A kasp molecular marker related to regulating the content of erucic acid, oleic acid, linoleic acid and linolenic acid in rapeseed oil and application thereof
By developing a KASP molecular marker at the 1114 bp position of the BnaA08.HDG4 gene cds sequence, the problem of the difficulty in efficiently screening the content of erucic acid, oleic acid, linoleic acid and linolenic acid in rapeseed oil in existing technologies has been solved, realizing a rapid and accurate detection method, reducing costs and avoiding pollution.
Patent Information
- Application Number
- CN202410087503.0
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-01-22
- Publication Date
- 2026-05-08
- Estimated Expiration
- 2044-01-22
AI Technical Summary
Existing technologies are insufficient for simultaneously and efficiently screening and detecting the content of erucic acid, oleic acid, linoleic acid, and linolenic acid in rapeseed oil, and traditional molecular marker methods suffer from low throughput or high cost.
A KASP molecular marker based on the 1114 bp position of the BnaA08.HDG4 gene cds sequence was developed, and the mutation site was monitored by PCR and fluorescence detection, providing an efficient and accurate detection method.
This method enables rapid and accurate detection of erucic acid, oleic acid, linoleic acid, and linolenic acid in rapeseed oil, avoiding aerosol contamination and environmental pollution caused by PCR products, and reducing detection costs.
Smart Images

Figure CN117947203B_ABST
Abstract
Description
Technical Field
[0001] This invention relates to the field of molecular genetic breeding technology, and in particular to a KASP molecular marker related to regulating the content of erucic acid, oleic acid, linoleic acid and linolenic acid in rapeseed oil and its application. Background Technology
[0002] rapeseed (Brassica napus type rapeseed) Brassica napus Rapeseed (genome AACC, 2n=38) is the world's second largest oilseed crop and an important oilseed crop in my country. With the improvement of living standards and dietary structure, the demand for edible rapeseed oil is increasing, making the cultivation of high-quality rapeseed one of the important goals of rapeseed breeding. The nutritional and health-promoting qualities of rapeseed oil are mainly determined by its fatty acid composition. Compared with other vegetable oils, rapeseed oil is rich in unsaturated fatty acids, mainly composed of monounsaturated oleic acid and polyunsaturated linoleic acid and linolenic acid, with an optimal ratio of 2:1. Among them, oleic acid (C18:1) and linoleic acid (C18:2) are considered very healthy and nutritious for the human body. However, the extracted linolenic acid (C18:3) contains three unsaturated double bonds that are easily oxidized, thus reducing the thermal stability during frying and the storage time of the oil. Erucic acid (C22:1) has long been considered to cause health problems in humans and livestock and is difficult to digest due to its long chain. Modern rapeseed is selected based on the erucic acid and glucosinolate content of "double low" seeds. Therefore, reducing the content of erucic acid and linolenic acid has always been an important goal in rapeseed production.
[0003] In Arabidopsis, the genetic basis of fatty acid biosynthesis and modification pathways in seeds is well described. To better understand the genetic mechanisms of lipid composition and biosynthesis in rapeseed seeds, numerous potential QTLs associated with seed quality traits have been identified in segregating populations of both parents over the past few decades. These QTLs include oil content, protein content, glucosinolate content, and fatty acid composition. In recent years, genome-wide association analysis (GWAS), also known as linkage disequilibrium-based association mapping, has been used to identify trait-related genetic variations. A large number of QTLs or genes from natural populations have been mined, offering higher resolution and greater cost-effectiveness. Therefore, GWAS has successfully proven to be a powerful tool.
[0004] Molecular markers have become a powerful tool in crop breeding due to their accuracy, speed, and efficiency. Their advantages, including early selection, independence from environmental influences, and high accuracy and efficiency, have led to their substantial use in various crops. There are many types of molecular markers. Currently, those substantially used in crops include early markers such as RFLP (Restriction Fragment Length Polymorphism), RAPD (Random Amplified Polymorphism DNA), and AFLP (Amplified Fragment Length Polymorphism), and more recently, the most widely used markers, such as SSR (Simple Sequence Repeat) and CAPS (Cleaved Amplified Polymorphic Sequence). However, these methods all have limitations such as low throughput or high cost. KASP (kompetitive allele specific PCR) is a technique developed by LGC (Government Chemists' Laboratories) in the UK for the precise identification of biallelic alleles in SNPs and InDels at specific loci in the genome. KASP molecular markers offer advantages such as high stability, high accuracy, low cost, speed, and high efficiency, and their application is most significant when dealing with large sample sizes and a limited number of SNP sites.
[0005] The applicant's Chinese invention patent application (Publication No.: CN110760608A, Publication Date: 2020-02-07) discloses two novel high-oleic acid allelic mutations (BnAfad2a and BnCfad2a) in the BnFAD2 gene of Brassica napus. The nucleotide sequences of the gene are as described in SEQ ID NO: 1 and ID NO: 2. This invention also provides two pairs of specific KASP molecular markers, KASP-421 and KASP-1073, for rapid screening of these novel high-oleic acid allelic mutation sites, and utilizes these markers for single-plant genotyping and screening of high-oleic acid lines. Both pairs of KASP molecular markers provided by this method are developed from SNP variations in the exon region of the Brassica napus BnFAD2 gene, resulting in higher screening specificity and more accurate and reliable detection results. The KASP molecular markers provided by this method require only two steps: PCR and fluorescence detection, making them low-cost and high-throughput, particularly suitable for the classification, screening, and identification of high-oleic acid genotypes in breeding populations. The patent only involves screening for high oleic acid, and there are currently no publicly reported studies on screening for erucic acid, oleic acid, linoleic acid and linolenic acid simultaneously. Summary of the Invention
[0006] This invention aims to overcome the shortcomings of existing patents or technologies. One objective is to provide a reagent for detecting molecular markers related to the detection and regulation of erucic acid, oleic acid, linoleic acid, and linolenic acid content in rapeseed oil. This molecular marker is located at the 1114 bp cds sequence of the BnaA08.HDG4 gene. Furthermore, a highly efficient and practical KASP molecular marker has been developed based on this marker. The KASP molecular marker can record and analyze the fluorescence signals generated during PCR using a computer, enabling the monitoring of mutation sites. The detection results show high consistency with phenotypes. The detection process eliminates the need for electrophoresis, completely preventing aerosol pollution from PCR products, environmental pollution from EB, and harm to human health. This allows for rapid and accurate detection of the aforementioned novel nucleotide mutation sites, providing an accurate, rapid, and effective detection method for screening and breeding varieties that regulate the content of erucic acid, oleic acid, linoleic acid, and linolenic acid in rapeseed oil.
[0007] To achieve the above objectives, the present invention adopts the following technical solution:
[0008] A reagent for detecting and regulating molecular markers related to the content of erucic acid, oleic acid, linoleic acid, and linolenic acid in rapeseed oil. The molecular marker is located at the 1114 bp position of the CDS sequence of the BnaA08.HDG4 gene, named the A1114G site, which can be either G or A. If the base is G, the BnaA08.HDG4 in the sample is determined to be a mutant sequence, and the genotype is defined as GG. If the base is A, the site is determined to be the original sequence, and the genotype is defined as AA. GG corresponds to low oleic acid, low linoleic acid, low linolenic acid, and high erucic acid, while AA is the opposite.
[0009] Preferably, the reagent is a KASP detection reagent, which includes two specific primers and one universal primer.
[0010] Preferably, the nucleotide sequences of the two specific primers are shown in SEQ ID NO:3 and SEQ ID NO:4; and the nucleotide sequence of the universal primer is shown in SEQ ID NO:5.
[0011] Furthermore, the present invention also discloses a reagent kit containing the aforementioned reagent.
[0012] Furthermore, the present invention also discloses a CDS gene fragment related to regulating the content of erucic acid, oleic acid, linoleic acid and linolenic acid in rapeseed oil. The CDS gene fragment is either a BnaA08.HDG4-cds-mutant gene fragment or a BnaA08.HDG4-cds-unmutant gene fragment. The nucleotide sequence of the BnaA08.HDG4-cds-mutant gene fragment is shown in SEQ ID NO:1, and the nucleotide sequence of the BnaA08.HDG4-cds-unmutant gene fragment is shown in SEQ ID NO:2.
[0013] Furthermore, the present invention also discloses the application of the reagent, the CDS gene fragment, or the kit in screening rapeseed varieties that regulate the content of erucic acid, oleic acid, linoleic acid, and linolenic acid in rapeseed oil.
[0014] Furthermore, this invention also discloses a method for screening rapeseed varieties that regulate the content of erucic acid, oleic acid, linoleic acid, and linolenic acid in rapeseed oil, the method comprising the following steps:
[0015] Genome DNA was extracted from rapeseed, and PCR amplification was performed using primers. Molecular markers in the amplification products were detected to screen rapeseed varieties that regulate the content of erucic acid, oleic acid, linoleic acid, and linolenic acid in rapeseed oil.
[0016] The molecular marker is located at the 1114 bp position of the BnaA08.HDG4 gene cds sequence, named the A1114G site, which can be either G or A. If the base is G, the BnaA08.HDG4 in the sample is determined to be a mutant sequence, and the genotype is defined as GG. If the base is A, the site is determined to be the original sequence, and the genotype is defined as AA. GG corresponds to low oleic acid, low linoleic acid, low linolenic acid, and high erucic acid, while AA is the opposite.
[0017] As a preferred method, the quality of the extracted DNA was detected by agarose gel electrophoresis and Nanodrop 2100. Agarose gel electrophoresis showed that the DNA bands were single, with A260 / 280 between 1.8 and 2.0 and A260 / 230 between 2.0 and 2.2. The DNA concentration was diluted to 20 ng / μL.
[0018] As a preferred option, the PCR reaction system is configured as follows: 2.5 μl of rapeseed sample DNA template (20 ng / μl), 2.5 μl of 2×KASPMastermix, and 0.07 μl of KASP AssayMix (molar concentration ratio of F-HEX:F-FAM:R = 2:2:5).
[0019] As a preferred method, the PCR reaction conditions are: 94℃ for 15 min; 94℃ for 20 sec, 61-55℃ for 1 min, with the annealing temperature decreasing by 0.6℃ for each cycle, for a total of 10 cycles; or 94℃ for 20 sec, 55℃ for 1 min, for a total of 26 cycles.
[0020] This invention, employing the aforementioned technical solution, provides a reagent for detecting and regulating molecular markers related to the content of erucic acid, oleic acid, linoleic acid, and linolenic acid in rapeseed oil. The molecular marker is located at position 1114 bp of the CDS sequence of the BnaA08.HDG4 gene, and its value is either G or A; if the base is G, the sample is determined to be... BnaA08.HDG4 The mutated sequence is defined as GG; if the base is A, the site is considered the original sequence, and the genotype is defined as AA. GG corresponds to low oleic acid, low linoleic acid, low linolenic acid, and high erucic acid, while AA is the opposite. Furthermore, a highly efficient and practical KASP molecular marker was developed based on this molecular marker. The KASP molecular marker can record and analyze the fluorescence signal generated during PCR using a computer to monitor the mutation site, with high consistency between the detection results and phenotypes. The detection process does not require electrophoresis, completely eliminating aerosol pollution from PCR products, environmental pollution from EB, and harm to the human body. It enables rapid and accurate detection of the aforementioned novel nucleotide mutation sites, providing an accurate, rapid, and effective detection method for screening and breeding varieties that regulate the content of erucic acid, oleic acid, linoleic acid, and linolenic acid in rapeseed oil. Attached Figure Description
[0021] Figure 1 The population validation results for the BnaA08.HDG4_A1114G label are shown in the figure.
[0022] Figure 2 shows the distribution of erucic acid, oleic acid, linoleic acid and linolenic acid in rapeseed under three different planting years; the horizontal axis from left to right represents the three planting years: Changsha_2018, Changsha_2019 and Nanjing_2020; the vertical axis on the right, from top to bottom, represents oleic acid, linoleic acid, linolenic acid and erucic acid. Detailed Implementation
[0023] The present invention will be further illustrated below with reference to specific embodiments. It should be understood that these embodiments are for illustrative purposes only and are not intended to limit the scope of the invention. Experimental methods in the following embodiments that do not specify specific conditions are generally performed according to conventional conditions such as those described in J. Sambrook et al., Molecular Cloning: A Laboratory Manual, 3rd Edition, Science Press, 2002, or according to the manufacturer's recommendations.
[0024] Example 1: Phenotypic determination of seed oleic acid content in a related population of Brassica napus.
[0025] 1.1. Rapeseed materials used in this experiment: 203 Chinese semi-winter rapeseed inbred lines were used as materials and planted at the Southwest University experimental base in Chongqing in 2013, 2014, and 2015. The field experiment was designed with two replicate randomized block designs, with three rows planted in each plot, a row spacing of 40 cm, and a plant spacing of 20 cm. Field management was the same as conventional production, and the growth environment of all samples was kept consistent.
[0026] 1.2. The contents of oleic acid (C18:1), linoleic acid (C18:2), linolenic acid (C18:3), and erucic acid (C22:1) in the seeds of 203 natural rapeseed populations were determined using a FOSS near-infrared spectroscopy system (TR-3750, Denmark). Three self-pollinated plants were taken from each material, and the measurement was repeated three times for each sample bag. The results are summarized in Table 1:
[0027] Table 1. Summary of relevant content indicators of self-pollinated seeds from 203 natural rapeseed populations.
[0028]
[0029] Example 2: A method for detecting... BnaA08.HDG4 SNP markers of gene allelic mutations
[0030] In the course of long-term research, this invention screened a candidate gene with structural variation through genome-wide association analysis. BnaA08.HDG4 A significant association was found between a SNP variant (named A1114G) located at position 1114 bp in the gene cds sequence and oleic acid, linoleic acid, linolenic acid, and erucic acid. The mutant and unmutated genome sequences are shown below:
[0031] BnaA08.HDG4 -cds-mutation sequence
[0032] 1000 TCGATAGTGT CAAGAGCCAA AACAATTCAG ATATTTCTT CGGGAGTTTC
[0033] 1060 TGGAGCAAGTGGGTCTCTTC TTCTGATGTA TGCAGAGTTA CAAGTGCTAT
[0034] 1100 CTCCATTAGT ACCAGCAAGA GAAAATTTACT TTCTACGGTA TGTGAAGCAA
[0035] 1160 AACGCAGAAG CTGGAAAATG GATGATTGTA GATTTCCCGG TTGACGGTTT
[0036] 1200 GATCAAACCGGCTTCGGGTATTACTACTACTGATCAGTACCGGAGAAAGC
[0037] BnaA08.HDG4 -cds-unmutated sequence
[0038] 1000 TCGATAGTGT CAAGAGCCAA AACAATTCAG ATATTTCTT CGGGAGTTTC
[0039] 1060 TGGAGCAAGTGGGTCTCTTCTTCTGATGTATGCAGAGTTACAAGTGCCAT
[0040] 1100 CTCCATTAGT ACCAACAAGA GAAATTTACT TTCTACGGTA TGTGAAGCAA
[0041] 1160 AACGCAGAAG CTGGAAAATG GATGATTGTA GATTTCCCGG TTGACGGTTT
[0042] 1200 GATCAAACCGGCTTCGGGTATTACTACTACTGATCAGTACCGGAGAAAGC.
[0043] We selected BnaA08.HDG4 The A1114G site of the gene sequence was used as the center to extract 100bp flanking sequences on both sides, and combined with cloned sequences. BnaA08.HDG4Sequence-differential primers were designed to specifically amplify gene sequence fragments, eliminating interference from homologous gene sequences in the detection. A primer set was designed, with each set consisting of three primers: two specific primers designed for base differences at key sites, and one universal primer. The KASP marker primers provided in this invention are the following specific primer combinations, as shown in the table below. Each KASP marker pair contains three primers.
[0044] The primers for the molecular marker BnaA08.HDG4_A1114G include:
[0045] Two specific primers:
[0046] Primer_AlleleFAM:5'-ccgtagaaagtaaatttctcttgc-3';
[0047] Primer_AlleleHEX:5'-ccgtagaaagtaaatttctcttgt-3';
[0048] A universal primer
[0049] Primer_Common: 5'-tatgcagagttacaagtgctat-3';
[0050] Example 3: A method described above that can be used for detection BnaA08.HDG4 Establishment of SNP marker system for gene allelic mutations
[0051] A population of Brassica napus containing 75 lines was selected, and the KASP primers designed above were used to perform initial screening and verification of the segregating population on the LGCSNPline genotyping platform. The specific operation steps are as follows: (1) Extract genomic DNA from the leaves of the material to be tested using the conventional method (CTAB method); the quality of the extracted DNA was detected by agarose gel electrophoresis and Nanodrop 2100, respectively. Agarose gel electrophoresis showed that the DNA band was single, A260 / 280 was between 1.8 and 2.0, and A260 / 230 was between 2.0 and 2.2. Such DNA samples meet the quality requirements, and the DNA concentration was diluted to 20 ng / μL for later use; (2) Using the DNA extracted in step 1 as a template, the detection method developed in Example 3 was used. BnaA08.HDG4 The SNP marker BnaA08.HDG4_A1114G with gene allelic mutation was amplified by PCR to obtain the amplification product.
[0052] KASP-tagged primers
[0053] The PCR reaction conditions were: 94℃ for 15 min; 94℃ for 20 sec, 61-55℃ for 1 min, with the annealing temperature decreasing by 0.6℃ per cycle, for a total of 10 cycles; or 94℃ for 20 sec, 55℃ for 1 min, for a total of 26 cycles. If the amplification effect was unsatisfactory, more cycles could be added, 3 cycles each time, up to a maximum of three cycles. After the reaction, the KASP reaction products were scanned using a Pherastar scanner to read the fluorescence data; the fluorescence scan results were automatically converted into images. The fluorescence signal was detected and the genotyping status was checked using a BMG Pherastar instrument. If the genotyping was insufficient, amplification continued, checking the genotyping status every 3 cycles until complete genotyping.
[0054] If the -1114 base in the BnaA08.HDG4_A1114G detection result is G, then the sample is determined to be... BnaA08.HDG4 If the sequence is a mutant, the genotype is defined as GG; if the base is A, the site is considered an original sequence, and the genotype is defined as AA. Amplification of the above KASP markers in the segregating population revealed clear genotyping in the amplification results of the BnaA08.HDG4_A1114G marker. Figure 1 ).
[0055] Furthermore, using rapeseed materials with known erucic acid, oleic acid, linoleic acid, and linolenic acid contents from three different planting years (Changsha_2018, Changsha_2019, Nanjing_2020), the results were validated. Significant phenotypic variations were found in the contents of the four fatty acids corresponding to different haplotypes of this gene under different planting years. Figure 2 ).
[0056] The foregoing description of embodiments of the present invention, through which those skilled in the art are able to implement or use the present invention, will be readily apparent to those skilled in the art. Various modifications to these embodiments will be readily apparent to those skilled in the art. The general principles defined herein may be implemented in other embodiments without departing from the spirit or scope of the invention. Therefore, the present invention is not to be limited to the embodiments shown herein, but is to be accorded the widest scope consistent with the principles and novelty disclosed herein.
Claims
1. The application of a reagent or kit containing said reagent for detecting molecular markers related to the content of erucic acid, oleic acid, linoleic acid, and linolenic acid in rapeseed of Brassica napus type in screening rapeseed varieties, characterized in that, The molecular marker is located at position 1114bp of the CDS sequence of the BnaA08.HDG4 gene, named A1114G site, corresponding to position 115 of SEQ ID NO:1 or SEQ ID NO:2, which is either G or A; if the base is G, the BnaA08.HDG4 in the sample is determined to be a mutant sequence, and the genotype is defined as GG; if the base is A, the site is determined to be the original sequence, and the genotype is defined as AA. GG genotype rapeseed corresponds to rapeseed with low oleic acid, low linoleic acid, low linolenic acid, and high erucic acid content, while AA genotype rapeseed is the opposite.
2. The application according to claim 1, characterized in that, This reagent is a KASP detection reagent, consisting of two specific primers and one universal primer.
3. The application according to claim 2, characterized in that, The nucleotide sequences of the two specific primers are shown in SEQ ID NO:3 and SEQ ID NO:4; the nucleotide sequence of the one universal primer is shown in SEQ ID NO:
5.
4. A method for screening rapeseed varieties of the Brassica napus type, characterized in that, The method includes the following steps: Genome DNA was extracted from rapeseed, and PCR amplification was performed using primers. Molecular markers in the amplification products were detected to screen rapeseed varieties. The molecular marker is associated with the content of erucic acid, oleic acid, linoleic acid, and linolenic acid in rapeseed of Brassica napus type. It is located at position 1114bp of the CDS sequence of the BnaA08.HDG4 gene and named the A1114G site, corresponding to position 115 of SEQ ID NO:1 or SEQ ID NO:2, which is either G or A. If the base is G, the BnaA08.HDG4 of the sample is determined to be a mutant sequence, and the genotype is defined as GG. If the base is A, the site is determined to be the original sequence, and the genotype is defined as AA. GG genotype rapeseed corresponds to rapeseed with low oleic acid, low linoleic acid, low linolenic acid, and high erucic acid content, while AA genotype rapeseed is the opposite.
5. The method according to claim 4, characterized in that, The quality of the extracted DNA was determined by agarose gel electrophoresis and Nanodrop 2100. Agarose gel electrophoresis showed that the DNA bands were single, with A260 / 280 between 1.8 and 2.0 and A260 / 230 between 2.0 and 2.
2. The DNA concentration was diluted to 20 ng / μL.
6. The method according to claim 4, characterized in that, The PCR reaction system was prepared as follows: 2.5 μl of rapeseed sample DNA template, 2.5 μl of 2×KASP Mastermix, and 0.07 μl of KASP AssayMix.
7. The method according to claim 4, characterized in that, The PCR reaction conditions were: 94℃ for 15 min; 94℃ for 20 sec, 61-55℃ for 1 min, with the annealing temperature decreasing by 0.6℃ for each cycle, for a total of 10 cycles; 94℃ for 20 sec, 55℃ for 1 min, for a total of 26 cycles.
Citation Information
Patent Citations
Novel rape BnFAD2 gene high oleic acid equipotential mutation and development and application of SNP labeling primer
CN110760608A