Method for removing inorganic phosphorus from high-salinity wastewater using mixed marine biofilm communities

Abstract

The invention belongs to the field of microbial technology and environmental protection technology, and discloses a method for removing inorganic phosphorus from high-salinity wastewater by using a mixed community of marine biofilms. The method comprises collecting marine biofilm samples and culturing microorganisms; extracting DNA of the cultured strains for PCR amplification and Sanger sequencing to determine the classification of the isolates; annotating the genome of each strain to determine whether there is ppk1、ppk2 and pap Genes are used to determine whether it is a polyphosphate bacteria; bacterial strains with phosphorus removal ability are inoculated and cultured and the absorbance value is adjusted to obtain a mixed community of marine biofilms; the mixed community of marine biofilms is enriched and cultured with a seawater salt concentration culture medium (marine broth 2216E), and the phosphate removal efficiency of the mixed community is measured with a 2216E liquid culture medium with phosphate added. When the initial phosphorus concentration is 26.5 mg / L, the phosphorus removal efficiency of the present invention reaches 73.97% in 72 hours, providing a new direction for biological phosphorus removal.

Description

Technical Field

[0001] The invention belongs to the field of microbial technology and environmental protection technology, and in particular relates to a method for removing inorganic phosphorus in high-salinity wastewater by utilizing mixed marine biofilm communities. Background Art

[0002] Due to the continuous collection of phosphate ore and the continuous production and utilization of phosphorus-related products, more and more phosphorus is discharged into the environmental water bodies, resulting in an increasing phosphate content in the water bodies, causing eutrophication of the water bodies, aggravated environmental pollution, and more difficult sewage treatment.

[0003] The current methods for removing phosphorus from sewage are mainly physical, chemical and biological methods. Since physical and chemical methods often produce a large amount of precipitation, these precipitations are difficult to recycle and reuse, resulting in pollution and increased recycling costs, sewage treatment plants widely use biological methods, that is, mainly relying on polyphosphate microorganisms to remove phosphates from sewage.

[0004] Sewage treatment plants mainly rely on polyphosphate microorganisms in activated sludge to enrich and recover phosphates. However, the bacteria are diverse and complex in nature, and the current strains with phosphorus removal capabilities have not been cultured in pure form. The composition of the microorganisms that work in each treatment plant is not uniform, and the application cannot be further expanded. In addition, since the strains in the sewage treatment plant rely on sludge and the bacteria in it to remove phosphorus, the presence of sludge will complicate the process: that is, the sludge needs to be precipitated before the phosphate can be recovered, and because the sludge has a high density, it is difficult to change the oxygen concentration. At the same time, since the bacteria in the sewage treatment plant come from activated sludge, and the activity of the microorganisms is weakened or lost at high salt concentrations (>10‰), the pollutant removal efficiency is reduced. When facing some high-salinity wastewater, it is necessary to reduce the salinity before removing phosphorus. The process is relatively complicated, the efficiency is slow, and the cost is correspondingly increased.

[0005] Through the above analysis, the problems and defects of the prior art are as follows:

[0006] (1) Currently, the bacterial strains with phosphorus removal ability have not been cultured in pure form and cannot be expanded for application.

[0007] (2) The existing wastewater phosphorus removal method has a relatively complex process and has high requirements for equipment and conditions.

[0008] (3) The current phosphorus removal microorganisms come from sludge, and their phosphorus removal efficiency is low when dealing with high-salt wastewater. Summary of the invention

[0009] In order to overcome the problems existing in the related art, the disclosed embodiment of the present invention provides a method for removing inorganic phosphorus in high-salinity wastewater by using a mixed community of marine biofilms, which can remove inorganic phosphorus in high-salinity wastewater without relying on complex equipment. The technical solution is as follows:

[0010] The present invention is achieved by using a mixed community of marine biofilms to remove inorganic phosphorus from high-salinity wastewater, comprising:

[0011] S1, collect marine biofilm samples for bacterial isolation and culture the microorganisms; extract DNA of the cultured strains for PCR amplification of 16SrRNA gene and Sanger sequencing to determine the classification of the isolates;

[0012] S2, extract the genome of each strain, assemble, align, predict open reading frames, and perform functional gene annotation to determine whether there is ppk1, ppk2 and pap Genes are used as targets to determine whether they are phosphate-accumulating bacteria and to identify strains with phosphorus removal capabilities;

[0013] S3, respectively preparing an enrichment medium and a phosphate removal medium, inoculating and culturing the screened bacterial strains with phosphorus removal ability, determining the growth stage, and mixing the bacterial liquids in proportion to obtain a marine biofilm mixed community;

[0014] S4, enriching and culturing the mixed community of marine biofilms with 2216E liquid culture medium, and determining the phosphate removal efficiency of the mixed community with 2216E liquid culture medium supplemented with phosphate.

[0015] In step S1, a marine biofilm sample for bacterial isolation is collected and microbial culture is performed, including:

[0016] Natural biofilms on rock surfaces at a depth of 1-2 meters in the subtidal zone were collected using sterile cotton swabs. The swabs were rinsed with seawater that had been filtered through a 0.1 μm filter membrane and sterilized by high pressure, and then diluted 10 times and 100 times, respectively.

[0017] Take 100 μL of the biofilm sample and spread it on a marine agar medium 2216 plate and culture the microorganisms at 25°C under light and aerobic conditions; examine the morphological characteristics of the colonies under a dissecting microscope and separate the obvious colony types;

[0018] DNA was extracted from cells by heating at 100°C for 5 min; PCR amplification was performed using universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3') 16S rRNA gene; Sanger sequencing was then performed to determine the taxonomy of the isolates.

[0019] In step S2, the genomes of each strain are extracted, assembled, aligned, open reading frames predicted, and functional gene annotations are performed, including:

[0020] Before genome sequencing, DNA of cultured strains was extracted using the TIANamp genomic DNA kit with a final lysozyme concentration of 10 mg / mL and incubated at 37°C for 30 min. Lysis buffer GA and buffers GB, GD, and GW were added according to the method provided by the kit. DNA integrity was detected by agarose gel electrophoresis in a Mini-Sub Cell GT system. For each bacterial strain, Illumina sequencing was performed using the NovaSeq 6000 system.

[0021] The returned clean reads were assembled using spades.py in SPAdes, and the integrity and potential contamination of the genome were assessed using Lineage_wf in CheckM. Genomes with a contamination rate of <5% and an integrity of more than 90% were considered high-quality genomes and used for further analysis.

[0022] After whole-genome comparison using fastANI, redundant genomes were removed and genomes with an average nucleotide identity ANI less than 99.9% were retained. Open reading frames (ORFs) were predicted using Prodigal in single genome analysis mode to predict closed-terminated ORFs;

[0023] For functional gene annotation, protein sequences corresponding to ORFs were searched in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database using DIAMOND and BLASTP, with an E value set to <1e -7 ; Based on genes related to phosphate metabolism, including phoU (K02039) , pstSCAB (K02036, K02037, K02038 and K02040) , pgk (K00927) , ppx (K01524) , ppk1 (K00937) , ppk2 (K22468) , phoB (K07657) , ppnK (K00858) and pit (K03306) Preliminarily determine whether the strain has the ability to remove phosphorus; culture the screened bacteria to the logarithmic phase, then add the seed preservation solution and store it in a -80℃ refrigerator; the seed preservation solution is a mixture of glycerol and sterile water in a 1:1 ratio and then sterilized.

[0024] In step S3, the bacterial strains having phosphorus removal ability are determined to include: Psychrobacter nivimaris , Psychrobacter marincola , Psychrobacter namhaensis , Psychrobacter halodurans , Psychrobacter fulvigenes , Psychrobacter celer , Psychrobacter maritimus ,Psychrobacter faecalis , Roseibium aggregatum , Stappia taiwanensis .

[0025] The enrichment medium is prepared by adding sterile water to the 2216E liquid medium, and the components of the medium include: 5.0 g of peptone, 1.0 g of yeast extract powder, 0.1 g of ferric citrate, 19.45 g of sodium chloride, 5.98 g of magnesium chloride, 3.24 g of sodium sulfate, 8 g of calcium chloride, 0.55 g of potassium chloride, 0.16 g of sodium carbonate, 0.08 g of potassium bromide, 0.034 g of strontium chloride, 0.022 g of boric acid, 0.004 g of sodium silicate, 0.0024 g of sodium fluoride, 0.0016 g of ammonium nitrate, and 0.008 g of disodium hydrogen phosphate.

[0026] Phosphate removal medium: After sterilizing the 2216E liquid medium, add sterilized 2g / LP disodium hydrogen phosphate mother solution to make the phosphorus concentration 26.5mg / L, and adjust the pH to 7.6±0.2 with 1mol / L NaOH and HCl; then mix the bacterial liquid in proportion to obtain a mixed marine biofilm community.

[0027] The 12 strains of bacteria with phosphorus removal ability that were screened and preserved were inoculated into EP tubes containing 2216E liquid culture medium at an inoculation rate of 1%, and cultured in a constant temperature shaker at 25°C and 180rpm under light and aerobic conditions for 2-3 days; when the bacterial liquid of all strains grew to the logarithmic phase, the bacterial liquid of each strain was aspirated, and the absorbance value of the bacterial liquid of each strain was measured at a wavelength of 600nm using a Thermo scientific multiskan FC microplate reader; according to the absorbance value of the bacterial liquid of each strain, the pure sterilized 2216E liquid culture medium was used as an adjustment liquid, and the absorbance value of the bacterial liquid of each strain was adjusted by dilution or centrifugal resuspension, so that the absorbance values ​​of the bacterial liquids of the 12 strains were unified at 0.2; the 12 strains of bacteria were mixed in the same amount and a preservation liquid equal to the bacterial liquid was added, and the preserved mixed bacterial colony was divided and stored in a -80°C refrigerator; the preservation liquid was obtained by mixing glycerol and sterile water in a ratio of 1:1 and then sterilizing

[0028] The mixed community of marine biofilms was enriched and cultured with 2216E liquid culture medium, specifically: the bacterial solution of the mixed community stored in the refrigerator was inoculated into an EP tube containing 2216E liquid culture medium at a ratio of 1% for activation culture for 2-3 days; the bacterial solution in the EP tube was inoculated into a conical flask containing 2216E liquid culture medium at a ratio of 1%, and cultured in a constant temperature shaker at 25°C and 180rpm under light and aerobic conditions for 3 days; the bacterial solution in the conical flask was inoculated into each well of a six-well plate containing 2216E liquid culture medium at a ratio of 1% and static culture was carried out for 16-18h to form a film.

[0029] It also includes using a pipette to aspirate the culture supernatant containing planktonic bacteria in the six-well plate, then adding 8 ml of 2216E liquid culture medium, and measuring the phosphorus concentration in the culture medium every 12 hours using the molybdenum antimony colorimetric method

[0030] Combining all the above technical solutions, the beneficial effects of the present invention are as follows: the present invention screened and cultured a bacterial community consisting of 12 bacterial strains, and compared the 12 bacterial strains with the NCBI database, which were Psychrobacter nivimaris , Psychrobacter marincola , Psychrobacter namhaensis , Psychrobacter halodurans , Psychrobacter fulvigenes , Psychrobacter celer , Psychrobacter maritimus , Psychrobacter faecalis , Roseibium aggregatum , Stappia taiwanensis When the initial phosphorus concentration was 26.5 mg / L, the phosphorus removal efficiency of the present invention was as high as 73.97% in 72 hours, providing a new direction for biological phosphorus removal.

[0031] The present invention screens and mixes 12 pure cultured bacteria from marine biofilms. This community can exert a high phosphorus removal ability under normal laboratory environment without adjusting the oxygen concentration. The enrichment medium and phosphate removal medium for culturing the community are both the same as the salinity of seawater (30‰), and can treat high-salinity wastewater. The carbon source used is easier to obtain (peptone, yeast powder, etc., which is easier to obtain and more economical than the specific acetate that needs to be provided by sewage treatment plants), and the bacterial community also tends to form a biofilm to facilitate phosphorus recovery, providing a new idea for wastewater phosphorus removal.

[0032] The present invention uses a method for removing inorganic phosphorus from high-salinity wastewater using a mixed community of marine biofilms, constructs an efficient phosphorus removal community consisting of 12 strains of bacteria, and can remove phosphorus from high-salinity wastewater. The present invention broadens the options for wastewater phosphorus removal, helps expand the application of wastewater phosphorus removal, and provides useful information for removing excess phosphates from wastewater and recycling them.

[0033] Compared with commercial phosphorus removal bacteria in high-salinity culture medium, the present invention has a faster phosphorus removal speed and stronger phosphorus removal ability, and is expected to develop a more efficient phosphorus removal bacteria for high-salinity wastewater. The phosphorus removal community of the present invention can remove phosphate under high-salinity conditions, solving the current difficulty in sewage treatment: that is, when faced with wastewater with high salinity, the phosphorus removal efficiency of activated sludge strains decreases, resulting in difficulty in removing phosphate from high-salinity wastewater. BRIEF DESCRIPTION OF THE DRAWINGS

[0034] The accompanying drawings herein are incorporated in and constitute a part of the specification, illustrate embodiments consistent with the present disclosure, and together with the description, serve to explain the principles of the present disclosure;

[0035] Figure 1 is a flow chart of a method for removing inorganic phosphorus from high-salinity wastewater by using a mixed community of marine biofilms provided by an embodiment of the present invention;

[0036] Figure 2 It is a schematic diagram of the phosphorus removal efficiency of the community provided by an embodiment of the present invention;

[0037] Figure 3 It is a comparison chart of the phosphorus removal efficiency of the community provided in the embodiment of the present invention and the phosphorus removal bacteria agent on the market. DETAILED DESCRIPTION

[0038] In order to make the above-mentioned objects, features and advantages of the present invention more obvious and easy to understand, the specific embodiments of the present invention are described in detail below in conjunction with the accompanying drawings. In the following description, many specific details are set forth to facilitate a full understanding of the present invention. However, the present invention can be implemented in many other ways different from those described herein, and those skilled in the art can make similar improvements without violating the connotation of the present invention, so the present invention is not limited by the specific implementation disclosed below.

[0039] The innovation of the present invention is that the 12 bacterial strains of the present invention are all from marine biofilms, and they are mixed into bacterial communities to determine whether there is ppk2 and pap The core innovation is to use genes to determine whether a bacteria is a polyphosphate-accumulating bacterium. This enables the phosphorus-removal community to have a stronger phosphorus-removal ability under higher salinity, and has stronger stability than single bacteria. It can be applied to a variety of environments, and with the support of genomic information, it can be further expanded for application or strain modification to further improve phosphorus removal efficiency and broaden application scenarios. 2216E liquid culture medium is used as the enrichment medium, and 2216E liquid culture medium plus disodium hydrogen phosphate is used as the phosphate removal medium. OD600 0.2 is used as the standard for mixed bacteria. The bacterial community is first allowed to form a film in a 6-well plate for 16-18 hours before being inoculated into the phosphate removal medium. The change in phosphate concentration in the culture medium is determined using an inorganic phosphate detection kit (phosphomolybdic acid method).

[0040] Examples, such as Figure 1 As shown, the method for removing inorganic phosphorus from high-salinity wastewater using a mixed community of marine biofilms provided in an embodiment of the present invention comprises the following steps:

[0041] S1, collect marine biofilm samples for bacterial isolation and culture the microorganisms; extract DNA of cultured strains for PCR amplification 16S rRNA Gene and Sanger sequencing to determine the taxonomy of the isolates;

[0042] S2, extract the genome of each strain, assemble, align, predict open reading frames, and perform functional gene annotation to determine whether there is ppk1, ppk2 and pap Genes determine whether it is a phosphate-accumulating bacterium and determine the strain with phosphorus removal ability;

[0043] S3, respectively preparing an enrichment medium and a phosphate removal medium, inoculating and culturing the screened bacterial strains with phosphorus removal ability, determining the growth stage, and mixing the bacterial liquids in proportion to obtain a marine biofilm mixed community;

[0044] S4, enriching and culturing the mixed community of marine biofilms with 2216E liquid culture medium, and determining the phosphate removal efficiency of the mixed community with 2216E liquid culture medium supplemented with phosphate.

[0045] The biofilm sampling and bacterial separation provided by the embodiment of the present invention include: using a sterile cotton swab to collect natural biofilms on the surface of rocks at a depth of 1-2 meters in the subtidal zone, and using seawater filtered through a 0.1 μm filter membrane and sterilized under high pressure to rinse the cotton swab, and dilute it 10 times and 100 times respectively; taking the biofilm sample and smearing it on a marine agar medium 2216 plate, and then culturing the microorganisms at 25°C under light and aerobic conditions; examining the morphological characteristics of the colonies under a dissecting microscope, and separating obvious colony types; heating at 100°C for 5 minutes to extract DNA from the cells; using universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3') for PCR amplification 16S rRNA The genes were then Sanger sequenced at the Beijing Genomics Institute in China to determine the classification of the isolates. Isolating marine bacteria is conducive to making the final phosphorus removal strains have a higher tolerance to salinity. Isolating culturable bacteria is conducive to distinguishing the functions of each bacteria, which is conducive to further expansion of applications, as well as in-depth analysis and strain modification to obtain more efficient phosphorus removal strains.

[0046] The genome extraction and analysis provided in the embodiment of the present invention includes: before genome sequencing, DNA of the cultured strain is extracted using the TIANamp genomic DNA kit, the final concentration of lysozyme is 10 mg / mL, and it is incubated at 37°C for 30 minutes; lysis buffer GA and buffers GB, GD and GW are added according to the method provided by the kit; the integrity of the DNA is detected by agarose gel electrophoresis in the Mini-Sub Cell GT system; for each bacterial strain, the NovaSeq 6000 system is used for Illumina sequencing. Spades.py in SPAdes (v3.13.0) is used to assemble the returned clean reads. The integrity and potential contamination of the genome are evaluated by Lineage_wf in CheckM (v1.1.2). Genomes with genome contamination <5% and integrity greater than 90% are considered high-quality genomes and used for further analysis. After whole-genome comparison using fastANI, redundant genomes are removed and genomes with an average nucleotide identity (ANI) of less than 99.9% are retained. Open reading frames (ORFs) were predicted using Prodigal (v2.60) in single genome analysis mode to predict closed and terminated ORFs. For functional gene annotation, protein sequences corresponding to ORFs were searched in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (v2022) using DIAMOND and BLASTP, with an E value of <1e -7 Based on genes related to phosphate metabolism, including phoU (K02039) , pstSCAB (K02036, K02037, K02038 and K02040) , pgk (K00927) , ppx (K01524) , ppk1 (K00937) , ppk2 (K22468) , phoB (K07657) , ppnK (K00858) and pit(K03306) Preliminary judgment on whether the strain has the ability to remove phosphorus. The screened bacteria were cultured to the logarithmic phase, and then the seed preservation solution was added and stored in a -80℃ refrigerator; the seed preservation solution was obtained by mixing glycerol and sterile water in a ratio of 1:1 and sterilizing. Determining the bacterial genome is conducive to mining the genes of bacteria. The presence or absence of functional genes can be used to infer certain metabolic functions of bacteria, which is conducive to screening phosphorus removal strains at the genome level, and can provide genetic evidence for strains with phosphorus removal capabilities. When the functional genes are located, it is conducive to the transformation of strains at the genome level, thereby improving the phosphorus removal efficiency. Screening phosphorus removal strains with phosphorus removal-related genes has lower workload and higher efficiency than the traditional plate streaking screening method, and can locate the functional genes that play a role, so that the screened phosphorus removal strains have a clearer understanding of the phosphorus removal principle.

[0047] The bacterial strains with phosphorus removal ability provided by the embodiments of the present invention include: Psychrobacter nivimaris , Psychrobacter marincola , Psychrobacter namhaensis , Psychrobacter halodurans , Psychrobacter fulvigenes , Psychrobacter celer , Psychrobacter maritimus , Psychrobacter faecalis , Roseibium aggregatum , Stappia taiwanensis .

[0048] The enrichment medium provided in the embodiment of the present invention is prepared by adding sterile water to the 2216E liquid medium, wherein the medium components include: 5.0 g of peptone, 1.0 g of yeast extract powder, 0.1 g of ferric citrate, 19.45 g of sodium chloride, 5.98 g of magnesium chloride, 3.24 g of sodium sulfate, 8 g of calcium chloride, 0.55 g of potassium chloride, 0.16 g of sodium carbonate, 0.08 g of potassium bromide, 0.034 g of strontium chloride, 0.022 g of boric acid, 0.004 g of sodium silicate, 0.0024 g of sodium fluoride, 0.0016 g of ammonium nitrate, and 0.008 g of disodium hydrogen phosphate;

[0049] The phosphate-removed medium is prepared by sterilizing the 2216E liquid medium, adding sterilized 2g / LP disodium hydrogen phosphate mother solution to adjust the phosphorus concentration to 26.5mg / L, and adjusting the pH to 7.6±0.2 with 1mol / L NaOH and HCl.

[0050] The bacterial flora mixing provided in the embodiment of the present invention includes: inoculating 12 preserved bacterial strains with phosphorus removal ability into an EP tube containing 2216E liquid culture medium at an inoculation rate of 1%, and culturing for 2-3 days in a 25°C constant temperature shaker at 180rpm under light and aerobic conditions; when the bacterial liquid of all strains grows to the exponential phase, absorbing the bacterial liquid of each strain, and measuring the absorbance value of the bacterial liquid of each strain at a wavelength of 600nm using a Thermo scientificmultiskan FC microplate reader; according to the absorbance value of the bacterial liquid of each strain, using a pure sterilized 2216E liquid culture medium as an adjustment liquid, adjusting the absorbance value of the bacterial liquid of each strain by dilution or centrifugal resuspension method, so that the absorbance values ​​of the bacterial liquids of the 12 strains are unified at 0.2; mixing the 12 bacterial strains in the same amount and adding a preservation liquid in an amount equal to the bacterial liquid, packaging the preserved mixed bacterial flora and storing it in a -80°C refrigerator; the preservation liquid is obtained by mixing glycerol and sterile water in a ratio of 1:1 and then sterilizing.

[0051] The enrichment culture of the mixed community provided in the embodiment of the present invention includes: inoculating the bacterial solution of the mixed community stored in the refrigerator into an EP tube containing 2216E liquid culture medium at a ratio of 1% for activation culture for 2-3 days; taking the bacterial solution in the EP tube and inoculating it into a conical flask containing 2216E liquid culture medium at a ratio of 1%, and culturing it in a constant temperature shaker at 25°C for 3 days under light and aerobic conditions at 180rpm; taking the bacterial solution in the conical flask and inoculating it into a six-well plate containing 2216E liquid culture medium in each well at a 1% inoculation amount and statically culturing for 16-18h to form a film. Carefully aspirate the culture supernatant containing planktonic bacteria in the six-well plate with a pipette, and then add 8ml of 2216E liquid culture medium. The phosphorus concentration in the culture medium is measured every 12 hours using the molybdenum antimony colorimetric method. Mixing strains that have been screened and verified to have phosphorus removal functions into communities is more stable than single phosphorus removal strains, more suitable for application in a variety of environments, and less likely to lose the phosphorus removal function. The mixed community has a strong film-forming ability and can be more firmly attached to solid carriers, making the phosphorus obtained by biological adsorption more concentrated, which is beneficial to the enrichment and recovery of phosphates.

[0052] In the above embodiments, the description of each embodiment has its own emphasis. For parts that are not described or recorded in detail in a certain embodiment, reference can be made to the relevant descriptions of other embodiments.

[0053] In order to further demonstrate the positive effects of the above embodiment, the present invention conducts the following experiments based on the above technical solution.

[0054] 1. Biofilm sampling and bacterial isolation:

[0055] Biofilms for bacterial isolation were collected in the coastal area of ​​Qingdao, China (36.05, 120.43) in March 2019. Natural biofilms on rock surfaces located at a depth of 1–2 m in the subtidal zone were scraped off with sterile cotton swabs and immediately transferred to the laboratory. The cotton swabs were thoroughly rinsed with 10 mL of seawater filtered through a 0.1 μm filter membrane and sterilized by autoclave, and then diluted 10-fold and 100-fold, respectively. 100 µL of each biofilm sample was spread on a marine agar medium 2216 plate (Haibo Biotech). Microbial culture was then performed at 25 °C under light and aerobic conditions. The morphological characteristics of the colonies, including size, color, shape, and surface morphology, were examined under a dissecting microscope, and distinct colony types were isolated. DNA was extracted from the cells by heating at 100°C for 5 min; PCR was performed to amplify the 16SrRNA gene using universal primers 27F (5'-AGAGTTTGATCCTGGCTCAG-3') and 1492R (5'-GGTTACCTTGTTACGACTT-3'), and then Sanger sequencing was performed at the Beijing Genomics Institute in China to determine the classification of the isolates. The strains used in the present invention and their 16SrRNA genes were compared with the NCBI database:

[0056] H023, 16s-NCBI comparison results: Psychrobacter nivimaris

[0057] L010, 16s-NCBI alignment results: Psychrobacter marincola

[0058] L022, 16s-NCBI comparison results: Psychrobacter namhaensis

[0059] L037, 16s-NCBI comparison results: Psychrobacter halodurans

[0060] S259, 16s-NCBI alignment results: Psychrobacter fulvigenes

[0061] S270, 16s-NCBI alignment results: Psychrobacter namhaensis

[0062] S279, 16s-NCBI alignment results: Psychrobacter celerPsychrobacter faecalis , 16S rRNA sequence: GTAGTGGGGGATAGCTCGGGGAAACTCGAATTAATACCGCATACGACCTACGGGAGAAAGGGGGCAACTTGTTGCTCTCGCTATTAGATGAGCCTAAGTCGGATTAGCTAGATGGTGGGGTAAAGGCCTACCATGGCGACGATCTGTAGCTGGTCTGAGAGGATGATCAGCCACACCGGGACTGAGACACGGCCCGGACTCCTACGGGAGGCAGCAGTGGGGAATATTGGACAATGGGGGCAACCCTGATCCAGCCATGCCGCGTGTGTGAAGAAGGCCTTTTGGTTGTAAAGCACTTTAAGCAGTGAAGAAGACTCTATGGTTAATACCCATGGGCGATGACATTAGCTGCAGAATAAGCACCGGCTAACTCTGTGCCAGCAGCCGCGGTAATACAGAGGGTGCAAGCGTTAATCGGAATTACTGGGCGTAAAGCGAGCGTAGGTGGCTTGATAAGTCAGATGTGAAATCCCCGGGCTTAACCTGGGAACTGCATCTGATACTGTTAAGCTAGAATAGGTGAGAGGAAGGTAGAATTCCAGGTGTAGCGGTGAAATGCGTAGAGATCTGGAGGAATACCGATGGCGAAGGCAGCCTCCTGGCATCATACTGACACTGAGGCTCGAAAGCGTGGGTAGCAAACAGGATTAGATACCCTGGTAGTCCACGCCGTAAACGATGTCTACTAGTCGTTGGGGCACCTTGATTGACTTAGTGACGCAGCTAACGCAATAAGTAGACCGCCTGGGGAGTACGGCCGCAAGGTTAAAACTCAAATGAATTTGACGGGGCCCGCACAAGCGGTGGAGCATGTGGTTTAATTCGATGCA,

[0063] S310, 16s-NCBI alignment result: Psychrobacter celerPsychrobacter maritimus

[0064] S419, 16s-NCBI alignment results: Roseibium aggregatum

[0065] Z008, 16s-NCBI alignment results: Stappia taiwanensis

[0066] In the present invention, 12 bacterial strains were selected and one representative strain from each of the three genera was deposited, and the deposit numbers are: S344: CCTCCM 20241514, S419: CCTCCM 20241515, and Z008: CCTCCM 20241516.

[0067] 2. Genome extraction and analysis:

[0068] Before genome sequencing, DNA of cultured strains was extracted using the TIANamp genomic DNA kit, with a final concentration of lysozyme of 10 mg / mL and incubated at 37°C for 30 min; lysis buffer GA and buffers GB, GD, and GW were added according to the method provided by the kit; DNA integrity was detected by agarose gel electrophoresis in the Mini-Sub Cell GT system; for each bacterial strain, Illumina sequencing was performed using the NovaSeq 6000 system. Genome assembly was performed on the returned clean reads using spades.py in SPAdes (v3.13.0). The integrity and potential contamination of the genome were assessed using Lineage_wf in CheckM (v1.1.2). Genomes with genome contamination <5% and integrity greater than 90% were considered high-quality genomes and used for further analysis. After whole-genome comparison using fastANI, redundant genomes were removed and genomes with an average nucleotide identity (ANI) of less than 99.9% were retained. Open reading frames (ORFs) were predicted using Prodigal (v2.60) in single genome analysis mode to predict closed and terminated ORFs. For functional gene annotation, protein sequences corresponding to ORFs were searched in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database (v2022) using DIAMOND and BLASTP, with an E value of <1e -7 Based on genes related to phosphate metabolism, including phoU (K02039) 、 pstSCAB (K02036, K02037, K02038 and K02040) , pgk (K00927) , ppx (K01524) , ppk1 (K00937) 、 ppk2 (K22468) , phoB (K07657) , ppnK (K00858) and pit(K03306) Preliminary determination of whether the strain has phosphorus removal ability. The selected bacteria were cultured to the logarithmic phase, and then added with seed preservation solution and stored in a -80℃ refrigerator; the seed preservation solution was obtained by mixing glycerol and sterile water in a ratio of 1:1 and then sterilizing.

[0069] 3. Culture medium preparation:

[0070] All bacteria and communities were enriched and cultured in 2216E liquid medium, and the phosphate removal efficiency of the community was determined in 2216E liquid medium supplemented with phosphate. The following are the specific formulas of each culture medium: Enrichment medium: 2216E liquid medium was prepared by adding sterile water to 2216E liquid medium. Ingredients (g / L): peptone 5.0g, yeast extract powder 1.0g, ferric citrate 0.1g, sodium chloride 19.45g, magnesium chloride 5.98g, sodium sulfate 3.24g, calcium chloride 8g, potassium chloride 0.55g, sodium carbonate 0.16g, potassium bromide 0.08g, strontium chloride 0.034g, boric acid 0.022g, sodium silicate 0.004g, sodium fluoride 0.0024g, ammonium nitrate 0.0016g, disodium hydrogen phosphate 0.008g.

[0071] Phosphate-removed medium: After the above 2216E liquid medium is sterilized, add sterilized 2 g / LP disodium hydrogen phosphate mother solution to make the phosphorus concentration about 26.5 mg / L, and adjust the pH to 7.6±0.2 with 1 mol / L NaOH and HCl.

[0072] 4. Mixed flora:

[0073] According to the above steps, a total of 12 bacterial strains with potential phosphorus removal ability were screened. The 12 bacterial strains that have been preserved were inoculated into a 15mL EP tube containing 5mL 2216E liquid culture medium at a 1% inoculation rate, and cultured for 2-3 days in a 25℃ constant temperature shaker at 180rpm under light and aerobic conditions. When the bacterial liquid of all strains grows to a certain extent, the bacterial liquid of each strain is aspirated, and the absorbance value of each strain bacterial liquid is measured at a wavelength of 600nm using a Thermo scientific multiskan FC microplate reader. According to the absorbance value of each strain bacterial liquid, pure sterilized 2216E liquid culture medium is used as an adjustment liquid, and the absorbance value of each strain bacterial liquid is adjusted by dilution or centrifugal resuspension, so that the absorbance value of the 12 strain bacterial liquid is unified at 0.2. After that, the 12 strains of bacteria are mixed together in the same amount, and the same amount of preservation liquid as the bacterial liquid is added. The mixed bacterial colony with good preservation is divided and stored in a -80℃ refrigerator for later use. The seed preservation solution is obtained by mixing glycerol and sterile water in a ratio of 1:1 and then sterilizing.

[0074] 5. Enrichment culture:

[0075] The mixed bacterial suspension stored in the refrigerator was inoculated into a 15mL EP tube containing 5mL 2216E liquid medium at a ratio of 1% and cultured for 2-3 days to activate the low-activity community stored in the refrigerator. Then the bacterial suspension in the 15mL EP tube was aspirated and inoculated into a 500mL conical flask containing 200mL 2216E liquid medium at a ratio of 1%, and cultured for 3 days in a 25℃ constant temperature shaker at 180rpm under light and aerobic conditions. Then the bacterial suspension in the conical flask was inoculated into a six-well plate containing 8mL 2216E liquid medium per well at a 1% inoculation rate and cultured for 16-18h to form a film.

[0076] 6. Determination of phosphorus removal efficiency:

[0077] The supernatant of the bacterial solution in the above six-well plate was carefully sucked away with a pipette, and then 800 μL of 2216E liquid culture medium was added. After that, the film-forming bacteria were resuspended in the bacterial solution by blowing with a new pipette tip and rubbing the bottom of the six-well plate. Then the resuspended bacterial solution in the six-well plate was sucked away and inoculated into a six-well plate with 8 mL of 2216E liquid culture medium containing additional phosphate in each well for static culture. Each sample was repeated 3 times. The total phosphorus concentration in the culture medium was determined every 12 hours using an inorganic phosphorus test kit (Nanjing Jiancheng Bioengineering Institute). The principle of the kit for determining phosphate is the phosphomolybdic acid method. The specific measurement process is to take 300 μL of the bacterial solution in the six-well plate, centrifuge it at 6000 rpm for 5 minutes, and take 200 μL of the supernatant for subsequent determination. The standard curve was prepared according to the operating method of the kit, and the residual phosphate concentration was calculated according to the absorbance value of each sample and the formula of the standard curve. The phosphate removal efficiency was calculated as the ratio of the removed phosphate to the total phosphate. The phosphate concentration in the bacterial solution in the six-well plate changes with time. Figure 2 shown.

[0078] 7. Comparison of phosphorus removal efficiency:

[0079] The phosphorus removal efficiency of two commercially available bacterial agents, namely the phosphorus removal bacteria of Guangzhou Yinneng Bio-Environment Technology Co., Ltd. and the total phosphorus removal bacteria of Liboyuan Environmental Protection Materials, was measured with the synthetic community according to the six-process method. The phosphorus removal efficiency was as follows: Figure 3 shown.

[0080] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any modifications, equivalent substitutions and improvements made by any technician familiar with the technical field within the technical scope disclosed by the present invention and within the spirit and principles of the present invention should be covered within the protection scope of the present invention.

Claims

1. A method for removing inorganic phosphorus from high-salinity wastewater using a mixed community of marine biofilms, characterized in that: The method includes: S1, collect marine biofilm samples for bacterial isolation and culture the microorganisms; extract DNA of cultured strains for PCR amplification of 16SrRNA gene and Sanger sequencing to determine the classification of isolates; S2, extract the genome of each strain, assemble, align, predict the open reading frame and perform functional gene annotation, and determine whether it is a phosphate-accumulating bacterium based on the presence of ppk1, ppk2 and pap genes, and determine the strain with phosphorus removal ability; S3, respectively preparing an enrichment medium and a phosphate removal medium, inoculating and culturing the screened bacterial strains with phosphorus removal ability, determining the growth stage, and mixing the bacterial liquids in proportion to obtain a marine biofilm mixed community; S4, enriching and culturing the mixed community of marine biofilms with 2216E liquid medium, and determining the phosphate removal efficiency of the mixed community with 2216E liquid medium supplemented with phosphate; The strains identified as having phosphorus removal capabilities included: Psychrobacternivimaris, Psychrobactermarincola, Psychrobacternamhaensis, Psychrobacterhalodurans, Psychrobacterfulvigenes, Psychrobacterceler, Psychrobactermaritimus, Psychrobacterfaecalis, Roseibiumaggregatum, and Stappiataiwanensis.

2. The method for removing inorganic phosphorus from high-salinity wastewater using a mixed community of marine biofilms according to claim 1, characterized in that: In step S1, a marine biofilm sample for bacterial isolation is collected and microbial culture is performed, including: Natural biofilms on rock surfaces at a depth of 1-2 m in the subtidal zone were collected using sterile cotton swabs. The swabs were rinsed with seawater that had been filtered through a 0.1 μm filter membrane and sterilized by high pressure, and then diluted 10 and 100 times, respectively. Take 100 μL of the biofilm sample and spread it on a marine agar medium 2216 plate and culture the microorganisms at 25°C under light and aerobic conditions; examine the morphological characteristics of the colonies under a dissecting microscope and separate the obvious colony types; DNA was extracted from cells by heating at 100°C for 5 min. 16S rRNA gene was amplified by PCR using universal primers 27F-5'-AGAGTTTGATCCTGGCTCAG-3' and 1492R-5'-GGTTACCTTGTTACGACTT-3'. Sanger sequencing was then performed to determine the classification of the isolates.

3. The method for removing inorganic phosphorus from high-salinity wastewater using mixed marine biofilm communities according to claim 1, characterized in that: In step S2, the genomes of each strain are extracted, assembled, aligned, open reading frames predicted, and functional gene annotations are performed, including: Before genome sequencing, DNA of cultured strains was extracted using the TIANamp genomic DNA kit with a final lysozyme concentration of 10 mg / mL and incubated at 37°C for 30 min. Lysis buffer GA and buffers GB, GD, and GW were added according to the method provided by the kit. DNA integrity was detected by agarose gel electrophoresis in a Mini-Sub Cell GT system. For each bacterial strain, Illumina sequencing was performed using the NovaSeq 6000 system.

4. The method for removing inorganic phosphorus from high-salinity wastewater using mixed marine biofilm communities according to claim 3, characterized in that: Also includes: The returned clean reads were assembled using spades.py in SPAdes, and the completeness and potential contamination of the genome were assessed using Lineage_wf in CheckM. Genomes with a contamination rate of <5% and an integrity rate of more than 90% were considered high-quality genomes and used for further analysis. After whole-genome comparison using fastANI, redundant genomes were removed and genomes with an average nucleotide identity ANI of less than 99.9% were retained. Open reading frames (ORFs) were predicted using Prodigal in single genome analysis mode to predict closed and terminated ORFs; In order to perform functional gene annotation, the protein sequences corresponding to ORFs were searched in the Kyoto Encyclopedia of Genes and Genomes (KEGG) database using DIAMOND and BLASTP, and the E value was set to <1e-7. Based on genes related to phosphate metabolism, including phoU-K02039, pstSCAB-K02036, K02037, K02038 and K02040, pgk-K00927, ppx-K01524, ppk1-K00937, ppk2-K22468, phoB-K07657, ppnK-K00858 and pit-K03306, it was preliminarily determined whether the strain had the ability to remove phosphorus. The screened bacteria were cultured to the logarithmic phase, and then the seed preservation solution was added and stored in a -80℃ refrigerator; the seed preservation solution was obtained by mixing glycerol and sterile water in a ratio of 1:1 and then sterilizing.

5. The method for removing inorganic phosphorus from high-salinity wastewater using mixed marine biofilm communities according to claim 1, characterized in that: The enrichment medium is prepared by adding sterile water to the 2216E liquid medium, and the components of the medium include: 5.0 g of peptone, 1.0 g of yeast extract powder, 0.1 g of ferric citrate, 19.45 g of sodium chloride, 5.98 g of magnesium chloride, 3.24 g of sodium sulfate, 8 g of calcium chloride, 0.55 g of potassium chloride, 0.16 g of sodium carbonate, 0.08 g of potassium bromide, 0.034 g of strontium chloride, 0.022 g of boric acid, 0.004 g of sodium silicate, 0.0024 g of sodium fluoride, 0.0016 g of ammonium nitrate, and 0.008 g of disodium hydrogen phosphate.

6. The method for removing inorganic phosphorus from high-salinity wastewater using mixed marine biofilm communities according to claim 5, characterized in that: Phosphate removal medium: After sterilizing the 2216E liquid medium, add sterilized 2g / LP disodium hydrogen phosphate mother solution to make the phosphorus concentration 26.5mg / L, and adjust the pH to 7.6±0.2 with 1mol / L NaOH and HCl; then mix the bacterial liquid in proportion to obtain a mixed marine biofilm community.

7. The method for removing inorganic phosphorus from high-salinity wastewater using mixed marine biofilm communities according to claim 6, characterized in that: Also includes: The 12 strains of bacteria with phosphorus removal ability that have been screened and preserved are inoculated into an EP tube containing 2216E liquid culture medium at an inoculation rate of 1%, and cultured in a constant temperature shaker at 25°C and 180rpm under light and aerobic conditions for 2-3 days; when the bacterial liquid of all strains grows to the logarithmic phase, the bacterial liquid of each strain is aspirated, and the absorbance value of the bacterial liquid of each strain is measured at a wavelength of 600nm using a Thermo scientific multiskan FC microplate reader; according to the absorbance value of the bacterial liquid of each strain, the pure sterilized 2216E liquid culture medium is used as an adjustment liquid, and the absorbance value of the bacterial liquid of each strain is adjusted by dilution or centrifugal resuspension method, so that the absorbance values ​​of the bacterial liquids of the 12 strains are unified at 0.2; the 12 strains of bacteria are mixed in the same amount and a preservation liquid equal to the bacterial liquid is added, and the preserved mixed bacterial community is divided and stored in a -80°C refrigerator; the preservation liquid is obtained by mixing glycerol and sterile water in a ratio of 1:1 and then sterilizing.

8. The method for removing inorganic phosphorus from high-salinity wastewater using mixed marine biofilm communities according to claim 7, characterized in that: The mixed community of marine biofilms was enriched and cultured with 2216E liquid culture medium, specifically: the bacterial solution of the mixed community stored in the refrigerator was inoculated into an EP tube containing 2216E liquid culture medium at a ratio of 1% for activation and culture for 2-3 days; the bacterial solution in the EP tube was inoculated into a conical flask containing 2216E liquid culture medium at a ratio of 1%, and cultured in a constant temperature shaker at 25°C and 180rpm under light and aerobic conditions for 3 days; the bacterial solution in the conical flask was inoculated into a six-well plate containing 2216E liquid culture medium in each well at a ratio of 1% and statically cultured for 16-18 hours to form a film.

9. The method for removing inorganic phosphorus from high-salinity wastewater using mixed marine biofilm communities according to claim 8, characterized in that: It also includes using a pipette to aspirate the culture supernatant containing planktonic bacteria in the six-well plate, then adding 8 ml of 2216E liquid culture medium, and measuring the phosphorus concentration in the culture medium every 12 hours using the molybdenum antimony colorimetric method.

Images