Preparation method and application of pseudovirus particle containing genome I / genome II type norovirus nucleic acid fragment
By constructing and expressing recombinant plasmids of MS2 phage coat protein and norovirus specific sequence, pseudovirus particles containing GⅠ/GⅡ norovirus nucleic acid fragments were prepared and purified, and the sensitivity and specificity of norovirus detection were insufficient. The problem has achieved efficient norovirus detection and drug inhibition, ensuring food safety and people's health.
Patent Information
- Application Number
- CN202410981501.6
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-07-22
- Publication Date
- 2024-12-10
AI Technical Summary
It is difficult for the prior art to effectively prepare and apply pseudovirus particles containing GⅠ/GⅡ type norovirus nucleic acid fragments, resulting in insufficient sensitivity and specificity of norovirus detection, and it is difficult to widely apply to food safety and public health protection.
By constructing the pET28a/CP-NGI/NGII recombinant plasmid, expressing MS2 phage coat protein and norovirus specific sequence, pseudovirus particles containing GⅠ/GⅡ norovirus nucleic acid fragments were prepared and purified for norovirus detection. and drug inhibition.
It has realized the quality control products and standards for norovirus detection, which has high sensitivity, specificity and stability, avoids missed detection, and is suitable for norovirus drug inhibition and kit preparation, ensuring food safety and people's health.
Smart Images
Figure CN119101133A_ABST
Abstract
Description
Technical Field
[0001] The present invention relates to virus medicine, in particular to a method for preparing pseudovirus particles containing genome I / genome II (GⅠ / GⅡ) type Norovirus nucleic acid fragments and its application. Background Art
[0002] Norovirus (NoV) belongs to the Caliciviridae family. It is a non-enveloped single-stranded positive-strand RNA virus with a genome length of about 7.5kb, spherical, icosahedral symmetry, and a diameter of about 38nm. NoV is now the main pathogen causing non-bacterial acute gastroenteritis / diarrhea in humans. According to statistics from the World Health Organization (WHO), about 200,000 young children die from Norovirus infection every year. At present, NoV continues to spread around the world and has become a public health problem faced by the world. Among the various genotypes of NoV, the prevalence of genome I and genome II is the most susceptible to infecting humans, accounting for about 10% and 90% respectively. Since it is difficult to isolate and culture Norovirus in vitro, it is impossible to identify the serotype and it is difficult to compare the methods. Therefore, strengthening the rapid detection of NoV is of great significance to ensure food safety and public health.
[0003] NoV infection is seasonal and often occurs in winter, especially in countries with high latitudes, so it is called "gastrointestinal flu" or "winter vomiting disease". NoV is an enterovirus. The main symptoms of human infection are abdominal pain, diarrhea, and vomiting, and they usually last for a relatively short time. It is a statutory Class C infectious disease in my country. NoV is transmitted directly from person to person through the fecal-oral route or aerosol vomitus, and can also be transmitted indirectly through contaminated food, water or environmental surfaces. But what is more noteworthy is that NoV has a serious risk of secondary transmission, and the virus may also be transmitted between species.
[0004] According to the characteristics of gene structure, NoV is divided into 10 gene groups (GI-GX), and different gene groups are further divided into 48 genotypes. The same genotype can be subdivided into different variants. Among them, GI type virus mainly breaks out in food and water, and GII type virus mainly causes human infection. Electron microscopy, radioimmunoassay (RIA) and enzyme immunoassay (EIA) are commonly used for Norovirus detection. Due to the low sensitivity and specificity of these tests, and the limited ability to type NoV, it is difficult to be widely used. Therefore, the following are currently used: (1) Enzyme-linked antibody (ELISA) kit detection. There are several commercial ELISA-based detection kits for NoV, such as the IDEIATM Norovirus kit developed by Oxoid Ltd in the UK and the Ridascreen® Norovirus kit developed by R-biopham in Germany. However, the sensitivity and specificity of these kits vary greatly. On the one hand, this is because the antigenic epitopes of NoV vary to a certain extent in different types. On the other hand, as NoV continues to mutate, a certain amount of antigenic drift will occur, which will lead to missed detection. (2) Molecular biological detection (RT-PCR) is the most widely used in the pre-detection of viruses, mainly including conventional fluorescent quantitative PCR (Real-time PCR, RT-PCR), nested PCR, multiplex RT-PCR, RT-qPCR and emerging digital PCR. Due to some defects in RT-PCR and nested PCR, they have gradually been replaced by other methods. At present, RT-qPCR is considered to be the "gold standard" for NoVs detection. However, due to the mutation and recombination of the virus, primers and probes for specific strains cannot detect all strains, often resulting in missed detections, so the design of primers and probes that can detect all strains is very critical. Due to the potential infectiousness of Norovirus and the instability of its RNA, how to develop positive quality control products that are resistant to RNase attack and safe and pollution-free is of great significance for the development of Norovirus RT-PCR kits.
[0005] The MS2 phage is a positive-sense single-stranded RNA phage with a genome length of 3659 bp, encoding four proteins: major coat protein (CP), mature protein (a protein), replicase protein (RNA polymerase required for genome proliferation) and lytic protein. It consists of 180 copies of 14KDa capsid protein molecules and 1 copy of mature enzyme protein. The mature enzyme not only protects the RNA genome from nuclease degradation, but also serves as a receptor binding protein for phage infection of Escherichia coli. As a non-viral vector delivery system, MS2 phage-like particles can target specific cells by binding to aptamers or covalently, and have been shown to have many characteristics as a delivery platform. On the one hand, these particles can be easily prepared by recombinant protein technology; on the other hand, the MS2 capsid protein interacts with the PAC site of RNA or DNA and can package the target RNA or DNA at the 5′ end of the PAC site, thereby protecting the target RNA or deoxyribonucleic acid from degradation by nucleases. MS2 VLP can provide an effective and convenient way to package various reagents and deliver them to target cells, and has been widely used in diagnostic reagent external standards. However, there has been no public report on how to prepare pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments and use them in the preparation of drugs to inhibit Norovirus and in the preparation of kits for detecting Norovirus. Summary of the invention
[0006] In view of the above situation, in order to overcome the defects of the prior art, the purpose of the present invention is to provide a method for preparing pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments and their application, which can effectively solve the application problems in the preparation of drugs to inhibit Norovirus and in the preparation of kits for detecting Norovirus.
[0007] The technical solution provided by the present invention is a method for preparing pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments, comprising the following steps: (1) Construction of pET28a / CP recombinant plasmid: Composed of carrying the MS2 bacteriophage coat protein CP gene and PAC site gene recombination (known products, such as the products of Yunzhou Biotechnology (Guangzhou) Co., Ltd.); (2) Construction of pET28a / CP-NGI / NGII recombinant plasmid: Using pUC57 as template and NGI-F and NGII-R as primers, the NGI / NGII specific conservative sequence was amplified. Bm Ⅰ and Hind Ⅲ. Double-digest the plasmid pET28a(+) / CP and the target gene sequence amplified by PCR, respectively, recover, connect, and transform into Escherichia coli DH5α competent cells; extract the plasmid, identify it by PCR and sequencing, and obtain pET28a(+) / CP-NGI / NGII; NGI-F gene sequence (SEQ ID No. 1): CGGGATCCCGCTGGATGCGNTTCCAT NGII-R gene sequence (SEQ ID No.4): CCCAAGCTTTCGACGCCATCTTCATTCACA The above NGI-F primer GGATCC is Bam H Ⅰ restriction site, NGII-R primer AAGCTT is Hind Ⅲ Restriction sites; NGI / NGII gene sequence (SEQ ID No.5): CGCTGGATGCGCTTCCATGACCTCGGATTGTGGACAGGAGATCGCGATCTTCTGCCCGAATTCGTAAATGATGATGGCGTCTAAGGAAGCTCATGTTCAGATGGATGAGATTCTCAGATCTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAGCTTTGTGAATGAAGATGGCGTCGA (3) Inducible expression The recombinant plasmid expression vector is transformed into Escherichia coli BL21 (DE3) to obtain recombinant bacteria, and the recombinant bacteria are induced to express the virus-like particles; the bacteria are collected, and a PBS buffer (lysis solution) with a pH of 7-9 is added, and the bacteria are ultrasonically broken to obtain the virus-like particles; (4) Purification Adding ammonium sulfate to the recombinant bacteria to precipitate the virus-like particles, so that the mass concentration of ammonium sulfate is 10-50%; then using gel filtration chromatography Sephacryl-1000 to purify the sample containing the virus-like particles obtained by the rough precipitation, first equilibrate the gel column with 5 column volumes of Sephacryl buffer, load the solution containing the precipitated protein at a flow rate of 4 mL / min, and collect the effluent to obtain the purified virus-like particles; (5) Digestion to remove residual DNA and RNA The purified virus-like particle solution was added with Mg (2 mmol / L) + and 500U of DNaseI nuclease, digested at 37°C for 8h to remove residual DNA and RNA in the solution to obtain the target particles.
[0008] The pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments prepared by the method of the present invention are prepared into quality control products or standard products for Norovirus detection, and are used in the preparation of drugs for inhibiting Norovirus and in the preparation of kits for detecting Norovirus.
[0009] The method of the present invention is scientific and reasonable, easy to operate, and can effectively solve the preparation of pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments. The pseudovirus particles contain GⅠ / GⅡ type Norovirus nucleic acid fragments, and the nucleic acid fragments can be used as targets for detecting Norovirus. The method includes constructing a plasmid vector containing a cDNA corresponding to a MS2 phage maturase encoding gene, a capsid protein encoding gene, a packaging site sequence, and a nucleic acid fragment of Norovirus, and then transcribing and expressing the plasmid vector in Escherichia coli cells, and then separating and purifying to obtain pseudovirus particles. The pseudovirus-like particles are safe and pollution-free, stable in performance, no missed detection, accurate in detection, resistant to RNase attack, and can be fully monitored and operated. It is a positive quality control product for nucleic acid detection of Norovirus, which opens up a new way to detect Norovirus, realizes the application in the preparation of drugs to inhibit Norovirus and the application in the preparation of Norovirus detection kits, is beneficial to people's health, and has significant economic and social benefits. BRIEF DESCRIPTION OF THE DRAWINGS
[0010] Figure 1 This is an electron microscope observation image of the pseudovirus-like particle of the present invention; Figure 2 This is a particle size diagram of the purified pseudovirus-like particles detected by dynamic light scattering; Figure 3 This is a fluorescence quantitative PCR image of residual nucleic acid detection of virus-like particles of the present invention; Figure 4 This is a diagram for determining the copy number of armor RNA of the present invention; Figure 5 The fluorescence quantitative PCR detection sensitivity diagram of the present invention (from left to right, 10 8 ~10 1 Copy number / uL); Figure 6 This is a graph showing the stability of the virus-like particles of the present invention. DETAILED DESCRIPTION
[0011] The specific implementation modes of the present invention are described in detail below in combination with embodiments and specific situations.
[0012] The present invention can be specifically implemented by the following examples. Example
[0013] The present invention discloses a method for preparing pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments, comprising the following steps: (1) Construction of pET28a / CP recombinant plasmid: Composed of carrying the MS2 bacteriophage coat protein CP gene and PAC site gene recombination (known products, such as the products of Yunzhou Biotechnology (Guangzhou) Co., Ltd.); (2) Construction of pET28a / CP-NGI / NGII recombinant plasmid: The specific conservative sequence of GⅠ / GⅡ type Norovirus was artificially synthesized by Sangon Biotechnology (Shanghai) Co., Ltd., and pUC57 was used as a template, NGI-F and NGII-R were used as primers to amplify the target gene. The amplification system was: 2×PCRMix premix 25μL, 1μL of upstream and downstream primers 10uM each, 1μL of template, ddH 2 O was added to 50 μL; the amplification program was 94°C pre-denaturation for 5 min, 58°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, and PCR products were recovered by agarose electrophoresis; The plasmid pET28a / CP and PCR product were prepared according to the ratio specified in the restriction endonuclease instructions. Bm Ⅰ and Hind Ⅲ double enzyme digestion, the enzyme digestion system is: Hind III and Bm Ⅰ 2μL each, 10 × KBuffer 5μL, PCR recovery product / pET28a / CP 15μL / 10μL, ddH 2Add 0 to 50uL, mix thoroughly, and digest in a 37℃ water bath for 2h. Perform agarose gel electrophoresis to identify the digestion products, and use a gel recovery kit to recover the digestion products. Select T 4 DNA ligase was used for ligation. The enzyme ligation reaction system was as follows: 2 μL containing 42 ng of target gene fragment, 6 μL containing 12.6 ng of pET28a / CP vector, 2 μL of 10 × Ligation Buffer, T 4 DNA ligase 2 μL, ddHO 2 O was added to 20 μL, and the cells were connected at 16°C overnight. The ligation product was transformed into DH5α competent cells, spread on plates, and the correct extracted plasmid was identified by bacterial liquid PCR to obtain the pET28a(+) / CP-NGI / NGII recombinant plasmid; (3) Inducible expression The pET28a(+) / CP-NGI / NGII recombinant plasmid was transformed into the Escherichia coli expression bacteria BL21 (DE3), and then the BL21 / pET28a(+) / CP-NGI / NGII engineering bacteria were streaked on LB solid plates containing 50μg / mL Kana at 37℃ for 16h, and single colonies of appropriate size were picked and cultured in LB liquid medium containing 50μg / mL Kana at 37℃ for 12h. The bacterial culture was inoculated into 100mL LB liquid medium containing 50μg / mL Kana at a ratio of 1:100, and the culture was placed on a shaker at 37℃ and 200 rpm for 4h to amplify the culture until the OD 600 The value was 0.5-0.7, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.6mmol / L, and the mixture was induced at 180rpm for 18h at 18℃. The induced bacterial solution was centrifuged, and the precipitate was collected. The precipitate was resuspended in a sterile beaker with PBS buffer at pH=8, and placed in a foam box filled with ice for ultrasonic disruption. The power was set to 300W, and the ultrasonic was continued for 5s each time, with an interval of 10s. The ultrasonic disruption was carried out for 10min, and the mixture was centrifuged at 12000 r / min for 10min, and the supernatant was collected. The LB solid medium is: 10 g of tryptone, 5 g of yeast extract, 10 g of sodium chloride (NaCl) and 15 g of agar powder are weighed respectively, 800 mL of distilled water is added, and the mixture is stirred until the solid is completely dissolved, and the volume is finally adjusted to 1000 mL, and the mixture is sterilized by high pressure at 121°C for 20 min, and stored at room temperature; The LB liquid medium is prepared by weighing 10 g of tryptone, 5 g of yeast extract and 10 g of sodium chloride (NaCl), adding 800 mL of distilled water, stirring until the solid is completely dissolved, and finally adjusting the volume to 1000 mL, sterilizing by high pressure at 121°C for 20 min, and storing at room temperature.
[0014] (4) Purification Crude purification by ammonium sulfate precipitation: Saturated ammonium sulfate was slowly added to the collected supernatant while stirring to a final concentration of 30%, stirred at 4°C for 30 min, and centrifuged at 12000 r / min to collect the supernatant; a crude solution containing virus-like particles was obtained; Gel filtration chromatography Sephacryl-1000 purification: The gel column was balanced with 5 column volumes of PBS buffer with pH=8, and the crude and pure solution containing virus-like particles was directly loaded at a flow rate of 4 mL / min; the inert shell of gel filtration chromatography Sephacryl-1000 excludes large molecules, preventing them from entering the core through the pores on the shell, while smaller molecules will continuously penetrate into the interior of the beads. Such small molecules not only have a long movement distance, but also encounter great resistance from the inside of the gel beads, so large virus-like particles are directly eluted first through the gaps between the gel beads to obtain a pure virus-like particle solution; (5) Digestion Take 0.5 mL of purified virus-like particles and add Mg with a final concentration of 2 mmol / L. + 0.252g / L, and 500U of DNase I was added at the same time, and digested at 37℃ for 8h to remove the residual nucleic acid DNA and RNA of virus-like particles, and obtain the target pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments.
[0015] The pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments prepared by the method of the present invention are physically characterized and characterized, and are stable, non-toxic, resistant to RNase attack, and can be fully monitored for nucleic acid detection of Norovirus positivity, and the effect is very good. The relevant information is as follows: 1. Physical characterization and characterization experiments of MS2 virus-like particles containing GⅠ / GⅡ norovirus nucleic acid 1. Physical characterization of virus-like particles: The virus-like particle solution purified in Example 2 was filtered through a 0.22 μM filter membrane, and a portion of the sample was tested for particle uniformity using a Zetasizer Nano ZSE nanoparticle size analyzer (Malvern); another portion of the purified particles was counterstained with 2% phosphotungstic acid and observed for particle size using a HT7800 (Japan) transmission electron microscope at an accelerating voltage of 80 kV.
[0016] Virus-like particles were observed by transmission electron microscopy (e.g. Figure 1 The particles are regular hexagonal materials with bright outside and dark inside, and the diameter is 23-28nm. The particle solution was analyzed by dynamic light scattering (DLS) (as shown in Figure 2 As shown): The solution is uniform and the inner diameter of the particles is about 23nm, which is consistent with the transmission electron microscopy data.
[0017] 2. Characterization of virus-like particles Detection of residual nucleic acid after virus-like particle digestion: 100 μL of the virus-like particles after digestion was removed and RNA was extracted using the trizol method. The steps were as follows: (1) Take 100 μL and add 1 mL of trizol, invert and mix, and let it stand at room temperature for 15 min to ensure that the nucleosomes are fully decomposed; (2) Centrifuge at 12000 rpm and 4°C for 10 min, and aspirate the supernatant into a clean centrifuge tube; (3) Add 0.2 mL of chloroform, shake vigorously for 15 sec, let it stand at room temperature for 3 min, and centrifuge at 12000 rpm and 4°C for 10 min; (4) Aspirate the upper aqueous phase into a clean centrifuge tube, add an equal volume of isopropanol, mix, and let it stand at room temperature for 20 min; (5) Centrifuge at 12000 rpm and 4°C for 10 min, and discard the supernatant; (6) Add 1 mL of pre-cooled 75% ethanol and flick off the precipitate. Centrifuge at 12000rpm at 4℃ for 10min, discard the supernatant, and dry at room temperature for 5-10min; (7) Repeat step (6); (8) Add 30-50μL RNase-free ddH 2 O is the extracted RNA. According to the instructions of the AMV first-strand cDNA synthesis kit, reverse transcription was performed to obtain cDNA. The virus-like particles not digested by DnaseI nuclease, the digested virus-like particles and the cDNA after reverse transcription were used as templates for detection by probe PCR. The reaction system is: 2×Taq Man Fast qPCR premix 10uL, NGI-F / NGII-F (10 uM) 0.4uL, NGI-R / NGII-R (10 uM) 0.4uL, NGI-Probe / NGII-Probe (10uM) 0.4uL, template 1uL, ddH 2 O was added to 20uL. The reaction procedure was: 95℃ 1min; 95℃ 20s, 60℃ 30s, collecting fluorescence signals; 40 cycles (Note: fluorescence collection: FAM and VIC); fluorescence detection results ( Figure 3 ) showed that the Ct values of the purified virus-like particles after RT-PCR were 34.31 (FAM channel) and 31.90 (VIC channel), respectively, while no amplification curve was found after detection without reverse transcription, indicating that the prepared armored RNA particles can resist DNase I digestion.
[0018] The primers used in the RNase-resistance detection are: SEQ ID No.6 and SEQ ID No.7.
[0019] NGI-Probe (SEQ ID No.6): TGGACAGGAGAYCGCRATCT NGII-Probe (SEQ ID No.7): AGCACGTGGGAGGGCGATGG 3. Determination of armor RNA copy number The concentration of the recombinant plasmid pET28a / CP-NGI / NGII was measured using the NanoDrop 2000 micro-nucleic acid protein concentration meter according to the formula: Sample Copies / μL = Avogadro constant (6.02×1023) copies × concentration (ng / μL×10 -9 ) / average molecular weight of recombinant plasmid (DNA length × 660) to calculate the initial copy number of recombinant plasmid pET28a / CP-NGI / NGII. The concentration of recombinant plasmid pET28a / CP-NGI / NGII was calculated by the formula as 1.47 × 10 9 After 10-fold serial dilution of the recombinant plasmid, 10 -3 , 10 -4 , 10 -5 , 10 -6 and 10 -7 The standard curve (FAM channel) was established by using the plasmid serial dilution as the horizontal axis and the threshold cycle (Ct) of PCR amplification as the vertical axis. The regression equation was Y = -3.932X + 37.938, with a slope of -3.932 and a correlation coefficient of R. 2 =0.995, indicating that the PCR amplification efficiency is high, the standard curve has good linearity, and there is a good correlation between the logarithm of the sample concentration and the threshold cycle number. The virus-like particles were diluted 1000 times and the Ct value of the fluorescence quantitative PCR test was 21.77. The copy number of the virus-like particles was calculated by the standard curve to be 1.90×10 7 copies / μL (see Figure 4 ).
[0020] 4. Fluorescence quantitative PCR detection sensitivity The plasmid standard pET28a(+) / CP-NGI / NGII was diluted to 10 1 copies / μL, using the reaction system and reaction procedure in
[0050] for fluorescence quantitative PCR amplification and fluorescence detection (see Figure 5) The results showed that the minimum detection limit of NGⅠ and NGⅡ detection was 10 2 CFU / mL, indicating a high sensitivity.
[0021] 2. Virus-like particle stability experiment Take 3mL of virus-like particles after nuclease digestion, filter with a 0.22μm syringe filter aseptically, and divide into 5 portions, each 600μL. One portion was placed at 4℃, and the remaining 4 portions were placed at 37℃ for 5d, 10d, 15d and 20d respectively. After 20d, the samples were lysed and RNA was extracted, reverse transcribed and tested by fluorescent PCR. The changes in their Ct values were compared. The virus-like particles after filtration and sterilization were placed at 37℃ for 5d, 10d, 15d and 20d, RNA was extracted, and reverse transcribed for testing. The Ct values of the two channels were not much different at 5d, 10d and 4℃, but the Ct values increased significantly after being placed at 37℃ for 15d and 20d. Figure 6 The trend of the Ct value change shows that the prepared virus-like particles can be stored at 37°C for at least 10 days and have good thermal stability.
[0022] It can be seen from the above that the preparation method of the present invention is scientific and reasonable, easy to operate, and can be effectively used to prepare pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments. Experiments have verified that the virus-like particles have the following technical advantages: 1. Non-infectious, safe and reliable, no danger to personnel and the environment during preparation and use; 2. MS2 virus-like particles are resistant to RNase and have good stability as standard and quality control products for Norovirus RT-PCR detection, and are easy to store and transport; 3. It has a good simulation effect on RNA in pathogens; since the expression product is a phage-like particle with the characteristics of virus particles, it can simulate virus particles and monitor the entire experimental process to avoid missed detection or false negatives.
[0023] The virus-like particles containing GⅠ / GⅡ type Norovirus RNA of the present invention can be used as quality control products or standard products for virus detection, and have strong practical value for the development of gene diagnosis kits for Norovirus, and have significant economic and social benefits.
Claims
1. A method for preparing pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments, It is characterized in that The following steps are involved: (1) Construction of pET28a / CP recombinant plasmid: It is composed of the gene recombination of the MS2 bacteriophage coat protein CP gene and the PAC site gene; (2) Construction of pET28a / CP-NGI / NGII recombinant plasmid: Using pUC57 as template and NGI-F and NGII-R as primers, the NGI / NGII specific conservative sequence was amplified. Bm Ⅰ and Hind Ⅲ. Double-digest the plasmid pET28a(+) / CP and the target gene sequence amplified by PCR, respectively, recover, connect, and transform into Escherichia coli DH5α competent cells; extract the plasmid, identify it by PCR and sequencing, and obtain pET28a(+) / CP-NGI / NGII; NGI-F (SEQ ID No. 1): CGGGATCCCGCTGGATGCGNTTCCAT NGII-R (SEQ ID No. 4): CCCAAGCTTTCGACGCCATCTTCATTCACA The above NGI-F primer GGATCC is Bam H Ⅰ restriction site, NGII-R primer AAGCTT is Hind Ⅲ Restriction sites; NGI / NGII gene sequence (SEQ ID No.5): CGCTGGATGCGCTTCCATGACCTCGGATTGTGGACAGGAGATCGCGATCTTCTGCCCGAATTCGTAAATGATGATGGCGTCTAAGGAAGCTCATGTTCAGATGGATGAGATTCTCAGATCTGAGCACGTGGGAGGGCGATCGCAATCTGGCTCCCAGCTTTGTGAATGAAGATGGCGTCGA (3) Inducible expression The recombinant plasmid expression vector is transformed into Escherichia coli BL21 (DE3) to obtain recombinant bacteria, and the recombinant bacteria are induced to express the virus-like particles; the bacteria are collected, and a PBS buffer (lysis solution) with a pH of 7-9 is added, and the bacteria are ultrasonically broken to obtain the virus-like particles; (4) Purification Adding ammonium sulfate to the recombinant bacteria to precipitate the virus-like particles, so that the mass concentration of ammonium sulfate is 10-50%; then using gel filtration chromatography Sephacryl-1000 to purify the sample containing the virus-like particles obtained by the rough precipitation, first equilibrate the gel column with 5 column volumes of Sephacryl buffer, load the solution containing the precipitated protein at a flow rate of 4 mL / min, and collect the effluent to obtain the purified virus-like particles; (5) Digestion to remove residual DNA and RNA The purified virus-like particle solution was added with Mg (2 mmol / L) + and 500U of DNase I nuclease, digested at 37°C for 8h to remove residual DNA and RNA in the solution to obtain the target particles.
2. The method for preparing pseudoviral particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments according to claim 1, It is characterized in that The following steps are involved: (1) Construction of pET28a / CP recombinant plasmid: It is composed of the gene recombination of the MS2 bacteriophage coat protein CP gene and the PAC site gene; (2) Construction of pET28a / CP-NGI / NGII recombinant plasmid: Using pUC57 as template and NGI-F and NGII-R as primers, the target gene was amplified. The amplification system was: 2×PCRMix premix 25 μL, 1 μL of each 10uM upstream and downstream primers, 1 μL of template, ddH 2 O was added to 50 μL; the amplification program was 94°C pre-denaturation for 5 min, 58°C annealing for 30 s, 72°C extension for 30 s, 30 cycles, and PCR products were recovered by agarose electrophoresis; The plasmid pET28a / CP and PCR product were prepared according to the ratio specified in the restriction endonuclease instructions. Bm Ⅰ and Hind Ⅲ double enzyme digestion, the enzyme digestion system is: Hind III and Bm Ⅰ 2μL each, 10× K Buffer 5μL, PCR recovery product / pET28a / CP 15μL / 10μL, ddH 2 Add 0 to 50uL, mix thoroughly, and digest in a 37℃ water bath for 2h. Perform agarose gel electrophoresis to identify the digestion products, and use a gel recovery kit to recover the digestion products. Select T 4 DNA ligase was used for ligation. The enzyme ligation reaction system was as follows: 2 μL containing 42 ng of target gene fragment, 6 μL containing 12.6 ng of pET28a / CP vector, 2 μL of 10 × Ligation Buffer, T 4 DNA ligase 2 μL, ddHO 2 O was added to 20 μL, and the cells were connected at 16°C overnight. The ligation product was transformed into DH5α competent cells, spread on plates, and the correct extracted plasmid was identified by bacterial liquid PCR to obtain the pET28a(+) / CP-NGI / NGII recombinant plasmid; (3) Inducible expression The pET28a(+) / CP-NGI / NGII recombinant plasmid was transformed into the Escherichia coli expression bacteria BL21 (DE3), and then the BL21 / pET28a(+) / CP-NGI / NGII engineering bacteria were streaked on LB solid plates containing 50 μg / mL Kana at 37°C for 16 h, and single colonies of appropriate size were picked and cultured in LB liquid medium containing 50 μg / mL Kana at 37°C for 12 h. The bacterial culture was inoculated into 100 mL of LB liquid medium containing 50 μg / mL Kana at a ratio of 1:100, and placed on a shaker at 37°C, 200 rpm for 4 h to amplify and culture until the OD 600 The value was 0.5-0.7, isopropyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.6mmol / L, and the mixture was induced at 180rpm for 18h at 18℃. The induced bacterial solution was centrifuged, and the precipitate was collected. The precipitate was resuspended in a sterile beaker with PBS buffer at pH=8, and placed in a foam box filled with ice for ultrasonic disruption. The power was set to 300W, and the ultrasonic was performed for 5s each, with a 10s pause, and ultrasonic disruption for 10min. The mixture was centrifuged at 12000r / min for 10min, and the supernatant was collected. (4) Purification Crude purification by ammonium sulfate precipitation: Saturated ammonium sulfate was slowly added to the collected supernatant while stirring to a final concentration of 30%, stirred at 4°C for 30 min, and centrifuged at 12000 r / min to collect the supernatant to obtain a crude solution containing virus-like particles; Gel filtration chromatography Sephacryl-1000 purification: The gel column was balanced with 5 column volumes of PBS buffer with pH=8, and the crude and pure solution containing virus-like particles was directly loaded at a flow rate of 4 mL / min; the inert shell of gel filtration chromatography Sephacryl-1000 excludes large molecules, preventing them from entering the core through the pores on the shell, while smaller molecules will continuously penetrate into the interior of the beads. Such small molecules not only have a long movement distance, but also encounter great resistance from the inside of the gel beads, so large virus-like particles are directly eluted first through the gaps between the gel beads to obtain a pure virus-like particle solution; (5) Digestion Take 0.5 mL of purified virus-like particles and add Mg with a final concentration of 2 mmol / L. + 0.252g / L, and 500U of DNase I was added at the same time, and digested at 37℃ for 8h to remove the residual nucleic acid DNA and RNA of virus-like particles, and obtain the target pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments.
3. Use of pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments prepared by the method of claim 1 or 2 in the preparation of drugs for inhibiting Norovirus.
4. Use of pseudovirus particles containing GⅠ / GⅡ type Norovirus nucleic acid fragments prepared by the method of claim 1 or 2 in the preparation of a kit for detecting Norovirus.