Primer composition for detecting polynucleotide containing stem-loop structure and application of primer composition

Abstract

The invention relates to the field of biological detection, in particular to a primer composition for detecting polynucleotide containing a stem-loop structure and application of the primer composition. The invention provides a primer composition for detecting polynucleotide containing a stem-loop structure. The primer composition comprises a reverse transcription primer and an amplification primer, wherein the reverse transcription primer comprises a segment complementary to a sequence to be detected and a universal sequence segment unrelated to the sequence to be detected. The primer composition disclosed by the invention can be used for rapidly, accurately and sensitively detecting tRNA by applying a fluorescent quantitative PCR technology, has the characteristics of high detection sensitivity, good specificity, high flux, low cost and the like, can be used for completing a fluorescent quantitative PCR reaction procedure in one step, does not need secondary treatment such as product purification and sequencing and the like, is extremely simple and convenient to operate and needs a small amount of samples.

Description

Technical Field

[0001] The present invention relates to the field of biological detection, and in particular to a primer composition for detecting polynucleotides containing a stem-loop structure and its application. Background Art

[0002] tRNA is small and complex, but it is widely used in research and biological applications such as RNA translation, peptide synthesis and gene expression. tRNA can form aggregates in the nucleus and cytoplasm and participate in the processes of gene delivery, expression, translation and regulation.

[0003] tRNA can be divided into enzyme-regulated tRNA, such as RNaseP-tRNA and RNase MRP-tRNA. The former is driven by the nucleic acid replication mechanism and used for gene expression; the latter is driven by the polypeptide synthesis mechanism and used for translation. tRNA helps gene expression, thereby promoting cell differentiation, cell growth and physiological reactions, so tRNA plays an important role in various functions of organisms.

[0004] In recent years, the expression of a certain gene can also be enhanced by using the variation of tRNA in the genome. For example, the variation of RNaseP-tRNA can promote the expression of multiple transcription factors and activate the expression of a series of genes, thereby enhancing the expression of a certain gene.

[0005] As an important nucleic acid molecule, tRNA participates in various functions of cells and plays an important role in gene expression, polypeptide synthesis, cell differentiation and development. It also promotes the antiviral mechanism of cells and is equally important in biological research and applications. However, the secondary conformation of tRNA is rich in stem-loop structures (composed of many reverse complementary sequences), which is a huge challenge for its molecular biological detection. At the same time, how to establish a simple and fast detection of RNA rich in stem-loop structures like tRNA has become a difficult problem in the molecular diagnostic industry. In practice, most tRNAs cannot be screened for suitable primers and probes after professional software such as Primer Express, beacon designer, oligo, and NCBI's Primer blast.

[0006] In 2023, Sichuan Agricultural University applied for an invention patent for a quantitative qPCR detection method and kit for tRNA aminoacylation levels (application number 202310516407.9). The process is to synthesize a linker sequence complementary to the 3'-end CCA of tRNA in vitro, connect it to the target tRNA through T4 ligase, and then perform reverse transcription and qPCR detection.

[0007] The above detection scheme has the problem that the joint structure is complex and difficult to synthesize, and the detection process involved (T4 connection, reverse transcription and qPCR) is carried out step by step, so the operation is complicated and time-consuming. Considering the risk of RNA degradation, these complex operations are not conducive to RNA detection. Therefore, it is necessary to propose a new method for detecting advanced RNA rich in stem-loop structure such as tRNA. Summary of the invention

[0008] In view of the above-mentioned shortcomings of the prior art, an object of the present invention is to provide a primer composition for detecting a polynucleotide containing a stem-loop structure and its use, so as to solve the problems in the prior art.

[0009] To achieve the above objectives and other related objectives, the present invention provides a primer composition for detecting polynucleotides containing stem-loop structures, wherein the primer composition comprises a reverse transcription primer and an amplification primer, wherein the reverse transcription primer comprises a segment complementary to a sequence to be detected and an unrelated universal sequence segment.

[0010] Preferably, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.16, the primer composition comprises a reverse transcription primer having a nucleotide sequence as shown in SEQ ID No.4, amplification primers having nucleotide sequences as shown in SEQ ID No.1 and 2, and a probe having a nucleotide sequence as shown in SEQ ID No.3; or, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.17, the primer composition comprises a reverse transcription primer having a nucleotide sequence as shown in SEQ ID No.11, amplification primers having nucleotide sequences as shown in SEQ ID No.8 and 9, and a probe having a nucleotide sequence as shown in SEQ ID No.10; or, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.18, the primer composition comprises a reverse transcription primer having a nucleotide sequence as shown in SEQ ID No.15, amplification primers having nucleotide sequences as shown in SEQ ID No.11 and 12, and a probe having a nucleotide sequence as shown in SEQ ID No.14.

[0011] The present invention also provides use of the aforementioned primer combination in preparing a tRNA detection product.

[0012] The present invention also provides a method for detecting a polynucleotide containing a stem-loop structure, the method comprising the following steps: 1) Mixing the aforementioned primer composition, a sample to be tested, reverse transcriptase, DNA polymerase, betaine, trehalose and water; 2) Perform the following procedures on the mixture obtained in step 1): a) reverse transcription; b) pre-denaturation; c) denaturation and extension; 3) Determine whether the sample to be tested contains the target nucleic acid fragment according to the Cq value of the amplification curve of the mixture in step 2).

[0013] As described above, the primer composition for detecting a polynucleotide containing a stem-loop structure and its use of the present invention have the following beneficial effects: 1. The primer combination of the present invention can detect tRNA quickly, accurately and more sensitively by applying fluorescent quantitative PCR technology, with high detection sensitivity (the detection limit can reach 1 copy), good specificity, high throughput and low cost.

[0014] 2. The primer combination of the present invention can complete the fluorescent quantitative PCR reaction procedure in one step without the need for secondary processing such as product purification and sequencing. The operation is extremely simple and the required sample amount is small.

[0015] 3. The method of the present invention for detecting polynucleotides containing a stem-loop structure breaks through the limitation that the traditional detection system requires at least three to four steps to complete tRNA.

[0016] 4. The primer composition and detection method of the present invention are not only applicable to the detection of tRNA, but also applicable to the detection of other RNAs or RNA domains with higher-order structures similar to tRNA. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 Shown is a schematic diagram of the structure of one of the tRNAs tested in the present invention.

[0018] Figure 2 Shown are schematic diagrams of the structures of two of the tRNAs detected in the present invention.

[0019] Figure 3 Shown are schematic diagrams of the structures of three of the tRNAs detected in the present invention.

[0020] Figure 4 Shown are the results of the first channel (tRNA target) of the tRNA negative sample in detection Example 1 of the present invention.

[0021] Figure 5 Shown is the result of the first channel of detecting tRNA positive sample 1 in Example 1 of the present invention.

[0022] Figure 6 Shown is the result of the first channel of detecting tRNA positive sample 2 in Example 1 of the present invention.

[0023] Figure 7 Shown are the results of the first channel of the tRNA positive control (tRNA gradient 10^3, 10^2, 10^1, 10^0) in detection example 1 of the present invention.

[0024] Figure 8 Shown is the result of the first channel of the tRNA negative sample in Example 2 of the present invention.

[0025] Fig. 9 Shown is the result of the first channel of detecting tRNA positive sample 1 in Example 2 of the present invention.

[0026] Fig.10 Shown is the result of the first channel of detecting tRNA positive sample 2 in Example 2 of the present invention.

[0027] Fig.11 Shown are the results of the first channel of the tRNA positive control (tRNA gradient 10^3, 10^2, 10^1, 10^0) in detection Example 2 of the present invention.

[0028] Fig.12 Shown is the result of the first channel of detecting tRNA negative samples in Example 3 of the present invention.

[0029] Fig.13 Shown is the result of the first channel of detecting tRNA positive sample 1 in Example 3 of the present invention.

[0030] Fig.14 Shown is the result of the first channel of detecting tRNA positive sample 2 in Example 3 of the present invention.

[0031] Fig.15 Shown are the results of the first channel of the tRNA positive control (tRNA gradient 10^3, 10^2, 10^1, 10^0) in detection Example 3 of the present invention.

[0032] Fig.16 Shown is a schematic diagram of the principle of tRNA detection in the present invention. DETAILED DESCRIPTION

[0033] The invention provides a primer composition for detecting a polynucleotide containing a stem-loop structure. The primer composition comprises a reverse transcription primer and an amplification primer. The reverse transcription primer comprises a segment complementary to a sequence to be detected and an irrelevant universal sequence segment.

[0034] In some specific embodiments, the polynucleotide containing a stem-loop structure can be selected from one or more of mRNA (messenger ribonucleic acid), tRNA (transfer ribonucleic acid), rRNA (ribosomal ribonucleic acid), miRNA (microRNA), siRNA (small interfering RNA), piRNA (RNA that interacts with PIWI protein), scRNA (RNA obtained from single-cell transcriptome sequencing), snRNA (small nucleolar RNA), snoRNA (small RNA) or lncRNA (long non-coding RNA). Preferably, the polynucleotide containing a stem-loop structure is tRNA.

[0035] In some specific embodiments, the length of the complementary segment of the sequence to be tested is 20-30 bp. Specifically, the length of the complementary segment of the sequence to be tested is 20-22 bp, 22-24 bp, 24-26 bp, 26-28 bp or 28-30 bp.

[0036] In some specific embodiments, the length of the non-related universal sequence segment is 25-30 bp. Specifically, the length of the non-related universal sequence segment is 25-27 bp or 27-30 bp.

[0037] Furthermore, the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment with a nucleotide sequence as shown in any one of SEQ ID No. 16-18.

[0038] In some specific embodiments, the non-related common sequence segment comprises a nucleic acid fragment having a nucleotide sequence as shown in any one of SEQ ID Nos. 19-21.

[0039] In some specific embodiments, the segment complementary to the sequence to be detected comprises a nucleic acid fragment having a nucleotide sequence as shown in any one of SEQ ID Nos. 22-24.

[0040] In some specific embodiments, the reverse transcription primer comprises a nucleic acid fragment with a nucleotide sequence as shown in any one of SEQ ID No. 4, 11, and 15.

[0041] Further, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.16, the reverse transcription primer comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.4; or, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.17, the reverse transcription primer comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.11; or, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.18, the reverse transcription primer comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.15.

[0042] In some specific embodiments, the amplification primer comprises a nucleic acid fragment with a nucleotide sequence as shown in any one of SEQ ID No. 1, 2, 8, 9, 11 or 12.

[0043] Further, the amplification primers comprise nucleic acid fragments whose nucleotide sequences are shown in SEQ ID Nos.1 and 2; or, the amplification primers comprise nucleic acid fragments whose nucleotide sequences are shown in SEQ ID Nos.8 and 9; or, the amplification primers comprise nucleic acid fragments whose nucleotide sequences are shown in SEQ ID Nos.11 and 12.

[0044] In some embodiments, the primer composition further comprises a probe.

[0045] In some specific embodiments, the probe comprises a nucleic acid fragment with a nucleotide sequence as shown in SEQ ID No. 3, 10 or 14.

[0046] In some embodiments, the probe further comprises a labeling fluorescent group and a quenching fluorescent group.

[0047] Furthermore, the labeling fluorescent group is selected from one or more of FAM, HEX, VIC, ROX, TAMRA, and CY5; and / or the quenching fluorescent group is selected from one or more of TAMRA, BHQ1, BHQ2, MGB, DABCYL, and BHQ3.

[0048] In some specific embodiments, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment with a nucleotide sequence as shown in SEQ ID No.16, the primer composition comprises a reverse transcription primer with a nucleotide sequence as shown in SEQ ID No.4, amplification primers with nucleotide sequences as shown in SEQ ID No.1 and 2, and a probe with a nucleotide sequence as shown in SEQ ID No.3; or, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment with a nucleotide sequence as shown in SEQ ID No.17, the primer composition comprises a reverse transcription primer with a nucleotide sequence as shown in SEQ ID No.11, amplification primers with nucleotide sequences as shown in SEQ ID No.8 and 9, and a probe with a nucleotide sequence as shown in SEQ ID No.10; or, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment with a nucleotide sequence as shown in SEQ ID No.18, the primer composition comprises a reverse transcription primer with a nucleotide sequence as shown in SEQ ID No.15, amplification primers with nucleotide sequences as shown in SEQ ID No.11 and 12, and a probe with a nucleotide sequence as shown in SEQ ID No.14.

[0049] The present invention also provides use of the aforementioned primer combination in preparing a tRNA detection product.

[0050] In some specific embodiments, the tRNA detection product further comprises one or more of a reverse transcriptase, a DNA polymerase, a buffer reagent, a surfactant or a preservative.

[0051] In some specific embodiments, the buffer reagent can be a phosphate buffer reagent. The phosphate buffer reagent is used to provide stable enzymatic reaction conditions. The surfactant is used to solubilize and disperse the solute to promote the enzymatic reaction. The preservative is used to control the growth of microorganisms in the test product.

[0052] The phosphate in the phosphate buffer reagent is selected from potassium phosphate or sodium phosphate. The potassium phosphate and sodium phosphate are selected from any one or more of potassium phosphate, potassium dihydrogen phosphate, dipotassium hydrogen phosphate, sodium phosphate, sodium dihydrogen phosphate and disodium hydrogen phosphate.

[0053] The surfactant is a substance containing both a hydrophilic group and a hydrophobic group to significantly reduce the surface tension of the target solution. The surfactant is selected from any one or more of stearic acid, sodium dodecylbenzene sulfonate, quaternary ammonium compounds, lecithin, amino acid type, betaine type, alkyl glucoside, fatty acid glyceride, fatty acid sorbitan or polysorbate.

[0054] The preservative can be self-produced or commercially available. Preferably, the preservative is any one or more of the commercial ProClin series preservatives ProClin150, 200, 300 or 5000.

[0055] The present invention also provides a method for detecting a polynucleotide containing a stem-loop structure, the method comprising the following steps: 1) Mixing the aforementioned primer composition, a sample to be tested, reverse transcriptase, DNA polymerase, betaine, trehalose and water; 2) Perform the following procedures on the mixture obtained in step 1): a) reverse transcription; b) pre-denaturation; c) denaturation and extension; 3) Determine whether the sample to be tested contains the target nucleic acid fragment according to the Cq value of the amplification curve of the mixture in step 2).

[0056] In some specific embodiments, the reverse transcriptase in step 1) is (NovoScript® Ⅲ ReverseTranscriptase Product No. E226).

[0057] In some specific embodiments, based on the volume after mixing in step 1), the working concentration of betaine is 0.5-1.7 mM. Specifically, the working concentration is 0.5-0.6 mM, 0.6-0.8 mM, 0.8-1 mM, 1-1.2 mM, 1.2-1.5 mM or 1.5-1.7 mM.

[0058] In some specific embodiments, based on the volume after mixing in step 1), the working concentration of trehalose is 0.1-0.6 mM. Specifically, the working concentration is 0.1-0.2 mM, 0.2-0.3 mM, 0.3-0.4 mM, 0.4-0.5 mM or 0.5-0.6 mM.

[0059] In some specific embodiments, the temperature of reverse transcription in step 2) is 50-60°C, and the time of reverse transcription is 5-15 min; specifically, the temperature of reverse transcription is 50-52°C, 52-55°C, 55-57°C or 57-60°C, and the time of reverse transcription is 5-7 min, 7-10 min, 10-12 min or 12-15 min; or, the temperature of pre-denaturation in step 2) is 90-100°C, and the time of pre-denaturation is 15-60 s; specifically, the temperature of pre-denaturation is 90-92°C, 92-95°C, 95-97°C or 97-100°C, and the time of pre-denaturation is 15-20 s, 20-30 s, 30-40 s. , 40-50s or 50-60s; or, in step 2), the denaturation temperature is 90-100°C, the denaturation time is 1-5s, the extension temperature is 55-65°C, the extension time is 10-30s, and the number of denaturation and extension cycles is 35-50; specifically, the denaturation temperature is 90-92°C, 92-95°C, 95-97°C or 97-100°C, the denaturation time is 1-2s, 2-3s or 3-5s, the extension temperature is 55-57°C, 57-60°C, 60-62°C or 62-65°C, the extension time is 10-15s, 15-20s, 20-25s or 25-30s, and the number of denaturation and extension cycles is 35-40, 40-45 or 45-50.

[0060] In the present invention, by selecting a specific reverse transcriptase and adjusting the dosage of betaine and trehalose, reverse transcription can be performed at 50-55° C., thereby opening the higher-order structure of tRNA during the reverse transcription process and being compatible with the Taq enzyme amplification system, thereby allowing the entire tRNA detection to be performed in a single tube in a one-step method.

[0061] In the present invention, the term "stem-loop structure" generally refers to a secondary structure formed by the presence of inverted repeat sequences inside RNA molecules, which allow long chain segments to fold back due to hydrogen bond pairing between complementary bases. In this structure, the double-stranded region between the paired bases is called the "stem", while the single-stranded region that cannot be paired protrudes to form a "loop".

[0062] In some cases, when the loop formed is smaller, the stem-loop structure is also called a hairpin or hairpin loop.

[0063] In the present invention, the term "probe" also referred to as "nucleic acid probe" is a short single-stranded DNA or RNA fragment (about 20 to 500 bp) used to detect a nucleic acid sequence complementary thereto. These probes can be labeled with radioisotopes, fluorescent dyes or enzymes (such as horseradish peroxidase) so that after hybridization with a sample, it can be determined whether the sample contains the sequence to be tested (i.e., the sequence complementary to the probe) by methods such as autoradiography, fluorescence, and enzyme-linked chemiluminescence.

[0064] The following describes the embodiments of the present invention through specific examples, and those skilled in the art can easily understand other advantages and effects of the present invention from the contents disclosed in this specification. The present invention can also be implemented or applied through other different specific embodiments, and the details in this specification can also be modified or changed in various ways based on different viewpoints and applications without departing from the spirit of the present invention.

[0065] Before further describing the specific embodiments of the present invention, it should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are for describing the specific embodiments rather than for limiting the scope of protection of the present invention; in the present specification and claims, unless otherwise expressly stated herein, the singular forms "a", "an" and "the" include plural forms.

[0066] When the embodiments give numerical ranges, it should be understood that, unless otherwise specified in the present invention, both endpoints of each numerical range and any numerical value between the two endpoints can be selected. Unless otherwise defined, all technical and scientific terms used in the present invention have the same meaning as those generally understood by those skilled in the art. In addition to the specific methods, equipment, and materials used in the embodiments, according to the grasp of the prior art by those skilled in the art and the record of the present invention, any methods, equipment, and materials of the prior art similar or equivalent to the methods, equipment, and materials described in the embodiments of the present invention can also be used to realize the present invention.

[0067] The nucleotide sequence information used in this application is as follows: SEQ ID No.16 CCUUUGGACUAGUACAUCUAGCUUACCUGAGAUUUAGGCAAGUCGGCCCAAUCUAAGGGCCCCAAAGGCCA SEQ ID No.17 CCGGCGGUAGUUCAGCAGGGCAGAACGGCGGACUCUAAAUCCGCAUGGCAGGGGUUCAAAUCCCCUCCGCCGGCCA SEQ ID No.18 GGAAACCUGAUCAUGUAGAUCGAAUGGACUCUAAAUCCGUUCAGCCGGGUUAGAUUCCCGGGGUUUCCCCA SEQ ID No.19 GTGGGCCTTTGGGGCCCTTAGATTGGGC SEQ ID No.20 CCACTACGCCTCCGCTTTCCTCTCTA SEQ ID No.21 GCCCAATCTAAGGGCCCCAAAGGCCCAC SEQ ID No.22 TGGCCTTTGGGGCCCTTAGA SEQ ID No.23 TGGCCGGCGGAGGGGATTTGAACCC SEQ ID No.24 TGGGGAAACCCCGGGAATCTAACCCGG Example 1 1. Extraction of nucleic acid samples 1.1 The preparation and inspection of reagents and materials before the experiment are as follows: (1) Check the shelf life of the kit and ensure that ethanol has been added to Wash Buffer 1 and 2, and tick the corresponding mark on the bottle; (2) Isopropyl alcohol (if unavailable, anhydrous ethanol can be used as a substitute) and 75% ethanol; (3) 1.5 mL Eppendorf tubes and various pipette tips within the autoclave validity period;

[0068] 1.2 Take out the EDTA anticoagulant tube containing whole blood from the 4℃ refrigerator and mix it by inverting it several times; 1.3 Mark the 1.5mL Eppendorf tube with the unique identification of the specimen; 1.4 Pipette 900 μL of Cell Lysis Solution into sterilized 1.5 mL Eppendorf tubes; 1.5 Carefully transfer 300 μL of whole blood to the 1.5 mL EP tube containing Cell Lysis Solution; 1.6 Cover the Eppendorf tube and incubate at room temperature for 10 minutes; 1.7 Centrifuge at 13,000 rpm at room temperature for 20 seconds; 1.8 Take out the Eppendorf tube and observe the white precipitate; 1.9 Open the Eppendorf tube cap, hold the bottom of the tube, tilt the EP tube mouth to discard part of the red supernatant, and try to absorb all the red supernatant; 1.10 Cover the Eppendorf tube and tap the bottom of the tube with your finger to resuspend the white precipitate; 1.11 Pipette 300 μL Nuclei Lysis Solution into the above Eppendorf tube, cover the tube, and mix by inverting several times; 1.12 Open the Eppendorf tube, transfer 100 μL of Protein Precipitation Solution into the above Eppendorf tube, cover the tube, and shake vigorously on a shaker for 20 seconds; centrifuge at 13,000 rpm at room temperature for 3 minutes; 1.13 Transfer the supernatant to a new sterilized 1.5 mL Eppendorf tube; 1.14 Pipette 300 μL of isopropanol into an Eppendorf tube, cover the tube, and mix by inverting several times. White flocculent gDNA will be precipitated. 1.15 Centrifuge at 13,000 rpm for 1 min at room temperature; 1.16 Open the Eppendorf tube, pinch the bottom of the tube, tilt the tube and discard the supernatant; 1.17 Pipette 300 μL of 75% ethanol into the Eppendorf tube, cover the tube, and gently invert it to wash the precipitate; 1.18 Centrifuge at 13,000 rpm for 1 min at room temperature; 1.19 Open the Eppendorf tube, hold the bottom of the tube, tilt the tube and discard the supernatant; 1.20 Place new filter paper on the laboratory bench, turn the Eppendorf tube upside down, absorb the liquid, and place the Eppendorf tube on its side with the lid open to air dry; 1.21 Visually estimate the size of the precipitate and add 50-100 μL DNA Rehydration Solution to the precipitate; 1.22 After overnight dissolution, use NanoDrop UV spectrophotometer to measure the nucleic acid concentration. The nucleic acid concentration is greater than or equal to 20ng / μL and OD260 / OD280 is 1.9±0.2, which is considered qualified. If the concentration is not enough, add ethanol to precipitate the DNA again, and then add an appropriate amount of DNA Rehydration Solution to dissolve the nucleic acid; 1.23 Mark the unique sample number again on the tube wall and tube cover, and wrap it with transparent tape for protection; 1.24 Store nucleic acid samples in a 4°C refrigerator.

[0069] 2. Fluorescence quantitative PCR reaction 2.1 Prepare 25 μL of PCR amplification system (excluding template addition) in the reagent preparation area and prepare the corresponding primers according to Table 1: Table 1 Gene sequence list Code SEQ ID No. sequence tRNA-F3 1 GGACTAGTACATCTAGCTTACCTGA tRNA-R3 2 CTCTCTATGGCCTTTGGGGC tRNA-P3 3 AGGCAAGTCGGCCCAATCTAAGG tRNA-RT 4 CCACTACGCCTCCGCTTTCCTCTCTATGGCCTTTGGGGCCCTTAGATTGGGC 16s-F3 5 CCGGAACTGTCAAGCTAGAGT 16s-R3 6 CGCTTTCGCACCTCAGTGTCA 16s-P2 7 TCGCCACTGGTATTCCTCCCGAT The components and addition amounts are shown in Table 2: Table 2 Addition amount of each component Mix 10μL tRNA-F3(10uM) 2μL tRNA-R3RC(10uM) 2μL tRNA-P3(10uM) 0.6μL tRNA-RT (10uM) 0.75μL template 2μL <![CDATA[ddH2O]]> Make up to 20 μL The specific composition of Mix is ​​as follows: reverse transcriptase (12.5U), Taq DNA polymerase (0.5U), RNaseInhibitor (20U), dNTP (0.6mM), 500mM Tris-HCl pH7.5, 120mM MgCl2, betaine (0.8mM), trehalose (0.5mM), 0.02% Tritonx-100;

[0070] 2.2 In the specimen preparation area, briefly centrifuge the template and add 2.0 μL to the amplification system. Mark the unique specimen identifier on the PCR tube wall and the test project code on the tube cap. Vortex the PCR tube to mix well and briefly centrifuge on a desktop centrifuge; 2.3 After setting the program, put the PCR tube into the adapter and install it into the thermal cycler, and set the reaction program according to the table below; Table 3 Reaction program and selected channels (FAM / VIC / ROX) stage Temperature Time Number of cycles Reverse transcription 55℃ 10min 1 cycle Pre-denaturation 95℃ 30 s 1 cycle PCR amplification 95℃ 2s, 60℃ 15s (collecting fluorescence) 45 cycles 2.4 Start the instrument operation.

[0071] 3. Interpretation of results: Check whether the corresponding fluorescence channels show specific amplification curves. In this embodiment, the FAM channel shows an S-shaped amplification curve for expressing tRNA.

[0072] The above results are Figure 4-7 As shown, it is shown that the primer and probe system can achieve specific amplification of the tRNA, and the amplification sensitivity reaches 1 copy / reaction. Example 2

[0073] Referring to the steps in Example 1, the detection Figure 2 The tRNA shown in the figure, wherein the amplification system is prepared according to Table 4: Table 4 Gene sequence list Code SEQ ID No. sequence tRNA-WX-F1 / 3 8 GACTCTAAATCCGCATGGCAGG tRNA-WX-R1 / 3RC 9 CCTTTGGGGCCCTTAGATTGG tRNA-WX-P3 10 CAAATCCCCTCCGCCGGCCAGTGG tRNA-WX-RT 11 GCCCAATCTAAGGGCCCCAAAGGCCCACTGGCCGGCGGAGGGGATTTGAACCC The components and addition amounts of the amplification system are as follows: Table 5 Addition amount of each component Mix 10μL tRNA-WX-F1 / 3(10uM) 2μL tRNA-WX-R1 / 3RC(10uM) 2μL tRNA-WX-P3(10uM) 0.6μL tRNA-WX-RT(10uM) 0.75μL template 2μL <![CDATA[ddH2O]]> Make up to 20 μL The above results are Figure 8-11 As shown, it is shown that the primer and probe system can achieve specific amplification of the tRNA, and the amplification sensitivity reaches 1 copy / reaction. Example 3

[0074] Referring to the steps in Example 1, the detection Figure 3 The tRNA shown in the figure, wherein the amplification system is prepared according to the corresponding primers in Table 6: Table 6 Gene sequence list Code SEQ ID No. sequence tRNA-1-F4 12 GGAAACCTGATCATGTAGATCGAA tRNA-1-R4 13 GGGGAAACCCCGGGAATCTA tRNA-1-P4 14 TGGACTCTAAATCCGTTCAGCCGGGT tRNA-1-RT 15 GCCCAATCTAAGGGCCCCAAAGGCCCACTGGGGAAACCCCGGGAATCTAACCCGG The components and addition amounts of the amplification system are as follows: Table 7 Addition amount of each component Mix 10μL tRNA-1-F4 2μL tRNA-1-R4 2μL tRNA-1-P4 0.6μL tRNA-1-RT 0.75μL template 2μL <![CDATA[ddH2O]]> Make up to 20 μL The above results are Figure 12-15 As shown, it is shown that the primer and probe system can achieve specific amplification of the tRNA, and the amplification sensitivity reaches 1 copy / reaction.

[0075] The above examples are for the purpose of illustrating the embodiments disclosed by the present invention and are not to be construed as limiting the present invention. In addition, the various modifications listed herein and the variations of the methods in the invention are obvious to those skilled in the art without departing from the scope and spirit of the present invention. Although the present invention has been specifically described in conjunction with various specific preferred embodiments of the present invention, it should be understood that the present invention should not be limited to these specific embodiments. In fact, various modifications as described above that are obvious to those skilled in the art to obtain the invention should be included within the scope of the present invention.

Claims

1. A primer composition for detecting a polynucleotide containing a stem-loop structure, characterized in that: The primer composition comprises a reverse transcription primer and an amplification primer, wherein the reverse transcription primer comprises a segment complementary to a sequence to be detected and an irrelevant universal sequence segment; The non-related universal sequence segment comprises a nucleic acid fragment having a nucleotide sequence as shown in any one of SEQ ID No.19-21; the segment complementary to the sequence to be tested comprises a nucleic acid fragment having a nucleotide sequence as shown in any one of SEQ ID No.22-24; and the reverse transcription primer comprises a nucleic acid fragment having a nucleotide sequence as shown in any one of SEQ ID No.4, 11, and 15.

2. The primer composition according to claim 1, characterized in that The polynucleotide containing a stem-loop structure is selected from tRNA.

3. The primer composition according to claim 2, characterized in that The polynucleotide containing a stem-loop structure comprises a nucleic acid fragment with a nucleotide sequence as shown in any one of SEQ ID No. 16-18.

4. The primer composition according to claim 1, characterized in that When the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.16, the reverse transcription primer comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.4; or, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.17, the reverse transcription primer comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.11; or, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.18, the reverse transcription primer comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.

15.

5. The primer composition according to claim 1, characterized in that The amplification primer comprises a nucleic acid fragment whose nucleotide sequence is shown in any one of SEQ ID No. 1, 2, 8, 9, 11 or 12.

6. The primer composition according to claim 5, characterized in that The amplification primers comprise nucleic acid fragments whose nucleotide sequences are shown in SEQ ID Nos. 1 and 2; or, the amplification primers comprise nucleic acid fragments whose nucleotide sequences are shown in SEQ ID Nos. 8 and 9; or, the amplification primers comprise nucleic acid fragments whose nucleotide sequences are shown in SEQ ID Nos. 11 and 12.

7. The primer composition according to claim 1, characterized in that The primer composition further comprises a probe; and / or, the probe comprises a nucleic acid fragment with a nucleotide sequence such as SEQ ID No. 3, 10 or 14; and / or, the probe further comprises a labeled fluorescent group and a quenched fluorescent group; and / or, the labeled fluorescent group is selected from one or more of FAM, HEX, VIC, ROX, TAMRA, and CY5; and / or, the quenched fluorescent group is selected from one or more of TAMRA, BHQ1, BHQ2, MGB, DABCYL, and BHQ3.

8. The primer composition according to claim 1, characterized in that When the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.16, the primer composition comprises a reverse transcription primer having a nucleotide sequence as shown in SEQ ID No.4, amplification primers having nucleotide sequences as shown in SEQ ID No.1 and 2, and a probe having a nucleotide sequence as shown in SEQ ID No.3; or, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.17, the primer composition comprises a reverse transcription primer having a nucleotide sequence as shown in SEQ ID No.11, amplification primers having nucleotide sequences as shown in SEQ ID No.8 and 9, and a probe having a nucleotide sequence as shown in SEQ ID No.10; or, when the polynucleotide containing a stem-loop structure comprises a nucleic acid fragment having a nucleotide sequence as shown in SEQ ID No.18, the primer composition comprises a reverse transcription primer having a nucleotide sequence as shown in SEQ ID No.15, amplification primers having nucleotide sequences as shown in SEQ ID No.11 and 12, and a probe having a nucleotide sequence as shown in SEQ ID No.

14.

9. Use of the primer composition according to any one of claims 1 to 8 in preparing a tRNA detection product.

10. The use according to claim 9, characterized in that The tRNA detection product further comprises one or more of a reverse transcriptase, a DNA polymerase, a buffer reagent, a surfactant or a preservative.

11. A method for detecting a polynucleotide containing a stem-loop structure, characterized in that: The method comprises the following steps: 1) mixing the primer composition according to any one of claims 1 to 8, a sample to be tested, reverse transcriptase, DNA polymerase, betaine, trehalose and water; 2) Perform the following procedures on the mixture obtained in step 1): a) reverse transcription; b) pre-denaturation; c) denaturation and extension; 3) Determine whether the sample to be tested contains the target nucleic acid fragment according to the Cq value of the amplification curve of the mixture in step 2).

Images