Heterologous expression engineering strain of tsupobiacin as well as construction method and application of heterologous expression engineering strain of tsupobiacin

Abstract

The invention discloses an engineering strain for heterologous expression of tsupoubicin as well as a construction method and application of the engineering strain. The engineering strain disclosed by the invention takes streptomyces albus as a host strain, expresses a Tsutubicin biosynthetic gene cluster, and is constructed by introducing the Tsutubicin biosynthetic gene cluster into the streptomyces albus and then replacing a promoter of a tsutuR1 gene on the Tsutubicin biosynthetic gene cluster with an ermEp * promoter; the classification name of the engineering strain is Streptomyces albus JM2, and the preservation number of the engineering strain is CGMCC (China General Microbiological Culture Collection Center) NO.32168. The shake flask fermentation yield of the engineering strain disclosed by the invention reaches 10.5 mg / L, which is improved by 7.3 times compared with that of the original production strain, and efficient heterologous expression of the novel anthracycline compound tsupobiacin biosynthetic gene cluster is realized for the first time.

Description

Technical Field

[0001] The invention belongs to the field of pharmaceutical biotechnology and relates to a tsukubabitsu heterologous expression engineering strain and a construction method and application thereof. Background Art

[0002] Due to evolving pathogens and emerging diseases, new drugs / lead compounds derived from natural products remain crucial to modern medicine. Streptomyces is an important microbial resource for studying new compounds, and a large number of silent secondary metabolites exist in each species of Streptomyces. Tsukubarubicin is a novel class of anthracycline compounds obtained by activating a silent gene cluster in Streptomyces tsukubaensis. The fermentation broth showed that tsukubarubicin had significant inhibitory activity against Bacillus subtilis, and the compound tsukubarubicin isolated and identified from it had strong inhibitory activity against cancer cell proliferation.

[0003] Doxorubicin is a commonly used anti-cancer drug in clinical practice. Using it as a control, tsukubarubicin showed stronger inhibitory activity on lung cancer cells A549, colon cancer cells HCT116, breast cancer cells MDA-MB-231, and gastric cancer cells MGC803. The inhibitory activity of tsukubarubicin on the four cell lines was significantly better than that of doxorubicin, and its inhibitory effect on breast cancer cells MDA-MB-231 was more prominent (Wu QB, Chen XA, Lv ZY, et al. Activation and discovery of tsukubarubicin from Streptomyces tsukubaensis through overexpressing SARPs [J]. Appl Microbiol Biotechnol, 2021, 105 (11): 4731-4741.). This indicates that the highly active tsukubarubicin has great drug potential in anticancer drugs, especially anti-breast cancer drugs.

[0004] However, in the process of fermenting tsukubabin by the original producing bacteria Streptomyces tsukuba L1907, the fermentation level of tsukubabin is low, the fermentation cycle is long, and there are many homologous impurities, resulting in high production costs and large separation and purification losses; in addition, the gene editing efficiency of Streptomyces tsukubabin is low, and there are other competitive metabolic pathways that hinder the efficient synthesis of tsukubabin. Summary of the invention

[0005] In view of the deficiencies in the prior art, the present invention provides a Tsukuba Bixing heterologous expression engineering strain and a construction method and application thereof.

[0006] The present invention adopts the following technical solution:

[0007] 1. A Tsukubabitsu heterologous expression engineered strain

[0008] The engineering strain uses Streptomyces albus as a host strain and expresses the Tsukubabitin biosynthetic gene cluster. The GenBank number of the Tsukubabitin biosynthetic gene cluster is MW561258.1.

[0009] Specifically, the engineered strain is constructed by introducing the tsuR1 gene cluster of the tsuR1 biosynthesis gene into Streptomyces albus, and then replacing the promoter of the tsuR1 gene on the tsuR1 gene cluster with the ermEp* promoter. The GenBank number of the tsuR1 gene is QWA14213.1.

[0010] Preferably, the host strain is classified and named as Streptomyces albus J1074, and Streptomyces albus J1074 is deposited in the General Microbiological Center (CGMCC) of China Microorganism Culture Collection Administration, with a deposit number of CGMCC No.4.7233, a deposit date of August 12, 2014, and a deposit address of No. 3, Yard No. 1, Beichen West Road, Chaoyang District, Beijing.

[0011] Preferably, the tsukubabinshi biosynthetic gene cluster is derived from Streptomyces tsukubaensis L199, which is deposited in the General Microbiology Center of the China Culture Collection Administration (CGMCC), with a deposit number of CGMCC No. 22816, a deposit date of July 5, 2021, and a deposit address of No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0012] The present invention further provides a tsukubabixing heterologous expression engineering strain, wherein the engineering strain uses Streptomyces albus J1074 as a host strain and Streptomyces albus L199 as a source strain of the tsukubabixing biosynthetic gene cluster. The classification of the engineering strain is Streptomyces albus JM2, the deposit unit is the General Microbiological Center (CGMCC) of the China Microbiological Culture Collection Administration, the deposit number is CGMCC NO.32168, the deposit date is October 10, 2024, and the deposit address is No. 3, Yard 1, Beichen West Road, Chaoyang District, Beijing.

[0013] 2. A method for constructing a Tsukubabitsin heterologous expression engineering strain

[0014] The construction method comprises the following steps:

[0015] 1) Using the large genome fragment in vitro recombination method, the tsukubabitsu biosynthetic gene cluster was cloned and the vector elements were replaced to obtain the recombinant vector p15A-tsu containing the tsukubabitsu biosynthetic gene cluster. The step 1) is specifically as follows:

[0016] 1.1) Using mixed colony PCR technology, the tsukubabitin biosynthetic gene cluster was located from the BAC library of Streptomyces tsukuba through primer pairs, and then the plasmid pTSU containing the tsukubabitin biosynthetic gene cluster was obtained;

[0017] The primer pair comprises a first primer pair (tsu-up-F / R), a second primer pair (tsu-mid-F / R) and a third primer pair (tsu-down-F / R); the first primer pair (tsu-up-F / R) is composed of a primer tsu-up-F and a primer tsu-up-R whose nucleotide sequences are respectively shown in SEQ ID NO.1 and SEQ ID NO.2; the second primer pair (tsu-mid-F / R) is composed of a primer tsu-mid-F and a primer tsu-mid-R whose nucleotide sequences are respectively shown in SEQ ID NO.3 and SEQ ID NO.4; the third primer pair (tsu-down-F / R) is composed of a primer tsu-down-F and a primer tsu-down-R whose nucleotide sequences are respectively shown in SEQ ID NO.5 and SEQ ID NO.6;

[0018] 1.2) The plasmid pTSU containing the tsukuba bicin biosynthetic gene cluster and the vector containing the p15A replicon are treated by using the linear loop recombination technology, and the tsukuba bicin biosynthetic gene cluster is inserted into the vector containing the p15A replicon to obtain an intermediate plasmid containing the p15A replicon and the tsukuba bicin biosynthetic gene cluster, and the linear loop recombination technology is then used to modify the intermediate plasmid with an element box containing an integrase gene to obtain a recombinant vector p15A-tsu containing the p15A replicon, the integrase gene and the tsukuba bicin biosynthetic gene cluster.

[0019] 2) The recombinant vector p15A-tsu obtained in step 1) is transferred to the host strain by conjugation, and inserted into the genome of the host strain under the action of integrase to obtain an intermediate strain. The specific steps of step 2) are:

[0020] 2.1) Introducing the recombinant vector p15A-tsu into Escherichia coli by biparental conjugation transfer technology to obtain Escherichia coli containing the recombinant vector p15A-tsu;

[0021] 2.2) Using Streptomyces albus J1074 as the host strain, the recombinant vector p15A-tsu was introduced into the host strain by Escherichia coli-Streptomyces conjugation transfer technology and inserted into the genome of the host strain to obtain the intermediate strain Streptomyces albus JM1.

[0022] 3) Using a traceless gene recombination technique, the promoter of the tsuR1 gene on the tsubabixin biosynthetic gene cluster in the genome of the intermediate strain is replaced with the ermEp* promoter to obtain the engineered strain. The step 3) is specifically as follows:

[0023] 3.1) Using the genome of the source strain Streptomyces tsukuba L199 as a template, the fourth primer pair (primer pair PR1-1 / 2) was used to amplify the upstream fragment of the tsuR1 gene promoter, and the fifth primer pair (primer pair PR1-5 / 6) was used to amplify the downstream fragment of the tsuR1 gene promoter; using fusion PCR technology, the upstream fragment of the tsuR1 gene promoter, the downstream fragment of the tsuR1 gene promoter and the ermEp* promoter were combined into the fragment ermEp*-HA;

[0024] The fourth primer pair (PR1-1 / 2) consists of primer PR1-1 and primer PR1-2, whose nucleotide sequences are shown in SEQ ID NO.18 and SEQ ID NO.19, respectively; the fifth primer pair (PR1-5 / 6) consists of primer PR1-5 and primer PR1-6, whose nucleotide sequences are shown in SEQ ID NO.22 and SEQ ID NO.23, respectively; the nucleotide sequences of the upstream fragment of the tsuR1 gene promoter and the downstream fragment of the tsuR1 gene promoter are shown in SEQ ID NO.24 and SEQ ID NO.24, respectively;

[0025] 3.2) using restriction endonucleases HindIII and EcoRI to digest plasmid pKC1139 to obtain a linear plasmid fragment; using seamless cloning technology to connect the linear plasmid fragment with the fragment ermEp*-HA to obtain plasmid pKC1139-ermEp*-HA;

[0026] 3.3) The plasmid pKC1139-ermEp*-HA was transferred into the intermediate strain Streptomyces albus JM1 by using the E. coli-Streptomyces conjugation transfer technique, and the engineered strain Streptomyces albus JM2 was obtained by screening. Step 3.3) is specifically as follows: the plasmid pKC1139-ermEp*-HA was introduced into the competent E. coli cell ET12567 / pUZ8002 by chemical transformation, and then conjugated with Streptomyces albus JM1 to obtain Streptomyces albus JM2 by screening.

[0027] 3. Application of a Tsukubabitsu heterologous expression engineered strain

[0028] The Tsukubabitsu heterologous expression engineered strain is used for fermentation production of Tsukubabitsu.

[0029] 4. A method for producing Tsukubabitsu using a Tsukubabitsu heterologous expression engineered strain

[0030] The method for producing tsukubabicin comprises the following steps: culturing the tsukubabicin heterologous expression engineering strain in a fermentation medium at 28° C. for 144 hours to obtain a fermentation product, and separating tsukubabicin from the fermentation product. The fermentation medium is preferably a NoS-soyE1 medium.

[0031] Compared with the prior art, the present invention has the following beneficial effects:

[0032] 1. The present invention provides a method for constructing an engineered strain for synthesizing tsukubabitin using a tsukubabitin biosynthetic gene cluster, thereby realizing heterologous and efficient synthesis of tsukubabitin. The method of the present invention improves the biosynthetic efficiency of tsukubabitin by enhancing the expression of regulatory genes in the tsukubabitin biosynthetic gene cluster, thereby realizing efficient heterologous expression of the tsukubabitin biosynthetic gene cluster of the novel anthracycline compound.

[0033] 2. The present invention provides an engineered strain capable of efficiently synthesizing tsukubabin: Streptomyces albus JM2, which realizes the heterologous synthesis of tsukubabin for the first time. The tsukubabin shake flask fermentation yield of Streptomyces albus JM2 reaches 10.5 mg / L. Compared with the original producing strain Streptomyces tsukubaensis L1907, the production efficiency of tsukubabin fermented by Streptomyces albus JM2 is increased by 7.3 times.

[0034] 3. The Streptomyces albus JM2 constructed by the present invention can efficiently express tsukubabinin and is widely used in the fermentation production of tsukubabinin and in the screening and preparation of anti-tumor drugs. BRIEF DESCRIPTION OF THE DRAWINGS

[0035] Figure 1 is a schematic diagram of heterologous expression of the tsukubabitin synthetic gene cluster in the present invention;

[0036] Figure 2 This is a high performance liquid chromatography analysis chart of the tsukubabixin fermentation product of the present invention;

[0037] Figure 3 It is a bar chart comparing the yields of Tsukubabitsing in Example 4, Comparative Example 1 and Comparative Example 3 of the present invention. DETAILED DESCRIPTION

[0038] The present invention is further described in conjunction with the accompanying drawings and examples. The experimental methods in the following examples are conventional methods unless otherwise specified. The materials, reagents, etc. used in the following examples are all commercially available unless otherwise specified.

[0039] The present invention provides a method for constructing a Tsukubabixin heterologous expression engineering strain using a Tsukubabixin biosynthetic gene cluster. The construction method of the present invention is based on the Streptomyces genomic library screening technology to obtain the Tsukubabixin biosynthetic gene cluster; through the Red / ET large fragment DNA in vitro recombination technology, the vector skeleton containing the Tsukubabixin biosynthetic gene cluster is cloned and modified, which is conducive to its expression in a heterologous host; the constitutive strong promoter ermEp* promoter is inserted before the pathway-specific regulatory factor, so that the expression level of the gene cluster introduced into the heterologous host can be maintained at a high level; finally, an engineering strain capable of efficiently synthesizing Tsukubabixin is obtained.

[0040] The present invention further provides a tsukubabitin heterologous expression engineering strain constructed by the above method: Streptomyces albus JM2. Streptomyces albus JM2 uses Streptomyces albus J1074 as a host strain to express the tsukubabitin biosynthetic gene cluster derived from Streptomyces albus L199. Streptomyces albus JM2 achieves heterologous and efficient synthesis of tsukubabitin, and the production efficiency of fermented tsukubabitin is 7.3 times higher than that of the original production strain Streptomyces albus L1907.

[0041] The specific embodiments of the present invention are as follows:

[0042] Example 1

[0043] This example provides an implementation method for constructing a recombinant vector p15A-tsu containing the Tsukubabitsu biosynthetic gene cluster. This example uses a large genomic fragment in vitro recombination method to clone the Tsukubabitsu biosynthetic gene cluster and replace vector elements to obtain a recombinant vector p15A-tsu containing the Tsukubabitsu biosynthetic gene cluster.

[0044] This embodiment specifically includes the following steps:

[0045] 1.1) Obtaining the biosynthetic gene cluster of tsububicin in vitro: Using the mixed colony PCR technique, the biosynthetic gene cluster of tsububicin was located from the BAC library of Streptomyces tsububicin by three primer pairs (the first primer pair tsu-up-F / R, the second primer pair tsu-mid-F / R and the third primer pair tsu-down-F / R), and then the plasmid pTSU containing the biosynthetic gene cluster of tsububicin was obtained. Step 1.1) is specifically as follows:

[0046] 1.1.1) Based on the BAC library of Streptomyces tsukuba L199, a mixed PCR screening method was used to select three points of the tsukuba bicin biosynthetic gene cluster (i.e., the two boundaries and the middle), and three pairs of specific primers (the first primer pair tsu-up-F / R, the second primer pair tsu-mid-F / R, and the third primer pair tsu-down-F / R) were used to locate the Escherichia coli monoclonal suspension in the Pth row and the 22nd column that contained the complete target tsukuba bicin biosynthetic gene cluster, and obtain Escherichia coli containing the tsukuba bicin biosynthetic gene cluster. Among them, the nucleotide sequences of primer tsu-up-F, primer tsu-up-R, primer tsu-mid-F, primer tsu-mid-R, primer tsu-down-F, and primer tsu-down-R are shown in SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively.

[0047] 1.1.2) The E. coli containing the Tsukubabin biosynthetic gene cluster obtained in step 1.1.1) is cultured and then the large plasmid is extracted to obtain the plasmid pTSU containing the Tsukubabin biosynthetic gene cluster. The extraction process of the large plasmid containing the Tsukubabin biosynthetic gene cluster is as follows:

[0048] ① Take a test tube containing 4 mL of LB liquid culture medium, add apramycin, inoculate the Escherichia coli monoclonal suspension containing the tsukubabin biosynthetic gene cluster into the test tube, and culture the inoculated test tube at 37°C and 250 rpm in a shaking incubator overnight; centrifuge the cultured cell suspension at 13,000 rpm for 1 min, remove the supernatant; add 200 μL of P1 buffer to resuspend the bacteria;

[0049] ② Then add 200 μL of P2 buffer and mix by inverting; then add 200 μL of P3 buffer and mix gently by inverting; centrifuge the mixture at 15000 rpm for 10 min;

[0050] ③After centrifugation, transfer 500μL of the supernatant to a new EP tube, add 600μL of pre-cooled isopropanol solution, and shake vigorously 5-6 times; centrifuge at 4℃, 15000rpm for 10 minutes, remove the supernatant; add 1mL 75% ethanol to the precipitate for washing;

[0051] ④ Centrifuge at 4°C and 15,000 rpm for 1 minute and remove the supernatant; dry the EP tube in a 60°C metal bath; add 50 μL of distilled water to the EP tube to dissolve the plasmid DNA, i.e., the plasmid pTSU containing the Tsukubabinski biosynthetic gene cluster.

[0052] 1.2) Cloning the tsukubabin biosynthetic gene cluster into a vector suitable for Streptomyces: Using Red / ET DNA loop recombination technology, the tsukubabin biosynthetic gene cluster was fished out and inserted into the vector p15A-cmR-tetR-tetO-hyg-ccdB containing the p15A replicon (corresponding to the attached Figure 1 In the "p15A" of the invention, the vector p15A-cmR-tetR-tetO-hyg-ccdB is used to ensure the stable replication of the tsukubabinin biosynthetic gene cluster; and then the chloramphenicol resistance gene cmR on the p15A vector backbone is replaced with an element box suitable for Streptomyces conjugation transfer to obtain a recombinant vector p15A-tsu containing the p15A replicon, the integrase gene, and the tsukubabinin biosynthetic gene cluster. Figure 1 As shown, step 1.2) is specifically as follows:

[0053] 1.2.1) Using the vector p15A-cmR-tetR-tetO-hyg-ccdB containing the p15A replicon as a template, use the primer pair p15A-F / R to amplify the p15A linearized fragment;

[0054] At the same time, the genome of Streptomyces tsuha1-F / R and tsuHA2-F / R were used as templates, and two 80 bp fragments at the boundaries of the tsuha1-F / R biosynthetic gene cluster were PCR amplified as homology arms, respectively, to obtain homology arms HA1 and HA2, and the 5' end of HA1 and the 3' end of HA2 each contained a sequence (20 bp) with 100% homology to both ends of the p15A linearized fragment; the amplified products were recovered, and the three fragments were fused into one fragment using the primer tsuHA1-F and the primer tsuHA2-R by fusion PCR technology to obtain the fragment p15A-HA;

[0055] The nucleotide sequences of primer p15A-F, primer p15A-R, primer tsuHA1-F, primer tsuHA1-R, primer tsuHA2-F, and primer tsuHA2-R are shown as SEQ ID NO.7, SEQ ID NO.8, SEQ ID NO.9, SEQ ID NO.10, SEQ ID NO.11, and SEQ ID NO.12, respectively; the nucleotide sequence of the p15A linearized fragment is shown as SEQ ID NO.13; the nucleotide sequences of homology arm HA1 and homology arm HA2 are shown as SEQ ID NO.14 and SEQ ID NO.15, respectively.

[0056] 1.2.2) Take 5 μL of plasmid pTSU (1 μg / μL) and fragment p15A-HA (200 ng / μL) obtained in step 1.1), add to 50 μL of electroporation competent cells E.coli GB2005 / pSC101, slowly pipette and mix well, then immediately transfer to an electroporation cup, wipe the surface of the electroporation cup with absorbent paper and place it in an Eppendorf electroporator, the electroporation conditions are: voltage 1350V, 10 μF, 600Ω; then add 750 μL of LB liquid culture medium, incubate at 37°C on a shaker for 1 hour, then spread the cells on LB solid culture medium containing 5 μg / mL tetracycline, and culture at 37°C overnight;

[0057] 1.2.3) Single clones grown on the plate were verified by PCR using primer pair p15A-F2 / tsu-up-R and primer pair p15A-R2 / tsu-down-F to obtain the intermediate plasmid p15A-cmR-tetR-tetO-tsu containing the p15A replicon and the tsuubibisin biosynthetic gene cluster;

[0058] The nucleotide sequences of primer p15A-F2, primer p15A-R2, primer tsu-up-R, and primer tsu-down-F are shown as SEQ ID NO.27, SEQ ID NO.28, SEQ ID NO.2, and SEQ ID NO.5, respectively.

[0059] 1.2.4) The pR6K-phiC31-oriT-aac(3)IV plasmid was digested with restriction endonuclease AseI at 37°C for 3 h, and the digestion product was purified and recovered to obtain the integrase gene (corresponding to Figure 1 The nucleotide sequence of the element box oriT-phi31 integrase-attP-aac(3)IV is shown in SEQ ID NO.16. The digestion reaction system of the restriction endonuclease is shown in the following table:

[0060] Components Dosage (20μL system) <![CDATA[ddH 2 The]]> XμL 10×Buffer 5μL Restriction endonuclease 1 1μL Restriction endonuclease 2 1μL Plasmid DNA 1 μg

[0061] 1.2.5) Take 5 μL of the intermediate plasmid p15A-cmR-tetR-tetO-tsu (1 μg / μL) and the element box oriT-phi31integrase-attP-aac(3)IV (200 ng / μL), add them to 50 μL of electroporation competent cells E.coli GB2005 / pSC101, slowly pipette and mix, and immediately transfer to an electroporation cup. After wiping the surface of the electroporation cup dry with absorbent paper, place it in an Eppendorf electroporator. The electroporation conditions are: voltage 1350 V, 10 μF, 600 Ω; then add 750 μL of LB liquid culture medium, incubate at 37°C on a shaker for 1 hour, then spread the cells on LB solid culture medium containing 50 μg / mL apramycin, and culture at 37°C overnight;

[0062] 1.2.6) Use primer pairs p15A-HA1F / pR6K-HA1R and p15A-HA2R / pR6K-HA2F to perform PCR verification on the single clones grown on the plate to obtain an integrative vector p15A-tsu containing the tsukubabixin synthesis gene cluster and applicable to Streptomyces, that is, a recombinant vector p15A-tsu containing a p15A replicon, an integrase gene, and a tsukubabixin biosynthesis gene cluster. The nucleotide sequences of primer p15A-HA1F, primer p15A-HA2R, primer pR6K-HA1R, and primer pR6K-HA2F are shown in SEQ ID NO.29, SEQ ID NO.30, SEQ ID NO.31, and SEQ ID NO.32, respectively.

[0063] Example 2

[0064] This example provides an implementation method of transferring the recombinant vector p15A-tsu obtained in Example 1 to Streptomyces albus by conjugation, and inserting it into the genome of Streptomyces albus under the action of integrase to obtain tsukubabicin-producing Streptomyces albus JM1. The integrase is phiC31 integrase, which is encoded by the phi31 integrase gene on the recombinant vector p15A-tsu backbone, and the nucleotide sequence of the phi31 integrase gene is shown in SEQ ID NO.17.

[0065] This embodiment specifically includes the following steps:

[0066] 2.1) The recombinant vector p15A-tsu was introduced into E.coilET12567 / pUZ8002 by biparental conjugation transfer technology to obtain E.coilET12567 / pUZ8002 / p15A-tsu. Step 2.1) is specifically as follows:

[0067] 2.1.1) The E. coli monoclone containing the recombinant vector p15A-tsu was transferred to 5 mL of LB liquid culture medium, and the corresponding antibiotics were added. The culture was shaken at 37°C and 220 rpm for 14-16 hours.

[0068] 2.1.2) Pick out a single clone of E. coli ET12567 / pUB307 and transfer it to 5 mL LB liquid medium containing chloramphenicol (25 μg / mL) and kanamycin (50 μg / mL), and culture at 37°C and 220 rpm for 14-16 h.

[0069] 2.1.3) Inoculate the E. coli culture of step 2.1.1) and 2.1.2) into LB liquid medium (10 mL) containing the corresponding antibiotics at a 1 / 100 inoculum volume, and culture at 37°C, 220 rpm with shaking for 4-6 h until OD 600nm The cell suspension was 0.4-0.6. The cells were precipitated by centrifugation at 4000 rpm for 4 min, washed twice with LB liquid culture medium, and finally suspended in a smaller volume of LB liquid culture medium to obtain an E. coli cell suspension of E. coil ET12567 / pUZ8002 / p15A-tsu.

[0070] 2.2) The recombinant vector p15A-tsu in the Escherichia coli containing the recombinant vector p15A-tsu obtained in step 2.1) is introduced into Streptomyces albus J1074 by Escherichia coli-Streptomyces conjugation transfer technology, and inserted into the genome of Streptomyces albus J1074 to obtain Streptomyces albus JM1. Step 2.2) is specifically as follows:

[0071] 2.2.1) Treatment of Streptomyces spores: Fresh or frozen (stored at -80°C) albus S. albus J1074 spores were washed twice in LB liquid medium, suspended in 500 μL TES buffer, and then placed in a 50°C water bath for 10 min to germinate the spores. Then an equal volume of 500 μL of 2×YT liquid medium was added, and the mixture was incubated at 37°C 220 rpm for 2-3 hours. The germinated spores were precipitated by centrifugation, collected and resuspended in 500 μL TES buffer.

[0072] 2.2.2) Mixing and co-cultivation: Add the Escherichia coli cell suspension obtained in step 2.1) to the spore suspension prepared in step 2.2.1), mix and let stand for 5 minutes; spread the mixture on MS solid culture medium and culture at 30°C for 12-16 hours; then spread apramycin (50 μg / mL) and nalidixic acid (25 μg / mL) on the surface of the plate; then culture the plate at 30°C for 3-5 days; the grown transformants were verified with the verification primer pair tsu-up-F / R, the verification primer pair tsu-mid-F / R and the verification primer pair tsu-down-F / R to obtain the white Streptomyces JM1 containing the tsuubibixin biosynthetic gene cluster. The nucleotide sequences of primer tsu-up-F, primer tsu-up-R, primer tsu-mid-F, primer tsu-mid-R, primer tsu-down-F, and primer tsu-down-R are shown as SEQ ID NO.1, SEQ ID NO.2, SEQ ID NO.3, SEQ ID NO.4, SEQ ID NO.5, and SEQ ID NO.6, respectively.

[0073] Example 3

[0074] This example provides an implementation method for replacing the native promoter of the tsuR1 gene on the tsukubabixin biosynthetic gene cluster with the ermEp* promoter using a traceless gene recombination technique to obtain a high-yield tsukubabixin Streptomyces JM2. The protein TsuR1 encoded by the tsuR1 gene, a pathway-specific regulatory gene of the tsukubabixin biosynthetic gene cluster, belongs to the SARP (Streptomyces antibiotic regulatory protein) protein family. The promoter of the tsuR1 gene is replaced by the efficient constitutive strong promoter ermEp* suitable for Streptomyces, so that the regulatory protein TsuR1 encoded by it is efficiently expressed in Streptomyces, thereby positively regulating the expression level of the tsukubabixin biosynthetic gene cluster, and then improving the fermentation level of tsukubabixin.

[0075] This embodiment specifically includes the following steps:

[0076] 3.1) The upstream fragment of tsuR1 gene promoter, the downstream fragment of tsuR1 gene promoter and ermEp* promoter were combined into the fragment ermEp*-HA using fusion PCR technology. Step 3.1) is specifically as follows: using the genome of Streptomyces tsukuba L199 as a template, using primer pair PR1-1 / 2 and primer pair PR1-5 / 6 to amplify the upstream fragment of the tsuR1 gene promoter and the downstream fragment of the tsuR1 gene promoter, respectively, the length of the upstream fragment of the tsuR1 gene promoter and the downstream fragment of the tsuR1 gene promoter are both 1500bp; using vector pIJ8660-ermEp* as a template, using primer pair PR1-3 / 4 to perform PCR amplification, and the front and back of the obtained fragment respectively contain a sequence homologous to the 3' end of the upstream fragment of the tsuR1 promoter and the 5' end of the downstream fragment (each 20bp); recovering and purifying the above three PCR products, and then performing fusion PCR with primer PR1-1 / 6, connecting the three fragments into one fragment, recovering and purifying, and obtaining the fragment ermEp*-HA. The nucleotide sequences of primer PR1-1, primer PR1-2, primer PR1-3, primer PR1-4, primer PR1-5 and primer PR1-6 are shown in SEQ ID NO.18, SEQ ID NO.19, SEQ ID NO.20, SEQ ID NO.21, SEQ ID NO.22 and SEQ ID NO.23, respectively. The nucleotide sequences of the upstream fragment of the tsuR1 gene promoter and the downstream fragment of the tsuR1 gene promoter are shown in SEQ ID NO.24 and SEQ ID NO.25, respectively; the nucleotide sequence of the promoter ermEp* is shown in SEQ ID NO.26.

[0077] 3.2) The plasmid pKC1139 was digested with restriction endonucleases HindIII and EcoRI to obtain a linear plasmid fragment; the linear plasmid fragment was connected with the fragment ermEp*-HA using seamless cloning technology to obtain plasmid pKC1139-ermEp*-HA. Step 3.2) is specifically as follows: use restriction endonucleases HindIII and EcoRI to cut plasmid pKC1139, digest at 37°C for 3 hours, purify and recover the digestion product to obtain linearized vector pKC1139; connect the linearized vector pKC1139 and the fragment ermEp*-HA together by seamless cloning technology to obtain plasmid pKC1139-ermEp*-HA; use chemical transformation to introduce plasmid pKC1139-ermEp*-HA into Escherichia coli competent cells DH5α, incubate for 1 hour, then spread on a plate (containing corresponding antibiotics), and culture in a 37°C incubator overnight; verify positive clones, obtain Escherichia coli containing plasmid pKC1139-ermEp*-HA, and extract to obtain plasmid pKC1139-ermEp*-HA.

[0078] 3.3) The plasmid pKC1139-ermEp*-HA was transferred into Streptomyces albus JM1 using the Escherichia coli-Streptomyces conjugation transfer technique to obtain Streptomyces albus JM2. Step 3.3) is specifically as follows: the plasmid pKC1139-ermEp*-HA was introduced into the competent Escherichia coli cell ET12567 / pUZ8002 by chemical transformation, and conjugated with Streptomyces albus JM1. After subculture on MS solid medium, the genotype of the mutant strain was verified by PCR using the internal primers ermEp-inF / R, and the promoter-replaced, high-yielding Streptomyces albus JM2 was screened. The nucleotide sequences of primer ermEp-inF and primer ermEp-inR are shown in SEQ ID NO.33 and SEQ ID NO.34, respectively.

[0079] Example 4

[0080] This embodiment provides a method for producing tsukubabitsu using tsukubabitsu heterologous expression Streptomyces albus JM2. Specifically, it includes the following steps:

[0081] 1. Plate culture: Culture Streptomyces albus JM2 on MS solid medium at 28°C for 7 days.

[0082] 2. Seed culture: scrape a bacterial block of about 1cm×1cm, inoculate it into the seed culture medium (30mL / 250mL), culture it at 28℃ for 24h, and shake it at 220rpm. The seed culture medium uses TSB medium.

[0083] 3. Fermentation: The mycelium in the seed culture medium was inoculated into the fermentation medium NoS-soyE1 at an inoculum size of 5%, and cultured at 28°C for 144 h; 3 parallels were prepared in each group, and samples were taken separately, and the fermentation broth was tested by high performance liquid chromatography.

[0084] 4. HPLC detection conditions: Chromatographic column: C18 column (Aglient, ZORBAX Extend-C18, 4.6 mm×150 mm, 5-Micron); detection wavelength: 500 nm; flow rate: 1.00 mL / min; injection volume: 50 μL; mobile phase: phase A is water containing 0.1% formic acid, and mobile phase B is pure acetonitrile; elution conditions: 0-30 min, 5%-45% phase B; 30-35 min, 100% phase B; 35-40 min, 100% phase B.

[0085] 5. Isolation of tsukubabinoxin: 0.6 mL of methanol was added to 0.3 mL of fermentation broth obtained by fermentation, and the mixture was shaken thoroughly and centrifuged at 15,000 rpm / min for 10 min. The supernatant was filtered through a 0.22 μm sterile microporous filter membrane, and the filtrate was collected to obtain a tsukubabinoxin sample.

[0086] Comparative Example 1

[0087] In this comparative example, tsukubabitin was produced using the tsukubabitin progenitor Streptomyces tsukuba L1907 in a similar manner to Example 4. The difference between this comparative example and Example 4 is that, in the plate culture stage, the tsukubabitin progenitor Streptomyces tsukuba L1907 was cultured on ISP4 solid medium at 28°C for 7 days.

[0088] Comparative Example 2

[0089] In this comparative example, tsukubabinin was produced using the starting strain Streptomyces albus J1074 in a similar manner to Example 4. The difference between this comparative example and Example 4 is that, in the plate culture stage, the starting strain Streptomyces albus J1074 was cultured on MS solid medium at 28° C. for 7 days.

[0090] Comparative Example 3

[0091] In this comparative example, Streptomyces albus JM1 was used to produce tsukubabinin in a similar manner to Example 4. The difference between this comparative example and Example 4 is that, in the plate culture stage, Streptomyces albus JM1 was cultured on MS solid medium at 28° C. for 7 days.

[0092] The tsukubabinoxin obtained in Example 4 of the present invention and Comparative Examples 1 to 3 was used for HPLC detection. The results are as follows: Figure 2 and Figure 3 shown.

[0093] Figure 2 The HPLC analysis diagrams of the tsukuba streptomyces L1907, albicans streptomyces J1074, albicans streptomyces JM1 and albicans streptomyces JM2 in the present invention in 250 mL shake flasks (NoS-soyE1 culture medium) are shown in the figure. In the figure, (i) is the spectrum of the tsukuba bicin standard. (ii) is the detection spectrum of the fermentation product of the albicans streptomyces JM2 strain. (iii) is the detection spectrum of the fermentation product of the albicans streptomyces JM1 strain. (iv) is the detection spectrum of the fermentation product of the tsukuba streptomyces L1907. (v) is the detection spectrum of the fermentation product of the albicans streptomyces J1074 wild-type strain. Figure 2 As shown, a substance with the same peak time as the tsukubabin standard can be detected in the fermentation broth of Streptomyces albus JM1, but in a small amount; while the content of tsukubabin in the fermentation broth of Streptomyces albus JM2 is significantly increased.

[0094] Figure 3 The following is a bar chart comparing the tsukubabinin yields of Streptomyces albus JM2, Streptomyces tsukuba L1907 and Streptomyces albus JM1 in 250 mL shake flasks (NoS-soyE1 medium) in Example 4, Comparative Example 1 and Comparative Example 3 of the present invention. Figure 3 As shown, the fermentation yield of tsukubabitsu by the original production bacterium Streptomyces tsukuba L1907 was 1.26 mg / L, and the fermentation yields of tsukubabitsu by Streptomyces albus JM1 and Streptomyces albus JM2 were 1.7 mg / L and 10.5 mg / L, respectively, which were 35% and 733% higher than those of L1907.

[0095] The culture medium and reagents used in the embodiments of the present invention are:

[0096] LB liquid medium: peptone 10 g, yeast extract 5 g, NaCl 10 g, distilled water 1000 mL, pH 7.2.

[0097] LB solid medium: peptone 10 g, yeast extract 5 g, NaCl 10 g, agar 20 g, distilled water 1000 mL, pH 7.2.

[0098] 2×YT liquid medium: peptone 16 g, yeast extract 10 g, NaCl 5 g, distilled water 1000 mL, pH 7.2.

[0099] MS solid medium: 20 g mannitol, 20 g soybean powder, 20 g agar, 1000 mL distilled water, pH 7.3; the medium for conjugation transfer needs to be sterilized and added with 10 mM MgCl 2 Solution.

[0100] ISP4 solid medium: 37 g of ISP4 solid powder (BD TM ), distilled water 1000mL, pH 7.2.

[0101] TSB medium: 20 g TSB solid powder (BD TM ), distilled water 1000mL, pH 7.2.

[0102] NoS-soyE1 medium: glucose (2%), soybean powder (0.5%), yeast extract (0.25%), K2HPO4 (0.1%), MgSO4·7HaO (0.1%), NaCl (0.3%), CaCO3 (0.3%), pH 7.5.

[0103] P1 buffer: 10 mM EDTA (pH 8.0), 50 mM Tris·Cl, 100 μg / mL RNase A, stored in a 4°C refrigerator.

[0104] P2 buffer: 200 mM NaOH, 1% SDS.

[0105] P3 buffer: 3.0 M potassium acetate, adjusted to pH 5.5, stored in a 4°C refrigerator.

[0106] TES buffer: 2-[Tris(hydroxymethyl)methylamino]-1-ethanesulfonic acid, Chinese name 2-[[Tris(hydroxymethyl)methyl]amino]ethanesulfonic acid, prepared at a concentration of 0.05M and a pH of 8.0.

[0107] The amino acid sequence and nucleotide sequence involved in the present invention are as follows:

[0108] SEQ ID NO.1: Name: Nucleotide sequence of primer tsu-up-F; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: GCGGGATGAAGGCGAACAG

[0109] SEQ ID NO.2: Name: Nucleotide sequence of primer tsu-up-R; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: ACAAGACCTCGGGCGGGTAC

[0110] SEQ ID NO.3: Name: Nucleotide sequence of primer tsu-mid-F; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: ACAGCACGTTCACCGGGACG

[0111] SEQ ID NO.4: Name: Nucleotide sequence of primer tsu-mid-R; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: TTGGGTGACAGGGCATCCGG

[0112] SEQ ID NO.5: Name: Nucleotide sequence of primer tsu-down-F; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: GGAAGTTGGCTCAGCAGGGTG

[0113] SEQ ID NO.6: Name: Nucleotide sequence of primer tsu-down-R; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: GCGCCGACCAGTTCGAGAAG

[0114] SEQ ID NO.7: Name: Nucleotide sequence of primer p15A-F; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: AGATCCGAAAACCCCAAGTTACG

[0115] SEQ ID NO.8: Name: Nucleotide sequence of primer p15A-R; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: AGATCCTTTCTCCTCTTTAGATC

[0116] SEQ ID NO.9: Name: Nucleotide sequence of primer tsuHA1-F; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: TCTAAAGAGGAGAAAGGATCTGAGTGGGGAGTGCGGCCGG

[0117] SEQ ID NO.10: Name: Nucleotide sequence of primer tsuHA1-R; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: ATCAGACGACGGTCATCCGATC

[0118] SEQ ID NO.11: Name: Nucleotide sequence of primer tsuHA2-F; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: TGACGGCGACGCGGAGCGC

[0119] SEQ ID NO.12: Name: Nucleotide sequence of primer tsuHA2-R; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: AACTTGGGGTTTTCGGATCTGTACTTCGTCCGGCTGACCC

[0120] SEQ ID NO.13: Name: Nucleotide sequence of p15A linearized fragment; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence:

[0121]

[0122] CTAAAGAGGAGAAAGGATCTGAGTGGGGAGTGCGGCCGGGAGTACGGCTGGTGGTGGAGCAG GGAGTCCGGTGACCCGGATCGGATGACCGTCGTCTGAT

[0123] SEQ ID NO.15: Name: Nucleotide sequence of homology arm HA2; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence:

[0124] TGACGGCGACGCGGAGCGCGACCCGTTCCGCCGCCCCCGTACCGCCGCTGTCGCGGTCGCGGGT CAGCCGGACGAAGTACAGATCCGAAAACCCCAAGTT

[0125] SEQ ID NO.16: Name: Nucleotide sequence of element box oriT-phi31 integrase-attP-aac(3)IV; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence:

[0126]

[0127] SEQ ID NO.17: Name: Nucleotide sequence of phi31 integrase gene; Sequence type: DNA (otherDNA); Organism source: synthetic construct. Sequence:

[0128]

[0129] SEQ ID NO.18: Name: Nucleotide sequence of primer PR1-1; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: CGACGGCCAGTGCCAAGCTTGGGCAGACCACCGACGGTCG

[0130] SEQ ID NO.19: Name: Nucleotide sequence of primer PR1-2; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: AAGGAGGCGGACATCATATGATGGACTTCCGGATACTTGG

[0131] SEQ ID NO.20: Name: Nucleotide sequence of primer PR1-3; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: CCAAGTATCCGGAAGTCCATCATATGATGTCCGCCTCCTT

[0132] SEQ ID NO.21: Name: Nucleotide sequence of primer PR1-4; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: TTTCCGTGAGCTTTCAATTGGGCGGCTTGCGCCCGATGCT

[0133] SEQ ID NO.22: Name: Nucleotide sequence of primer PR1-5; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: AGCATCGGGCGCAAGCCGCCCAATTGAAAGCTCACGGAAA

[0134] SEQ ID NO.23: Name: Nucleotide sequence of primer PR1-6; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: TATGACATGATTACGAATTCGTTGACGATGTCCTCGGCCG

[0135] SEQ ID NO.24: Name: Nucleotide sequence of the upstream fragment of the tsuR1 gene promoter; Sequence type: DNA (genomic DNA); Organism source: Streptomyces tsukubaensis L199. Sequence:

[0136]

[0137] SEQ ID NO.25: Name: Nucleotide sequence of the downstream fragment of the tsuR1 gene promoter; Sequence type: DNA (genomic DNA); Organism source: Streptomyces tsukubaensis L199. Sequence:

[0138]

[0139] SEQ ID NO.26: Name: Nucleotide sequence of promoter ermEp*; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence:

[0140] GCGGTCGATCTTGACGGCTGGCGAGAGGTGCGGGGAGGATCTGACCGACGCGGTCCACACGTG GCACCGCGATGCTGTTGTGGGCACAATCGTGCCGGTTGGTA

[0141] SEQ ID NO.27: Name: Nucleotide sequence of primer p15A-F2; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: CCGAAAGGCAGGAACAGGAG

[0142] SEQ ID NO.28: Name: Nucleotide sequence of primer p15A-R2; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: CCACAGCGCTGAGTGCATAT

[0143] SEQ ID NO.29: Name: Nucleotide sequence of primer p15A-HA1F; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: TAGGCAGTTCGCTCCAAGCT

[0144] SEQ ID NO.30: Name: Nucleotide sequence of primer p15A-HA2R; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: CCCGTAAACTCGCCCAGAAG

[0145] SEQ ID NO.31: Name: Nucleotide sequence of primer pR6K-HA1R; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: GTGTCAGAGACAACTCCAAG

[0146] SEQ ID NO.32: Name: Nucleotide sequence of primer pR6K-HA2F; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: AGAGCTGTACGAAGACCGCG

[0147] SEQ ID NO.33: Name: Nucleotide sequence of primer ermEp-inF; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: TACCAACCGGCACGATTGTG

[0148] SEQ ID NO.34: Name: Nucleotide sequence of primer ermEp-inR; Sequence type: DNA (other DNA); Organism source: synthetic construct. Sequence: GCGGTCGATCTTGACGGCTG.

Claims

1. A Tsukubabitsu heterologous expression engineered strain, characterized in that: The engineering strain uses Streptomyces albus as a host strain and expresses the tsukubabitin biosynthetic gene cluster.

2. The Tsukuba Bixing heterologous expression engineered strain according to claim 1, characterized in that: The engineered strain is constructed by introducing the tsuR1 gene cluster of the tsuR1 biosynthesis gene cluster into Streptomyces albus, and then replacing the promoter of the tsuR1 gene on the tsuR1 gene cluster with the ermEp* promoter.

3. The Tsukuba Bixing heterologous expression engineered strain according to claim 1, characterized in that: The host strain is classified and named as Streptomyces albus J1074, and the tsukubabin biosynthetic gene cluster is derived from Streptomyces tsukubaensis L199.

4. The Tsukuba Bixing heterologous expression engineered strain according to claim 1, characterized in that: The engineering strain is classified and named Streptomyces albus JM2, the preservation unit is the General Microbiology Center of China Microbiological Culture Collection Administration, the preservation number is CGMCC NO.32168, and the preservation date is October 10, 2024.

5. A method for constructing a Tsukuba Bixing heterologous expression engineered strain according to any one of claims 1 to 4, characterized in that: The following steps are involved: 1) Cloning and replacing vector elements of the tsukubabitin biosynthetic gene cluster to obtain a recombinant vector p15A-tsu containing the tsukubabitin biosynthetic gene cluster; 2) transferring the recombinant vector p15A-tsu obtained in step 1) to the host strain by conjugation to obtain an intermediate strain; 3) The promoter of the tsuR1 gene on the tsubabitsin biosynthetic gene cluster of the intermediate strain is replaced with the ermEp* promoter to obtain the engineered strain.

6. The method for constructing the Tsukuba Bixing heterologous expression engineering strain according to claim 5, characterized in that: The step 1) is specifically as follows: 1.1) Using mixed colony PCR technology, the tsukubabitin biosynthetic gene cluster was located from the BAC library of Streptomyces tsukuba through primer pairs, and then the plasmid pTSU containing the tsukubabitin biosynthetic gene cluster was obtained; 1.2) The plasmid pTSU containing the tsukuba bicin biosynthetic gene cluster and the vector containing the p15A replicon are treated by using the linear loop recombination technology, and the tsukuba bicin biosynthetic gene cluster is inserted into the vector containing the p15A replicon to obtain an intermediate plasmid containing the p15A replicon and the tsukuba bicin biosynthetic gene cluster, and the linear loop recombination technology is then used to modify the intermediate plasmid with an element box containing an integrase gene to obtain a recombinant vector p15A-tsu containing the p15A replicon, the integrase gene and the tsukuba bicin biosynthetic gene cluster.

7. The method for constructing the Tsukuba Bixing heterologous expression engineering strain according to claim 5, characterized in that: The step 2) is specifically as follows: 2.1) Introducing the recombinant vector p15A-tsu into Escherichia coli by biparental conjugation transfer technology to obtain Escherichia coli containing the recombinant vector p15A-tsu; 2.2) Using Streptomyces albus J1074 as a host strain, the recombinant vector p15A-tsu was introduced into the host strain by Escherichia coli-Streptomyces conjugation transfer technology to obtain an intermediate strain.

8. The method for constructing the Tsukuba Bixing heterologous expression engineering strain according to claim 5, characterized in that: The step 3) is specifically as follows: 3.1) amplifying the upstream fragment of the tsuR1 gene promoter and the downstream fragment of the tsuR1 gene promoter; using fusion PCR technology to combine the upstream fragment of the tsuR1 gene promoter, the downstream fragment of the tsuR1 gene promoter and the ermEp* promoter into the fragment ermEp*-HA; 3.2) using restriction endonucleases HindIII and EcoRI to digest plasmid pKC1139 to obtain a linear plasmid fragment; using seamless cloning technology to connect the linear plasmid fragment with the fragment ermEp*-HA to obtain plasmid pKC1139-ermEp*-HA; 3.3) The plasmid pKC1139-ermEp*-HA was transferred into the intermediate strain using the E. coli-Streptomyces conjugative transfer technique to obtain the engineered strain Streptomyces albus JM2.

9. Use of the Tsukuba Bixing heterologous expression engineered strain according to any one of claims 1 to 4 or the Tsukuba Bixing heterologous expression engineered strain obtained by the construction method according to any one of claims 5 to 8, characterized in that: Used for fermentation production of Tsukubabitsu.

10. A method for producing Tsukuba Bisin using the Tsukuba Bisin heterologous expression engineered strain according to any one of claims 1 to 4 or the Tsukuba Bisin heterologous expression engineered strain obtained by the construction method according to any one of claims 5 to 8, characterized in that: The method comprises the following steps: using fermentation medium to culture the tsukubabitzin heterologous expression engineering strain, culturing at 28°C for 144 hours to obtain a fermentation product, and separating tsukubabitzin from the fermentation product.

Images