

[0061] Blended oil: Select 40% high-quality edible chia seed oil, 10% pomegranate seed oil, 25% rice bran oil, 15% rapeseed oil and 10% tea oil and add them to the reaction vessel.

[0062] The mixture was mixed at room temperature (25°C) and stirred for 30 minutes at a stirring speed of 75 r / min. After stirring, the mixture was filtered through a 350-mesh screen to obtain the mixed oil, which was then subjected to in vitro digestion to obtain the digestion product. Example 6

[0063] Blended oil: Select 45% high-quality edible chia seed oil, 5% pomegranate seed oil, 30% rice bran oil, 15% rapeseed oil and 5% tea oil and add them to the reaction vessel.

[0064] The mixture was mixed at room temperature (25°C) and stirred for 30 minutes at a stirring speed of 75 r / min. After stirring, the mixture was filtered through a 350-mesh screen to obtain the mixed oil.

[0065] Comparative Example 1

[0066] Blended oil: As in Example 1, except that the blended oil needs to be processed by silica gel column (wet packing and wet loading are used, and the eluent is n-hexane-anhydrous diethyl ether (v / v=5:1). The activated silica gel is packed into the chromatography column, and then the blended oil and eluent are mixed at a ratio of 1:1 (v / v) and passed through the chromatography column. When the solution is basically consistent with the height of the packing material, 3 times the volume of eluent is added and the mixture is passed through the chromatography column again. After collecting the eluent, the eluent is removed by rotary evaporation) to obtain the "blended oil (-)" sample.

[0067] Comparative Example 2

[0068] Blended oil: As in Example 1, except that β-sitosterol, campesterol, and stigmasterol are added to a portion of the blended oil obtained in this invention (the accompanying substances are first dissolved in DMSO and then added to the blended oil) so that the content of trace accompanying substances in the product exceeds the limit of this invention, thereby obtaining a "blended oil (+)" sample. Comparative Example 3

[0069] Blended oil: As in Example 1, except that: polyphenols, α-tocopherol, and γ-tocopherol are added to a portion of the blended oil obtained in this invention (the accompanying substances are first dissolved in DMSO and then added to the blended oil) so that the content of trace accompanying substances in the product exceeds the limit of this invention, thereby obtaining a "blended oil (+)" sample. Comparative Example 4

[0070] Blended oil: Select 30% high-quality edible chia seed oil, 15% pomegranate seed oil, 35% rice bran oil and 20% rapeseed oil and add them to the reaction vessel.

[0071] The mixture was mixed at room temperature (25°C) and stirred for 30 minutes at a stirring speed of 75 r / min. After stirring, the mixture was filtered through a 350-mesh screen to obtain the mixed oil. Comparative Example 5

[0072] Blended oil: Select 40% high-quality edible chia seed oil, 35% rice bran oil and 25% rapeseed oil and add them to the reaction vessel.

[0073] The mixture was mixed at room temperature (25°C) and stirred for 30 minutes at a stirring speed of 75 r / min. After stirring, the mixture was filtered through a 350-mesh screen to obtain the mixed oil.

[0074] The fatty acid composition and accompanying oils of the obtained blended oil were analyzed and are shown in Table 2.

[0075] Table 2 shows the percentage of major fatty acids and the content of trace accompanying substances (mg / kg) in the oils of each example.

[0076]

[0077]

[0078] ND means Not Detected.

[0079] Depend on Figure 1 It can be seen that the TG and TC contents in the model group were 9.29 times and 4.72 times that of the control group, respectively, and the HepG2 cell hyperlipidemia model was successfully established.

[0080] Compared to the model group, all the vegetable blended oil examples reduced the contents of TG, TC, and LDL-C to some extent, while increasing the content of HDL-C. Example 1 showed better effects in reducing hyperlipidemia and hypercholesterolemia; compared to the model group, the contents of TG, TC, and LDL-C decreased by 76%, 64%, and 59%, respectively, while the HDL-C content increased by 177%. Blended oils outside the scope of this invention, including both the - and + blended oils of Comparative Examples 1-3, showed reduced effects. The results of Comparative Examples 4 and 5 indicate that the absence of one or more of the five ingredients resulted in poor effects in reducing hyperlipidemia and hypercholesterolemia.

[0081] Lipid accumulation can also cause oxidative damage to cells, reducing the activity of antioxidant enzymes. MDA is the end product of lipid oxidation, and its content can reflect the degree of peroxidation. Oxidative damage can further affect normal metabolism, thus forming a vicious cycle.

[0082] Depend on Figure 2 It can be seen that, compared with the model group, the plant-based blended oil examples can increase the content of superoxide dismutase, catalase, and glutathione peroxidase, while reducing the content of MDA. Example 1 has better effects, with SOD, CAT, and GPx contents increasing by 16%, 12%, and 52%, respectively, and MDA content decreasing by 45% compared with the model group. AST and ALT levels are important indicators for evaluating hepatocyte damage. When hepatocytes are damaged, the permeability of the cell membrane changes, and internal AST and ALT leak out, leading to an increase in their extracellular levels.

[0083] Depend on Figure 3 It can be seen that, compared with the model group, all the vegetable blended oil examples have a certain effect in reducing AST and ALT content, with Example 1 showing better results, reducing AST and ALT content by 15% and 12% respectively compared with the model group. Blended oils outside the scope of this invention, including both the blended oils (-) and blended oils (+) in Comparative Examples 1-3, showed reduced effects. The results of Comparative Examples 4 and 5 indicate that the absence of one or more of the five raw materials resulted in poor effects.

[0084] AMPK is a serine / threonine protein kinase that regulates multiple enzymes related to energy homeostasis and is known as the "cellular energy regulator." When the intracellular ATP / AMP ratio decreases, phosphorylation of the total signaling factor AMPK regulates signaling pathways such as SREBP and PPAR, inhibiting multiple processes including fatty acid and cholesterol synthesis and promoting fatty acid oxidation, thus maintaining the dynamic balance of lipid metabolism. Cholesterol regulatory element-binding protein 1c (SREBP-1c) and its downstream fatty acid synthase (FAS), acetyl-CoA carboxylase (ACC), and stearoyl-CoA desaturase (SCD) are key enzymes in fatty acid synthesis. Peroxisome proliferator-activated receptor (PPARα) and its downstream carnitine palmitoyltransferase (CPT-1) are key enzymes in fatty acid oxidation. Cholesterol 7α-hydroxylase (CYP7A1) is the rate-limiting enzyme for the breakdown of cholesterol into bile acids, and hydroxymethylglutaryl-CoA reductase (HMGCR) is the rate-limiting enzyme for cholesterol synthesis.

[0085] Depend on Figure 4 It can be seen that, compared with the model group, the vegetable blended oil of Example 1 has a better effect on promoting fatty acid oxidation and reducing fatty acid and cholesterol synthesis, while the effects of blended oils outside the scope of this invention, namely the blended oils (-) and blended oils (+) of Comparative Examples 1-3, are reduced. The results of Comparative Examples 4 and 5 show that the lack of one or more of the five raw materials is not effective.

[0086] This invention provides an edible vegetable blended oil with a reasonable ratio of fatty acids and trace elements. Utilizing their synergistic effect, this edible vegetable blended oil has a better effect on lowering high blood lipids and high cholesterol, which can meet the nutritional needs of different groups of people and has broad market prospects and application value.

[0087] It should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention and are not intended to limit it. Although the present invention has been described in detail with reference to preferred embodiments, those skilled in the art should understand that modifications or equivalent substitutions can be made to the technical solutions of the present invention without departing from the spirit and scope of the technical solutions of the present invention, and all such modifications or substitutions should be covered within the scope of the claims of the present invention.

Claims

1. A blended edible vegetable oil, characterized in that: The blended oil, in its finished product, contains the following lipid-related compounds in mg / kg oil: polyphenols 20-70, squalene 100-300, oryzanol 2350-5700, β-sitosterol 1600-4550, campesterol 700-2100, stigmasterol 300-750, lanosterol 40-95, campesterol 30-165, α-tocopherol 90-240, and γ-tocopherol 275-850. The blended oil contains, by mass percentage, saturated fatty acids 5%-15%, monounsaturated fatty acids 15%-43%, and polyunsaturated fatty acids 28%-79%, of which n-3 polyunsaturated fatty acids 13%-37%, n-6 polyunsaturated fatty acids 11%-31%, and punicic acid 3%-11%. The edible vegetable blended oil comprises, by weight percentage, 20-55% chia seed oil, 5-15% pomegranate seed oil, 15-35% rice bran oil, 5-25% rapeseed oil, and 5-10% tea oil.

2. The vegetable blended oil as described in claim 1, characterized in that: The polyphenols, squalene, oryzanol, β-sitosterol, campesterol, stigmasterol, lanosterol, α-tocopherol, and trace amounts of γ-tocopherol contained in the blended vegetable oil are all non-exogenous additives.

3. The vegetable blended oil as described in claim 1, characterized in that: The saturated fatty acids are derived from one or both of C16:0 and C18:

0.

4. The vegetable blended oil as described in claim 1, characterized in that: The edible vegetable blended oil comprises, by weight percentage, 40% chia seed oil, 15% pomegranate seed oil, 35% rice bran oil, 5% rapeseed oil, and 5% tea oil.

5. A method for preparing the vegetable blended oil according to any one of claims 1 to 4, characterized in that: This includes mixing chia seed oil, pomegranate seed oil, rice bran oil, rapeseed oil, and tea oil, stirring, and filtering to obtain the blended edible oil.

6. The method for preparing the blended vegetable oil as described in claim 5, characterized in that: The stirring is carried out at a temperature of 20-30℃, for a time of 25-35 minutes, and at a speed of 60-90 r / min; the filtration is carried out using a 350-mesh screen.

Images