East asian phellinus and application thereof

Abstract

The application belongs to the technical field of medicine, and particularly relates to Phellinus orientoasiaticus and application thereof. Phellinus orientoasiaticus (strain IFPW11189) is preserved in the China General Microbiological Culture Collection Center, and the preservation date is August 15, 2024, and the preservation number is CGMCC No.41436. The application can improve the flavone yield of liquid-state fermentation of Phellinus orientoasiaticus, and provides scientific guidance for the development of medicinal fungal resources.

Description

Technical Field

[0001] The invention belongs to the technical field of medicine, and in particular relates to an East Asian phyllophora and an application thereof. Background Art

[0002] Phellinus fungi are a large group of fungi with a semicircular to nearly horseshoe-shaped cap, a yellowish-brown, porous hymenium, and a hardwood-like, corky texture. They belong to the Hymenochaetaceae family, order Hymenochaetales, phylum Basidiomycota. They contain a variety of active substances, including polysaccharides, flavonoids, and triterpenes (Jianghu Dachuan et al. 2018), as well as vitamins and trace elements essential for human life (Yu Yanjie et al. 2022), and have excellent medicinal value. According to modern fungal taxonomy, they may belong to different genera, including Fomitiporia, Phellinus, Phylloporia, Porodaedalea, Sanghuangporus, and Tropicoporus (Wu Shenghua and Dai Yucheng 2020). At present, research on the genus Phellinus mainly focuses on Sanghuangporus sanghuang (Zhang Jian et al. 2023), Sanghuangporus baumii (Fu Lizhong et al. 2021), Sanghuangporus lonicericola (Zhu Shumei 2022), and Sanghuangporus vaninii (Zhang Yangyang et al. 2023). It has more than 20 pharmacological functions (Wu et al. 2019; 2020), including antibacterial, antioxidant, anti-tumor, immunity-enhancing, and lipid-lowering (Dai et al. 2010).

[0003] Flavonoids possess potent antioxidant properties, regulating the body's enzyme systems to prevent the normal growth of cancer cells and achieve both cancer prevention and treatment (Zhu Shumei, 2022). Flavonoids from Phellinus igniarius grown in the wild possess potent antioxidant properties, playing a significant role in its medicinal properties (Ye Jingjing et al., 2021).

[0004] Phellinus orientoasiaticus belongs to the family of Hymenochaetaceae, and its cap is semicircular to nearly horseshoe-shaped, with a light gray-brown or dark brown surface, and a pore layer of yellow-brown, which is hard and corky when fresh, and hard and woody after drying. It usually grows on living trees of Rosaceae, especially peach and apple trees, and is widely distributed in Northeast China, North China and Southwest China (Li Yu et al. 2015). Phellinus orientoasiaticus is a closely related fungus to the genus Phellinus, and is highly similar to Phellinus ribis in appearance. It is occasionally sold as "Phellinus ribis" on the market, and is therefore called "pseudo-Phellinus ribis". Previous studies have found that Phellinus orientoasiaticus has good medicinal value through comparative studies of the content of medicinal active substances and antioxidant activity of Phellinus orientoasiaticus, Phellinus ribis and Phellinus mori (Zhang Siyao et al. 2023). Given the limited amount of fruiting bodies obtained, the development and utilization of Phellinus orientoasiaticus will have important guiding significance for the medicinal fungus resources in China. SUMMARY

[0005] The purpose of the present application is to provide a Phellinus orientoasiaticus and its application.

[0006] To achieve the above-mentioned purpose, the technical solution adopted by the present application is as follows:

[0007] A Phellinus orientoasiaticus, Phellinus orientoasiaticus, strain IFPW11189, preserved in the China General Microbiological Culture Collection Center, No. 3, Beichen West Road, Chaoyang District, Beijing. The preservation date is August 15, 2024, and the preservation number is CGMCC No. 41436.

[0008] The application of the Phellinus orientoasiaticus in the production of flavonoids.

[0009] The application of the Phellinus orientoasiaticus in the production of flavonoids under liquid fermentation conditions.

[0010] A method for preparing flavonoids using the strain, wherein the Phellinus orientoasiaticus is subjected to liquid fermentation to obtain high-yield flavonoids.

[0011] The mycelial suspension of the strain is inoculated into a liquid medium, and shaken at 120 r / min and 28℃. After 10 days, the mycelium is broken by a homogenizer to obtain a mycelial suspension, which is ready for use.

[0012] The liquid medium is prepared by adding yeast extract (10 g / L), KH2PO4 (0.08%), CaCO3 (0.05%), MgSO4 (0.05%) and vitamin B1 (0.1%) per liter of water.

[0013] The mycelial suspension of the strain obtained above is inoculated into a culture medium, and cultured at 28° C. and 120 r / min for 10 days to obtain a high yield of flavonoids.

[0014] The culture medium is prepared by adding 17.12 g / L glucose, 6.91 g / L peptone, KH2PO4 (0.07%), CaCO3 (0.05%), MgSO4 (0.05%), and vitamin B1 (0.1%) to each liter of water, and the inoculation amount is 2.30%.

[0015] The advantages of the present invention are:

[0016] The present invention discloses a strain of the East Asian woody fungus obtained by isolating the fruiting bodies collected from wild apricot trees and having high medicinal value. The optimized liquid fermentation method thereof has the following advantages:

[0017] 1. The strain culture method is simple, the growth rate is fast, and it is not easy to mutate;

[0018] 2. This strain has high levels of various medicinal ingredients and strong antioxidant activity;

[0019] 3. In the optimized scheme, the flavonoid content obtained under the conditions of glucose 17.12g / L, peptone 6.91g / L, KH2PO4 (0.07%), CaCO3 (0.05%), MgSO4 (0.05%), vitamin B1 (0.1%), and inoculation amount of 2.30% was relatively the highest, which was 905.66mg / L, which was 30% higher than the 692.44mg / L in the seed culture medium.

[0020] The invention can improve the flavonoids yield of liquid fermentation of East Asian phyllophora, and provide scientific guidance for the development of medicinal fungus resources. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 This is a diagram showing the effect of total flavonoid content in fermentation broths of liquid culture media with different carbon sources and nitrogen sources provided in Example 3 of the present invention.

[0022] Figure 2 The effects of different nitrogen sources, carbon sources, KH2PO4 addition amounts and different inoculation amounts on the total flavonoid content of the fermentation broth provided in Example 3 of the present invention.

[0023] Figure 3 This is the response surface diagram of Y=f(A, D) provided in Example 3 of the present invention.

[0024] Figure 4Heat map of the ABTS free radical scavenging ability of the fermentation broth after liquid fermentation of the five strains provided in Example 4 of the present invention; among them, A: East Asian wood-based fungus, B: Vani linterinia, C: Light nuclear fiber fungus, D: Quercus linterinia, E: Baum linterinia, and the control is vitamin C (Vc). DETAILED DESCRIPTION

[0025] The present application will be further explained below with reference to the embodiments.

[0026] Example 1

[0027] Isolation and identification of Phellinus orientoasiaticus:

[0028] 1. Isolation of strains:

[0029] The surface of fruiting bodies of wild-collected F. arguta was disinfected with 75% alcohol for 20 seconds. The surface was then scraped with a blade. Small pieces of flesh were then removed with tweezers and placed in PDA culture media, three per medium. The cells were cultured in a 28°C incubator for 7 days and passaged twice to obtain the target strain.

[0030] 2. Identification of strains:

[0031] 2.1 Morphological identification

[0032] The fruiting body of this fungus is perennial, with a distinct cap-like or flat, recurved, imbricate, and woody appearance. The cap is semicircular to horseshoe-shaped, with a light gray-brown to dark brown surface that later cracks, with blunt, gray-brown margins. The pores are gray-brown and non-refractive, and are round, with 5-7 per millimeter. The flesh is yellowish-brown and up to 5 cm thick. The tubes are reddish-brown, 1-3.5 cm long, and have distinct stratification. The mycelium is cottony and white.

[0033] 2.2 Homology Analysis

[0034] The ITS sequence of this strain is:

[0035] TCCGAAAGGATCATTAATGATTTTTGAAAGCGAAGGCCTTGTTGTTGCCCCGAAGC

[0036] CCCGGCCGTCCAGGCCCCTGGTCTTCATTCCAATCCACCCCTTGTCCCCCTTATGGA

[0037] AGTTATAAGCGGCGGAGATGGTATTGTAATAAGTCGAGGGCGGAGGCCTTCGGGA

[0038] CTGCGGTTGACCCCTCCACCTTTATTACCACCCTTTGTTGCCGTGTAGAATCCATTC

[0039] TCCTTCTGGGCGGAAATGAAATCCACCTTCCACCACGGATTTTCTGGCTTTTCCCA

[0040] CGGATGAAGACCCAACGGAATTCGGTTAAGTAATGGGAATTCCAGAATCAAGGGA

[0041] TCCATGGATTCTTTGACCCCCCCTTCCCCCCCTGGTTATTCGGGGGGCCATCCTTGT

[0042] TGAAGTGCCTTGTTATTCCCACCCCCCTTGTTTTCTTAATTCGGCCGTTGGCCTGGG

[0043] AAGTTCCGGCCCCCTTCCCGCGGTCGGCTCTTCTTAAATGCATTAGCTGGGCTTTG

[0044] GCTCGCGTTGAACGGTGTAATAGTAATCTTACATTCGCCTGAGCGCTTGCCTTGACA

[0045] AGTCTGCTTCTAATCGTCTTCGGACAAGGTCTTTGTTACCTT

[0046] Comparison with the NCBI database revealed that strain IFPW11189 is most closely related to Phellinus orientoasiaticus, with a similarity of over 99%. Based on the fruiting body's morphological, physiological, and biochemical characteristics, as well as ITSDNA sequence analysis, it was identified as Phellinus orientoasiaticus.

[0047] The strain IFPW11189 is deposited in the General Microbiology Center of the China Culture Collection Administration, with a deposit date of August 15, 2024 and a deposit number of CGMCC No.41436.

[0048] Example 2 Acquisition of the training program

[0049] 1. Culture medium preparation:

[0050] PDA culture medium: 200 g of fresh peeled potatoes, cut into 2 cm small pieces, add 1000 mL of distilled water and cook until soft, filter through 4 layers of gauze, add 20 g of glucose and 12 g of agar powder, and dilute to 1000 mL. The pH value is natural.

[0051] Liquid culture medium: yeast extract (10 g / L), KH2PO4 (0.08%), CaCO3 (0.05%), MgSO4 (0.05%), VB1 (0.1%).

[0052] The above culture media were sterilized in an autoclave at 121°C for 20-30 minutes.

[0053] 2. Liquid fermentation:

[0054] Activation: Select the strain of the East Asian wood-poring fungus described in the previous example and inoculate it onto a PDA medium plate for activation. Incubate in a dark incubator at 28°C until colonies have grown and set aside. Use a 0.5 cm diameter borer to remove mycelial blocks from the East Asian wood-poring fungus strain and inoculate them into liquid culture medium for liquid fermentation. Shake flasks are incubated at 120 rpm and 28°C for 10 days. The fermentation broth is filtered and rinsed with deionized water to obtain mycelium. The fermentation broth is set aside.

[0055] 3. Determination of active substance content:

[0056] 3.1 Enrichment of total flavonoids from the fermentation broth alcohol extract: Weigh an appropriate amount of D101 macroporous resin and pretreat it (soak in 95% ethanol for 54 hours, rinse with deionized water until odorless, soak in 5% NaOH solution for 4 hours, wash with deionized water until the pH is neutral, soak in HCl solution for 4 hours, and wash with deionized water until neutral). The treated macroporous resin is loaded onto a column for stabilization. The fermentation broth alcohol extract sample is concentrated using a rotary evaporator to obtain a concentrate, which is wet-filtered and gradient eluted with 70%-80% ethanol. The total flavonoids portion is concentrated using a rotary evaporator and dried to obtain a total flavonoid sample.

[0057] 3.2 Determination of total flavonoids content: The total flavonoids content was determined by aluminum nitrate spectrophotometry: 10 mg of rutin standard was weighed, dissolved in 72% ethanol, and transferred to a 50 mL volumetric flask. The volume was made up to 50 mL with 72% ethanol solution, and shaken to obtain a rutin standard solution with a concentration of 0.2 mg / mL.

[0058] Take 1 mL of 0, 30, 40, 50, 60, 70, 80 and 90 μg / mL standard solution in 10 mL test tube, add 1 mL of 5% NaNO2 solution, shake and stand for 6 min, then add 1 mL of 10% Al (NO3) 3 solution, shake and stand for 6 min, finally add 4 mL of 4% NaOH solution, add water to 10 mL, and stand for 15-20 min. Measure the absorbance at 510 nm. Draw the standard curve with the mass concentration of the standard solution as the abscissa and the absorbance as the ordinate (Cui Cui, 2014).

[0059] Take 5 mL of the alcohol extract and transfer it to a 25 mL volumetric flask. Prepare the solution according to the method for drawing the standard curve and calculate the total flavonoid content in the sample. The total flavonoid content in the fermentation broth is 692.44 mg / L.

[0060] Example 3: Obtaining a high-yield flavonoid culture optimization scheme

[0061] 1. Single factor experiment

[0062] 1.1 Determination of nitrogen source type and addition amount

[0063] Take yeast extract powder, peptone and (NH4)2SO4 as the nitrogen source respectively, fix glucose as the carbon source, add 0.08% of KH2PO4, 0.05% of CaCO3, 0.05% of MgSO4 and 0.1% of VB1, and measure the total flavonoid content after 10 days of fermentation to determine the optimal nitrogen source. Change the nitrogen source concentration (2 g / L, 6 g / L, 10 g / L, 14 g / L, 18 g / L) and conduct further cultivation to determine the optimal nitrogen source and optimal concentration. Among the three nitrogen sources, the total flavonoid content of the strain cultured in the medium with peptone as the nitrogen source is the highest Figure 1 a). With the increase of peptone addition amount, the total flavonoid content of the fermentation broth shows a trend of first increasing and then decreasing. When the nitrogen source is added too much, excessive nitrogen source will cause the premature aging and autolysis of the bacterial cells, thereby shortening the product secretion time and leading to a decrease in the total flavonoid content. Therefore, 6 g / L is selected as the optimal addition amount Figure 2 a)

[0064] 1.2 Determination of carbon source type and addition amount

[0065] Glucose, sucrose and starch were used as carbon sources, fixed peptone was used as nitrogen source, KH2PO4 was added in an amount of 0.08%, CaCO3 was 0.05%, MgSO4 was 0.05% and VB1 was 0.1%. After 10 days of shake flask culture and fermentation, the total flavonoid content was measured to determine the best carbon source. The carbon source concentration was changed (12g / L, 18g / L, 24g / L, 28g / L, 30g / L) and cultured again to determine the best carbon source and concentration. Among the three carbon sources, the strain cultured with glucose as the carbon source had the highest total flavonoid content ( Figure 1 b). With the increase of glucose addition, the total flavonoid content in the fermentation broth showed a trend of first increasing and then decreasing. When too much glucose was added, the bacteria could not be completely washed out due to the excessive nutrients in the culture medium, resulting in a decrease in the accumulation of bacterial metabolites and a decrease in the total flavonoid content. The total flavonoid content was the highest at 18g / L, so 18g / L was selected as the optimal addition amount ( Figure 2 b).

[0066] 1.3 Determination of KH2PO4 concentration

[0067] With the increase of KH2PO4 concentration, the total flavonoid content of the fermentation broth showed a trend of first increasing, then decreasing, and then increasing again. When the concentration of KH2PO4 was too high, the strain could not absorb inorganic salts and the osmotic pressure increased, resulting in the inhibition of strain growth and the decrease of total flavonoid content. The maximum value was reached at 0.08%, so the optimal concentration of KH2PO4 was selected as 0.08% ( Figure 2 c).

[0068] 1.4 Determination of the optimal mycelial inoculation amount

[0069] With peptone as nitrogen source, glucose as carbon source, KH2PO4 addition amount was 0.08%, CaCO3 was 0.05%, MgSO4 was 0.05%, VB1 was 0.1%, and the inoculation amount was set to 1%, 2%, 3%, 4%, and 5% respectively. After 10 days of shake flask liquid culture fermentation, the total flavonoid content was measured to determine the optimal inoculation amount. By exploring the effect of different inoculation amounts on the total flavonoid content of fermentation, it was found that when the inoculation amount was 2%, the total flavonoid content was relatively high. When the addition amount was too high, the strain growth space was insufficient, which led to poor growth of the strain and a decrease in the total flavonoid content. Therefore, the optimal inoculation amount was selected as 2% ( Figure 2 d).

[0070] 2 Response surface experimental design and results

[0071] Using the single-factor results above as the central value of the response surface, we further set the dose of each factor at low, medium, and high levels, creating a 4-factor, 3-level experimental design. Using Design-Expert 13 software, we designed multiple random combinations of culture conditions to identify the concentration of each factor that maximized the total flavonoid content of the fermentation broth. Each factor was set at high, medium, and low levels, with corresponding design codes of 1, 0, and -1, respectively. The design levels for each factor are shown in Table 1.

[0072] Table 1 Response surface factor design and levels

[0073]

[0074] Through the BBD experimental design, the culture results of each group are shown in Table 2. The above data were fitted with quadratic regression, and the quadratic regression equation was obtained as follows:

[0075] Y=888.17+73.31A-59.89B-29.89C+32.47D-30.85AB+110.91AC+1117.86AD+3.08BC+50.30BD-10.81CD-223.54A2+189.69B2-1150.26C 2 -11.27D 2

[0076] The dependent variable Y represents the total flavonoid content of the fermentation liquid. From the variance table 3, we can see that at the significant level, A, B, AD, A 2 、B 2 、C 2 、D 2 The performance is significant, and the model p < 0.01, the lack of fit item is 0.1328> 0.05, indicating that the model is reasonable. As shown in Table 3, R 2 Close to 1, indicating good correlation, and precision (Adeq Precision)>4, the data is reasonable, CV% <10, indicating that the experimental accuracy and reliability are high, and Adjusted R 2 and Predicted R 2 The difference is <0.2, indicating that the regression model can fully explain the process. Therefore, the equation model has a good fit and can accurately predict the maximum total flavonoid content.

[0077] Table 2 Box-Behnken experimental design and results

[0078]

[0079] Table 3 Analysis of variance of total flavonoids content

[0080]

[0081] Note: p-value < .05 is significant "*", p-value < .01 is extremely significant "**"

[0082] Table 4 Fitting statistics of total flavonoid content

[0083]

[0084] According to the above results, the software was used to draw a three-dimensional analysis diagram of the interaction between glucose (B), peptone (A), KH2PO4 (C) and inoculum size (D). It can be seen from the figure that peptone has a very significant effect on the fermentation broth. With the increase of the amount of peptone added, the total flavonoid content shows a trend of first increasing and then decreasing, and the slope is obvious, indicating that the total flavonoid content is more significantly affected by the amount of peptone added. When the amount added is too large, the concentration may be high, and the high osmotic pressure may affect the secretion of flavonoids by the strain. The contour lines are elliptical, indicating that there is an interaction between peptone and inoculum size ( Figure 3 ), and the interaction effect was significant.

[0085] Software analysis and optimization determined the optimal conditions for each factor. The optimal ratio was 17.125 g / L glucose, 6.91 g / L peptone, 0.07% KH2PO4, and an inoculum size of 2.241%. The predicted total flavonoid content was 906.637 mg / L. Based on actual results, the optimal ratio was determined to be 17.12 g / L glucose, 6.91 g / L peptone, 0.07% KH2PO4, and an inoculum size of 2.30%. Under these conditions, the flavonoid contents were 908.57 mg / L, 904.29 mg / L, and 904.14 mg / L, respectively. The average value was 905.66 mg / L, which was close to the predicted value, indicating that the model's predictions were accurate. The optimized total flavonoid content increased by 30% compared to the 692.44 mg / L in the seed culture medium.

[0086] Example 4 Comparative Study on the Antioxidant Activity of Flavonoids

[0087] The antioxidant activity of flavonoids from the above-mentioned East Asian wood-growing fungus strain was studied, and compared with other fungi currently available (Phosphorus linteus, Phellinus leucophylla, Phellinus linteus, and Phellinus baumii). Specifically:

[0088] Comparison of ABTS free radical scavenging ability

[0089] The fermentation broth of Familiarum spp. was obtained according to the optimal conditions described in the above examples. Meanwhile, the fermentation broth of other strains was obtained according to the disclosed method. Then, the ABTS free radical scavenging ability was determined according to the conventional method (see Figure 4), the fermentation broth of the East Asian woody pore fungus obtained by the present invention has the best ABTS free radical scavenging ability, and is significantly higher than the positive control Vc at low concentrations (0.1 mg / L-0.2 mg / L), and the scavenging ability increases with increasing concentration. The scavenging rates of the ethanol extracts of the fermentation broth of East Asian woody pore fungus, oak linterella, and baum linterella are 99.49%, 93.37%, and 92.24%, respectively.

[0090] It can be seen that the active substance extraction and content test of the East Asian wood-filled fungus, which is widely distributed in western Liaoning and has rich fungal resources, found that compared with the famous Phellinus strains, this fungus has better active substance content.

[0091] The present invention uses the East Asian wood-filled pore fungus as a demonstration strain and the flavonoid content as an optimization value, optimizes liquid culture medium conditions by combining single factors with a response surface method, and obtains an average flavonoid content of 905.66 mg / L under the conditions of a ratio of 17.12 g / L glucose, 6.91 g / L peptone, KH2PO4 (0.07%), CaCO3 (0.05%), MgSO4 (0.05%), VB1 (0.1%), and an inoculum amount of 2.30%. The optimized total flavonoid content is 30% higher than that of 692.44 mg / L in the seed culture medium, thereby enabling better development and utilization of bacterial strain resources and improving their application value.

Claims

1. An application of Fatty Acids of East Asian origin in producing flavonoids under liquid fermentation conditions, characterized in that: The mycelial suspension of the East Asian wood-poring fungus was inoculated into the liquid culture medium and cultured with shaking at 120 r / min and 28°C for 10 days. The mycelial suspension was obtained by breaking the mycelium with a homogenizer and set aside for use. The culture medium is prepared by adding 17.12 g / L glucose, 6.91 g / L peptone, 0.07% KH2PO4, 0.05% CaCO3, 0.05% MgSO4, and 0.1% vitamin B1 per liter of water, with an inoculum size of 2.30%; East Asian wood pore fungus ( Phellinus orientoasiaticus ), strain IFPW11189, deposited in the General Microbiology Center of China Culture Collection Administration, deposit date: August 15, 2024, deposit number: CGMCC No.41436.

2. A method for preparing flavonoids using Fatty Acids of East Asian origin, characterized in that: The East Asian woody pore fungus is fermented in liquid state to obtain high-yield flavonoids; The mycelial suspension of the East Asian wood-poring fungus was inoculated into the liquid culture medium and cultured with shaking at 120 r / min and 28°C for 10 days. The mycelial suspension was obtained by breaking the mycelium with a homogenizer and set aside for use. The culture medium is prepared by adding 17.12 g / L glucose, 6.91 g / L peptone, 0.07% KH2PO4, 0.05% CaCO3, 0.05% MgSO4, and 0.1% vitamin B1 per liter of water, with an inoculum size of 2.30%; East Asian wood pore fungus ( Phellinus orientoasiaticus ), strain IFPW11189, deposited in the General Microbiology Center of China Culture Collection Administration, deposit date: August 15, 2024, deposit number: CGMCC No.41436.

Images