Indel molecular markers tightly linked to the major QTL locus for maize resistance to southern rust and its application

Abstract

The present invention discloses an Indel molecular marker tightly linked to a major effect QTL locus of corn resistance to southern rust and its application. The Indel molecular marker is present in the confidence interval of the QTL locus of a corn plant showing resistance to southern rust, and is missing in the confidence interval of the QTL locus of a corn plant showing susceptibility to southern rust. The present invention provides an effective and reliable molecular marker for the identification or screening of corn resistance to southern rust, and is applied to the genetic improvement of corn resistance to southern rust and its breeding, which can effectively shorten the breeding period, speed up the breeding process, improve the breeding efficiency, speed up the process of screening excellent germplasm resources, and provide a new direction for reducing breeding costs. For example, it can be used for corn seed production by pollinating and preserving seeds for corn plants containing Indel molecular markers. The present invention provides a new direction for the screening, identification and breeding of corn resistance to southern rust by molecular assisted selection.

Description

Technical Field

[0001] The invention belongs to the field of biotechnology, and in particular relates to an Indel molecular marker tightly linked to a major effect QTL locus of corn resistance to southern rust and an application thereof. Background Art

[0002] Southern corn rust is an extremely harmful airborne disease, which is mainly caused by the biotrophic fungus Puccinia polysora Underw. The disease was first discovered and identified in Africa, and broke out in the main corn producing areas of West Africa and surrounding countries, causing serious yield losses. Subsequently, the damage of southern corn rust continued to spread. The obvious damage of southern corn rust to my country's corn production began in the 1990s, and it has shown a trend of increasing year by year. Especially in recent years, southern corn rust has caused serious damage to summer-sown corn in the Huanghuaihai region of my country, causing huge yield losses to corn yields. Under this condition, breeding and using new disease-resistant varieties have become the main means to alleviate or even overcome the damage of southern corn rust. Studies have shown that southern corn rust resistance is controlled by major effect gene loci, so combined with molecular marker-assisted selection, improved offspring with good resistance can be quickly obtained. Therefore, mining excellent alleles related to southern rust resistance and developing molecular markers of corresponding alleles have important production application value for molecular marker-assisted selection in the process of improving maize resistance to southern rust. Summary of the invention

[0003] Based on the above background, the inventors located the major QTL locus for resistance to southern rust on chromosome 10 of maize and developed its tightly linked Indel molecular marker, which can provide an effective and reliable molecular-assisted selection method for the genetic improvement of maize resistance to southern rust and its molecular breeding.

[0004] The technical solution of the present invention is:

[0005] The nucleotide sequence of the Indel molecular marker tightly linked to the major QTL locus of maize resistance to southern rust is shown in SEQ ID NO.1.

[0006] Furthermore, the QTL locus is located at position 1,282,904-2,260,899 on chromosome 10.

[0007] Furthermore, the Indel molecular marker exists within the confidence interval of the QTL site of the corn plant showing the trait of resistance to southern rust, and is missing from the confidence interval of the QTL site of the corn plant showing the trait of susceptibility to southern rust.

[0008] Based on the same inventive concept, the present invention also provides the application of the above-mentioned Indel molecular marker, and the application includes at least one of the following:

[0009] 1) Application in identification or screening of southern rust resistance traits in corn;

[0010] 2) Application in genetic improvement of corn resistance to southern rust;

[0011] 3) Application in breeding or auxiliary breeding to improve corn resistance to southern rust.

[0012] Based on the same inventive concept, the present invention also provides a primer pair for amplifying the Indel molecular markers mentioned above, the nucleotide sequences of the primer pair are shown in SEQ ID NO.2 and SEQ ID NO.3 respectively:

[0013] Forward Prime: GTTCCAAGGAAATACATGGCCT SEQ ID NO.2;

[0014] Reverse Primer: GTGGTTTTTTCCCCTTCACTTTG SEQ ID NO.3.

[0015] Based on the same inventive concept, the present invention also provides an application of the above primer pair, wherein the application includes at least one of the following:

[0016] 1) Application in identification or screening of southern rust resistance traits in corn;

[0017] 2) Application in genetic improvement of corn resistance to southern rust;

[0018] 3) Application in breeding or auxiliary breeding to improve corn resistance to southern rust.

[0019] Based on the same inventive concept, the present invention also provides a method for identifying or screening corn resistance to southern rust, which comprises the following steps:

[0020] Extracting the genomic DNA of the corn to be tested, and performing PCR amplification using the primer pair;

[0021] The PCR amplification product is sequenced. When the sequencing result shows that the tested corn plant contains the InDel molecular marker, the tested corn is resistant to southern rust; when the tested corn plant lacks the InDel molecular marker, the tested corn is susceptible to southern rust.

[0022] Based on the same inventive concept, the present invention also provides a method for genetically improving corn breeding for resistance to southern rust, which uses DNA from leaves of a single corn plant as a template and uses the primer pair to perform PCR amplification to obtain an amplified product; the amplified product is sequenced and identified, and if the identification result contains the InDel molecular marker, the corn plant is self-pollinated to obtain a stable genetic inbred line of the target gene.

[0023] Compared with the prior art, the present invention has the following beneficial effects:

[0024] The present invention provides an effective and reliable molecular marker for the identification or screening of southern rust resistance of corn, and is applied to the genetic improvement of southern rust resistance of corn and its breeding, which can effectively shorten the breeding period, speed up the breeding process, improve the breeding efficiency, speed up the screening process of excellent germplasm resources, and provide a new direction for reducing breeding costs. For example, corn seed production can be carried out by pollinating and preserving seeds of corn plants containing InDel molecular markers. The present invention provides a new direction for the screening, identification and breeding of southern rust resistance of corn by molecular assisted selection. BRIEF DESCRIPTION OF THE DRAWINGS

[0025] Figure 1 The southern rust resistance performance of the susceptible parents and individual plants of their F2 segregating population according to the embodiments of the present invention.

[0026] Figure 2 This is the QTL positioning of maize southern rust resistance based on the F2 segregating population of the combination of N531_R and F35 according to an embodiment of the present invention.

[0027] Figure 3 This is the genotype identification of 48 maize inbred lines Ins_RppSLN of the embodiment of the present invention: the material names corresponding to the serial numbers in the figure are detailed in Table 2; the sequences of the internal reference marker amplification primers are zSSIIb-F: CGGTGGATGCTAAGGCTGATG; zSSIIb-R: AAAGGGCCAGGTTCATTATCCTC.

[0028] Figure 4 This is the utilization effect of the Indel molecular marker Ins_RppSLN in the embodiment of the present invention in corn germplasm improvement. The sequences of the internal reference marker amplification primers in the figure are: zSSIIb-F: CGGTGGATGCTAAGGCTGATG; zSSIIb-R: AAAGGGCCAGGTTCATTATCCTC. DETAILED DESCRIPTION

[0029] In order to make the objectives, technical solutions and advantages of the present invention more clearly understood, the present invention is further described in detail below in conjunction with its embodiments; it should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention.

[0030] Unless otherwise specified, the experimental methods used in the following examples are conventional methods.

[0031] Unless otherwise specified, the materials and reagents used in the following examples can be obtained from commercial sources.

[0032] Example 1: Identification and discovery of the main effect locus of RppSLN in maize resistance to southern rust

[0033] (1) Materials

[0034] Parent materials: disease-resistant parent N531_R and susceptible parent F35.

[0035] Among them, the disease-resistant parent N531_R comes from the local variety "Silu Nuo" (abbreviated as SLN) as the donor parent and the excellent inbred line "N531" as the recurrent parent. The self-pollinated offspring BC6F5 with resistance to southern rust was selected from the 6th generation backcross (BC6F1) population and named N531_R. Its recurrent parent N531 is not resistant to southern rust, while the donor parent "Silu Nuo" is a local variety collected in Menghai, Yunnan, my country, with more original traits (multiple ears, fewer rows, more tillers, etc.), and has strong disease resistance and stress resistance. It is the donor parent of N531_R's southern rust resistance. The susceptible parent F35 is a temperate inbred line of the NSS group, which is highly susceptible to southern rust.

[0036] Positioning population: The disease-resistant parent N531_R and the susceptible parent F35 were hybridized to obtain F1. The F1 seeds were planted and self-pollinated to obtain the F2 segregating population for the positioning of the major effect QTL locus of southern rust resistance.

[0037] (2) Experiment

[0038] 1) Field trial design and phenotyping

[0039] At the Sanya test base in Hainan (18.09 ° N, 108.56 °E), the disease-resistant parent N531_R and the susceptible parent F35, as well as the F1 hybrid seeds and F2 segregating populations of the N531_R / F35 combination were planted at the same time, with a planting density of 4500 plants / mu, and the field management adopted the local management method. In order to ensure that the southern rust disease is fully developed, 5 days after the population sheds pollen, the diseased leaves are taken from the local southern rust disease plots and rinsed in water, and then artificial assisted inoculation is performed using a suspension containing southern rust spores. Repeated inoculation is performed 10 days after pollination to ensure the inoculation effect. After the identification population was fully diseased, the southern rust resistance was evaluated using a 9-level classification system: Level 1, high resistance (HR), no lesions or a small number of spores; Level 3, resistant (R), a small number of lesions, not exceeding 25% of the leaf area; Level 5, moderate resistance (MR), leaf spots are clearly visible, some are connected in pieces or chlorotic necrotic spots, and leaf lesions account for 26%-50%; Level 7, susceptible (S), there are a large number of lesions on the leaves, the summer spores are large and mostly connected in pieces, the host is obviously torn, and the leaf area accounts for 51%-75%; Level 9, highly susceptible (HS), the plant leaves have more than 75% lesions, at this time most leaves or the entire plant is dead.

[0040] 2) Extraction of genomic DNA from corn leaves (CTAB method)

[0041] (1) Before and after corn pollination, take young leaves from the susceptible and resistant parents N531_R and F25 and their hybrid combination F2 offspring, place them at the bottom of the tube, and clearly mark them on each 96-well plate;

[0042] (2) Place the 96-well plate containing fresh leaves in a 50-degree oven until dry;

[0043] (3) After the leaves are dried, place appropriate steel balls in a 96-well plate and cover it tightly with a cap. Proof the plate on a proofing machine until it is crushed;

[0044] (4) Use a 12-well pipette to take 400 μl of CTAB solution and add it to the 96-well plate after the sample is plated. Cover the plate tightly with the cap and shake vigorously to ensure that the leaves are fully lysed by the CTAB solution.

[0045] (5) After lysis with CTAB solution for 30 min, add 400 μl of chloroform-isoamyl alcohol solution (24:1 solution) in the same way and gently shake for 10 min. Be careful not to use too much force to prevent DNA breakage and degradation.

[0046] (6) Then, place the 96-well plate in a centrifuge and centrifuge at 4000 speed for 20 min.

[0047] (7) Gently remove the 96-well plate from the centrifuge, take 200 μl of the supernatant, and add it to a new 96-well plate;

[0048] (8) Then add the same volume of ice-cold isopropanol to precipitate the DNA and place it in a -20 degree refrigerator for half an hour to allow the DNA to fully precipitate;

[0049] (9) After the DNA is precipitated, place the 96-well plate in a centrifuge and centrifuge at 4000 rpm for 20 min.

[0050] (10) Remove the 96-well plate from the centrifuge, pour off the isopropanol, add 75% alcohol to rinse the DNA, and soak for 30 minutes;

[0051] (11) Place the sample in the centrifuge again and centrifuge at 4000 rpm for 15 min. Pour off the alcohol and allow the DNA to dry.

[0052] (12) After the DNA is dried, add 200 μl of deionized water to dissolve the DNA and transfer it to a 96-well PCR plate using a 12-channel pipette.

[0053] 3) Genotype identification and QTL mapping

[0054] The 1K liquid phase chip developed by Shijiazhuang Biotechnology Co., Ltd. was used to identify the genotypes of the resistant and susceptible parents and the F2 segregating population. The chip contains 1354 SNP sites, and the physical locations of the relevant sites are clear.

[0055] Based on the genotype data obtained from the 1K chip, the linkage map was constructed using the software QTLIciMapping V3.3. Using the constructed genetic map, genotype data and phenotypic data, the complete interval mapping module in QTLIciMapping V3.3 was used to locate the QTL for resistance to southern rust and analyze the genetic effects.

[0056] (3) Results analysis

[0057] In Hainan, the disease-resistant parent N531_R, the susceptible parent F35 and their hybrid combination F1 and F2 segregating populations were planted at the same time. After inoculation and identification with southern rust, it was found that the disease-resistant parent N531_R and its hybrid combination (F1) with F35 showed good disease resistance ( Figure 1 a). Disease resistance identification was performed on individual plants of the F2 segregation population of the combination of N531_R and F35. The individual plants in the population showed obvious segregation of susceptible and resistant plants in southern rust resistance ( Figure 1 b) The disease resistance of individual plants in the population was evaluated. Among the 183 F2 plants investigated, the number of disease-resistant (disease resistance rating no more than 3) and susceptible (disease resistance rating greater than 3) plants were 133 and 50, respectively. The chi-square test ( χ 2=0.5264<0.3841), the ratio of resistant / susceptible plants in the F2 segregating population was consistent with the genetic characteristics of a single dominant disease resistance gene of 3:1.

[0058] Using the genotype data and disease resistance phenotypic data of the F2 segregating population of the combination of N531_R and F35, QTL localization analysis of southern rust resistance was carried out (Table 1, Figure 2 ), and the results showed that a major disease resistance-related locus was located on the arm of chromosome 10, which could explain 84.77% of the phenotypic variation of the segregating population. Because the disease resistance locus came from the local variety "Silu Nuo", the southern rust disease resistance locus was named R .

[0059] Table 1. QTL mapping for southern rust resistance based on the F2 segregating population of the combination of N531_R and F35

[0060]

[0061] Example 2: Main loci for resistance to southern rust of corn R Molecular marker development and validation

[0062] (1) Materials

[0063] Inbred lines: 48 maize inbred lines including the disease-resistant parent N531_R and the disease-susceptible parent F35.

[0064] Molecular assisted selection verification population: The disease-resistant parent N531_R was used as the donor parent, and the excellent inbred lines "Zheng 58" and "Chang 7-2" susceptible to southern rust were used as recipient parents. Backcrossing was carried out for two consecutive generations to obtain their respective BC2F1 populations, which were used to verify the effect of the newly developed markers in molecular assisted selection.

[0065] (2) Test methods

[0066] 1) Field trial design and phenotyping

[0067] At the Sanya test base in Hainan (18.09 ° N, 108.56 °E), plant relevant corn inbred lines and test materials, and adopt local management methods for field management. In order to ensure that southern rust is fully developed, 5 days after the group sheds pollen, diseased leaves are taken from the local southern rust-infected plots and rinsed in water, and then artificial assisted inoculation is carried out using a suspension containing southern rust spores. Repeat the inoculation 10 days after pollination to ensure the inoculation effect. The southern rust resistance is evaluated using a 9-level classification method: Level 1, high resistance (HR), no lesions or a small number of spores; Level 3, resistance (R), a small number of lesions, not exceeding 25% of the leaf area; Level 5, medium resistance (MR), leaf spots are clearly visible, with individual connected pieces or chlorotic necrotic spots, and leaf lesions account for 26%-50%; Level 7, susceptible (S), there are a large number of lesions on the leaves, the summer spores are large and mostly connected in pieces, the host is obviously torn, and the leaf area accounts for 51%-75%, and Level 9, highly susceptible (HS), the plant leaves have more than 75% lesions, and most leaves or the entire plant is dead at this time. (Specifically the same as Example 1)

[0068] 2) DNA extraction (CTAB method)

[0069] (1) When the maize inbred seedlings grow to the stage of three leaves and one heart, tissue sampling is carried out. The sampling site is the leaves. The leaves are quickly placed in a sterilized mortar and fully ground with liquid nitrogen. Liquid nitrogen is continuously added during the grinding process. After sufficient grinding, the leaves are added to a 2.0 ml centrifuge tube and added to 1 / 3 of the centrifuge tube;

[0070] (2) Preheat the prepared CTAB extract in a 65°C water bath, then add 800 μl of preheated CTAB buffer to the centrifuge tube in the previous step and shake vigorously to mix thoroughly.

[0071] (3) Place the mixed extract in a 65°C constant temperature water bath for 30 min, shaking it every 10 min to allow it to react fully;

[0072] (4) Take out the centrifuge tube after sufficient reaction, add an equal volume of chloroform / isoamyl alcohol (volume ratio 24:1), and mix slowly;

[0073] (5) Place the centrifuge tube in a centrifuge and centrifuge (4000 rpm, 15-20 min);

[0074] (6) Carefully pipette the supernatant into another clean centrifuge tube, add an equal volume of pre-cooled isopropanol, and gently mix until a white precipitate is formed.

[0075] (7) Use a sterilized pipette tip to pick up the white precipitate, place it in another clean centrifuge tube, and add 600 μl of 75% ethanol to rinse 1-2 times;

[0076] (8) Centrifuge, pour off 75% ethanol, remove excess ethanol with a pipette tip and dry at room temperature, dissolve DNA with ddH2O and store in a -20℃ refrigerator for later use.

[0077] 3) Reference genome assembly

[0078] In order to understand the main effect loci of southern rust resistance between the disease-resistant parent N531_R and the susceptible parent F35 in detail R The reference genomes of N531_R and its recurrent parent N531 (susceptible) were assembled based on the genomic differences in the confidence interval. First, the PacBio Sequel II platform was used for sequencing to obtain CCS clean reads, and the contig genome was assembled using the software hifiasm-0.16.1 (-l 2 --purge-cov 100 --high-het -s 0.01). Then, the contig version of the genome assembled by hifiasm was mounted on chromosomes using HiC-Pro (v2.11.1) and ALLHiC (0.9.13) using the clean reads of Hi-C. Finally, Juicebox (v1.11.08) was used to manually correct the assembled genome.

[0079] 4) Molecular marker development

[0080] Based on the assembled reference genome sequences of N531_R (resistant) and its recurrent parent N531 (susceptible), R Within the confidence interval, blastn software was used to compare and found that N531_R (resistant) had an 11362bp Indels insertion sequence in the confidence interval compared with its recurrent parent N531 (susceptible) genome sequence. Based on the insertion sequence, a dominant marker was designed using PrimerPremier5. The primers can amplify a 487bp PCR product in N531_R (resistant) material, but no PCR product can be amplified in the recurrent parent N531 (susceptible).

[0081] 5) Molecular marker amplification

[0082] The developed primers were used to perform PCR in different maize inbred lines and materials. The amplification system is shown in Table 2.

[0083] Table 2:

[0084]

[0085] The PCR amplification program is shown in Table 3.

[0086] Table 3:

[0087]

[0088] 6) Genotyping by molecular markers

[0089] The genotype identification of InDel molecules was performed using 1% agarose. The process is as follows:

[0090] (1) Weigh 1 g of agarose, add 100 ml of 1×TAE, and heat in a microwave oven for about 3 min;

[0091] (2) Add 8 μl of GelStain to the agarose solution and mix well;

[0092] (3) Pour the solution into the slot where the comb is inserted, and after it cools and solidifies, place it into the electrophoresis solution;

[0093] (4) Add 5 μl of PCR stock solution and Marker 3, 140 V, 20 min.

[0094] (5) Take photos using the gel imaging system.

[0095] (3) Results analysis

[0096] After comparing the reference genome sequence, it was found that there was a DNA deletion in the reference genome of its recurrent parent N531 compared to N531_R ( Figure 3 To this end, a gene for tracking the main effect loci of southern rust resistance was designed based on the reference genome of the disease-resistant material N531_R. R The dominant molecular marker: Ins_RppSLN (primer sequence: Forward Primer: GTTTCAAGGAAATACATGGCCT (SEQ ID NO.2); Reverse Primer: GTGGTTTTTTCCCCTTCACTTTG (SEQ ID NO.3)), the length of the sequence amplified by this primer is 487 bp (the disease-resistant material can amplify the band, while the susceptible material has no amplified band). In order to verify the relationship between this molecular marker and southern rust resistance in maize inbred lines, the southern rust resistance identification of 48 maize inbred lines and the genotype identification of the developed molecular marker were carried out (Table 4, Figure 3 ), the results showed that the five inbred lines with good resistance to southern rust were able to amplify the target band (including the disease-resistant parent N531_R in the F2 mapping population, Figure 1 ), while the inbred lines that showed disease resistance were susceptible or highly susceptible (including the susceptible parent F35 in the F2 mapping population, Figure 1) failed to amplify the target band, indicating that the developed Indel molecular marker Ins_RppSLN can be used for molecular evaluation of southern rust resistance of maize inbred lines. The specific nucleotide sequence of the Indel molecular marker Ins_RppSLN is shown in SEQ ID NO.1 below.

[0097] The nucleotide sequence of SEQID NO.1 is specifically:

[0098] GTTTCCAAGGAAATACATGGCCTGTGCCACTAAAAGTACACTTCACACAAAATCCACACAAGATAGTTTCGAGAAAATATATGACAGCTTATAAAATAGAGACAGATACAGGTAACACATGAACTGCATCACTTGGGTCCATCTCCCTCTTCAATGTGATTTTAGACTAAGAACCACAAATATAATTAACAAGCCATGCCAATGCTTCTAATCATCTTGCTGAACAGGACCTCTCTCTTGGTA CTGAAGCAACTCACATTTACCTGAAATATTGGTTTGTGTATAGTAAATAAGTTGAAATGCAAAGGATGGAGCAAACATGTAAAGGAAAAATGCAATCACAGAATTTCTTCAAGCAAACAGTAATGATACAAGGTTTTTTTGGCCAATGTTATAAATGAATGCGACACAAATAGGATCAATCACAGAGAAGACACGGATTTAACGTGGAAAACCCCTCCAAAGTGAAGGGGAAAAAACCAC.

[0099] (4) To further verify the application effect of the Indel molecular marker Ins_RppSLN in improving maize germplasm resistance to southern rust, the southern rust-resistant material N531_R1 was used as the donor parent, and the maize inbred lines Chang 7-2 and Zheng 58 susceptible to southern rust were used as recurrent parents (Table 4). Backcrossing was performed twice to construct BC2F1 backcross populations. The two backcross populations were planted under inoculation conditions. After the onset of southern rust, disease-resistant and disease-susceptible plants were selected for genotyping of the disease-resistance molecular auxiliary selection marker Ins_RppSLN ( Figure 4), the results showed that the individual plants that could successfully amplify the Ins_RppSLN band were resistant to southern rust, while the individual plants without the Ins_RppSLN amplified band were susceptible to southern rust. This result further shows that the Indel molecular marker Ins_RppSLN of the present invention can be used for auxiliary selection and screening for southern rust resistance in the process of corn germplasm improvement.

[0100] Table 4. Genotypes and disease resistance ratings of the southern rust resistance auxiliary molecular marker Ins_RppSLN of 48 maize inbred lines

[0101] Serial number Material Name genotype Disease resistance level 1 N531_R Target band type High resistance 2 JING2416K Target band type High resistance 3 P178 Target band type anti- 4 Qi319 Target band type Zhongkang 5 K22 Target band type High resistance 6 F35 No target band type High Sensitivity 7 JING2416 No target band type High Sensitivity 8 ZHENG58 No target band type High Sensitivity 9 TIE7922 No target band type High Sensitivity 10 K12 No target band type High Sensitivity 11 JI853 No target band type High Sensitivity 12 JING24 No target band type High Sensitivity 13 ZHONG106 No target band type feel 14 B97 No target band type High Sensitivity 15 CHANG7-2 No target band type High Sensitivity 16 107 No target band type High Sensitivity 17 4F1 No target band type High Sensitivity 18 MS71 No target band type High Sensitivity 19 Oh43 No target band type High Sensitivity 20 Oh7B No target band type High Sensitivity 21 FENG263 No target band type High Sensitivity 22 XUAN6 No target band type High Sensitivity 23 GAN41 No target band type High Sensitivity 24 LONGKANG1 No target band type High Sensitivity 25 DAN340 No target band type High Sensitivity 26 DAN3115 No target band type High Sensitivity 27 GB No target band type High Sensitivity 28 FU85 No target band type High Sensitivity 29 FU8701 No target band type High Sensitivity 30 ZHONG128 No target band type High Sensitivity 31 YE488 No target band type High Sensitivity 32 5003 No target band type High Sensitivity 33 LIAO5110 No target band type High Sensitivity 34 L069 No target band type High Sensitivity 35 R08 No target band type High Sensitivity 36 DAN988 No target band type feel 37 CN165 No target band type feel 38 SHEN5005 No target band type High Sensitivity 39 C103 No target band type High Sensitivity 40 107 No target band type High Sensitivity 41 WK12 No target band type High Sensitivity 42 ZEZI23 No target band type High Sensitivity 43 TIAN77 No target band type High Sensitivity 44 WK858 No target band type feel 45 B73 No target band type High Sensitivity 46 WEIFENG322 No target band type High Sensitivity 47 ZONG3 No target band type High Sensitivity 48 H21 No target band type High Sensitivity

[0102] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be regarded as the protection scope of the present invention.

Claims

1. An Indel molecular marker closely linked to the major QTL locus for maize resistance to southern rust, characterized in that: Its nucleotide sequence is shown in SEQ ID NO.

1.

2. The Indel molecular marker tightly linked to the major QTL locus of maize resistance to southern rust according to claim 1, characterized in that: The Indel molecular marker exists within the confidence interval of the QTL site of the corn plant showing the trait of resistance to southern rust, and is missing from the confidence interval of the QTL site of the corn plant showing the trait of susceptibility to southern rust.

3. The use of the Indel molecular marker according to claim 1, characterized in that: The application includes at least one of the following: 1) Application in identification or screening of southern rust resistance traits in corn; 2) Application in genetic improvement of corn resistance to southern rust; 3) Application in breeding or auxiliary breeding to improve corn resistance to southern rust.

4. A primer pair for amplifying the Indel molecular marker according to claim 1 or 2, characterized in that: The nucleotide sequences of the primer pairs are shown in SEQ ID NO.2 and SEQ ID NO.3 respectively: Forward Primer: GTTCCAAGGAAATACATGGCCT SEQ ID NO.2; Reverse Primer: GTGGTTTTTTCCCCTTCACTTTG SEQ ID NO.

3.

5. The use of the primer pair according to claim 4, characterized in that: The application includes at least one of the following: 1) Application in identification or screening of southern rust resistance traits in corn; 2) Application in genetic improvement of corn resistance to southern rust; 3) Application in breeding or auxiliary breeding to improve corn resistance to southern rust.

6. A method for identifying or screening corn for resistance to southern rust, characterized in that: It includes the following steps: Extracting the genomic DNA of the corn to be tested, and performing PCR amplification using the primer pair described in claim 4; The PCR amplification product is sequenced. When the sequencing result shows that the tested corn plant contains the InDel molecular marker described in claim 1, the tested corn is resistant to southern rust; when the tested corn plant lacks the InDel molecular marker described in claim 1, the tested corn is susceptible to southern rust.

7. A method for breeding corn for genetic improvement of resistance to southern rust, characterized in that: The method uses DNA from leaves of a single corn plant as a template and performs PCR amplification with the primer pair described in claim 4 to obtain an amplified product; the amplified product is sequenced and identified, and if the identification result contains the InDel molecular marker described in claim 1, the corn plant is self-pollinated to obtain a stable genetic inbred line of the target gene.

Images