Method for removing non-target nucleic acid template

Abstract

The invention provides a method for removing a non-target nucleic acid template. According to the method provided by the invention, on the basis of UDG / AAG + AP site endonuclease, incision site-dependent endonuclease or 5 '-phosphoric acid-dependent exonuclease is further added, and a non-target nucleic acid template with dU / dI is subjected to digestion treatment, so that fragments cut by glycosylase can be prevented from being repaired into a complete template in a positive and negative chain mutual overlapping manner; amplification of a non-target nucleic acid template is caused. Compared with a traditional anti-pollution system, the method provided by the invention has the advantages that polluted non-target amplified nucleic acid fragments can be thoroughly removed, the detection rate of the polluted fragments is effectively reduced, and false positive is reduced.

Description

[0001] Incorporation by Reference of Related Applications

[0002] This application claims priority to invention patent application No. 202310438086.5 filed on April 23, 2023. The entire contents are incorporated herein by reference. Technical Field

[0003] The present disclosure relates to the field of biotechnology, and in particular to a method for removing non-target nucleic acid templates. Background Art

[0004] During the PCR amplification process, PCR product fragments will diffuse in the environment through aerosols. When the second amplification experiment is performed, these aerosol fragments will be amplified as templates, which will eventually cause false positive amplification results.

[0005] At present, the main method used to prevent aerosol contamination is the combination of dUTP and UDG enzyme (Uracil DNA Glycosylase), such as the method disclosed in US Pat. No. 7,687,247B1. However, since UDG cuts dU only on one chain, the aerosol generated by amplification with lower dUTP can still be amplified after UDG treatment. In particular, in tNGS (targeted Next Generation Sequencing, such as pathogenic microorganism targeted sequencing) super multiplex PCR, the amount of dUTP added cannot be too much, otherwise it will affect the performance of multiple amplification, and adding less dUTP will result in a smaller proportion of dU on the multiple amplification products of tNGS. The fragments cut by UDG will be repaired into a complete template through the mutual overlap of positive and negative chains in the amplification after several rounds of PCR amplification, thereby causing the template contaminated by aerosol to be amplified. In other words, UDG enzyme cannot completely remove dU-containing products, and increasing the amount of UDG enzyme still cannot completely remove them. Furthermore, during tNGS sequencing, false positive results caused by aerosol contamination can still be detected. Therefore, the current method of combining dUTP with UDG enzyme cannot truly prevent aerosol contamination. Summary of the invention

[0006] The purpose of the present disclosure is to provide a method for removing non-target nucleic acid templates, including dU / dI-mediated double-strand DNA break method (UDB / IDB for short) ( Figure 1 ) and dU / dI-mediated double-stranded DNA exonuclease (UDE / IDE) ( Figure 2). The method provided by the present disclosure can achieve the purpose of completely removing non-target nucleic acid templates (contamination fragments) without affecting amplification, and this method can be applied not only to conventional PCR amplification and qPCR amplification, but also to multiple amplification in tNGS to ensure the fidelity of each result.

[0007] The first aspect of the present disclosure provides a method for removing a non-target nucleic acid template, the method comprising: adding a digestive enzyme combination to a reaction system containing a target nucleic acid template and a non-target nucleic acid template, and incubating; the digestive enzyme combination comprises a DNA glycosylase, an AP site endonuclease, and an endonuclease that recognizes a nick site, or the digestive enzyme combination comprises a DNA glycosylase, an AP site endonuclease, and a 5'-3' exonuclease that is dependent on a 5' phosphate group; the non-target nucleic acid template contains at least one of dU (deoxyuridine) or dI (deoxyinosine), and the target template does not contain dU or dI. For example, the non-target nucleic acid template contains dU, and the target nucleic acid template does not contain dU, regardless of whether the non-target nucleic acid template and the target nucleic acid template contain dI; or, the non-target nucleic acid template contains dI, and the target nucleic acid template does not contain dI, regardless of whether the non-target nucleic acid template and the target nucleic acid template contain dU. For another example, the non-target nucleic acid template contains dU but not dI, and the target nucleic acid template does not contain dU, regardless of whether the target nucleic acid template contains dI; the non-target nucleic acid template contains dI but not dU, and the target nucleic acid template does not contain dI, regardless of whether the target nucleic acid template contains dU; or, the non-target nucleic acid template contains dU and dI, and the target nucleic acid template does not contain dU and / or does not contain dI.

[0008] In some embodiments, the non-target nucleic acid template comprises a double-stranded nucleic acid. In some embodiments, the non-target nucleic acid template comprises a double-stranded DNA, and the double-stranded DNA is at least partially complementary. In some embodiments, at least one strand of the double-stranded DNA contains dU and / or dI. In some embodiments, only one strand of the double-stranded DNA contains dU and / or dI. In some embodiments, both strands of the double-stranded DNA contain dU and / or dI.

[0009] In some embodiments, the non-target nucleic acid template is from the environment, such as an aerosol, such as a sequencing chamber.

[0010] In some embodiments, the reaction system is, for example, a PCR amplification system or an isothermal amplification system.

[0011] In some embodiments, the DNA glycosylase specifically recognizes a dU or dI site and generates an apurinic / apyrimidinic site (ie, an AP site).

[0012] In some embodiments, when the non-target nucleic acid template contains dU, the DNA glycosylase in the digestive enzyme combination is uracil DNA glycosylase (Uracil DNA Glycosylase, UDG enzyme) or single-strand selective monofunctional uracil DNA glycosylase (Single-strand selective Monofunctional Uracil-DNA Glycosylase, SMUG enzyme), and the UDG enzyme or SMUG enzyme specifically recognizes the dU site and removes uracil (Uracil, dU) to produce a pyrimidine-free site.

[0013] In some embodiments, when the non-target nucleic acid template contains dI, the DNA glycosylase in the digestive enzyme combination is alkyladenine DNA glycosylase (Alkyladenine DNA Glycosylase, AAG enzyme) or endonuclease V (Endonuclease V), and the AAG enzyme or endonuclease V specifically recognizes the dI site and removes hypoxanthine (dI) to produce a purine-free site.

[0014] In some embodiments, when the non-target nucleic acid template contains dU and dI, the DNA glycosylase in the digestive enzyme combination can be two enzymes that recognize dU and dI sites, respectively, including but not limited to any combination of the DNA glycosylases listed above, such as UDG enzyme and AAG enzyme.

[0015] In some embodiments, an AP site refers to an apurinic / apyrimidinic site, a nick refers to a break in a phosphodiester bond on a damaged nucleic acid chain, and a gap refers to a loss of one or several nucleotides on a damaged nucleic acid chain.

[0016] In some embodiments, the AP site endonuclease can recognize the AP site and cut the phosphodiester bond to form a nick or a 1-base gap. The AP site endonuclease is, for example, at least one of APE1 (human apurinic / apyrimidinic endonuclease, Apurinic-Apyrimidinic Endonuclease 1), endonuclease III (Endonuclease III), endonuclease IV (Endonuclease IV), FPG (formamidopyrimidine [fapy]-DNA glycosylase, formamidopyrimidine [fapy]-DNA glycosylase), endonuclease V (Endonuclease V), endonuclease VIII (Endonuclease VIII), OGG1 (8-oxoguanine DNA glycosylase 1, 8-oxo guanine DNA glycosylase 1), T4 PDG (T4 pyrimidine DNA glycosylase, T4 pyrimidine DNA glycosylase), hNEIL1 (human endonuclease VIII-like1), and hNTHL1 (human nth like DNA glycosylase 1).

[0017] In some embodiments, the nick site recognition endonuclease can cut the DNA at the nick site to form double-stranded breaks (DSB), and the nick site recognition endonuclease is, for example, at least one of T7 Endonuclease I and Mismatch Endonuclease I.

[0018] In some embodiments, the digestive enzyme combination consisting of the DNA glycosylase, the AP site endonuclease, and the nick site recognition endonuclease cuts the contaminated DNA template into double-strand breaks ( Figure 1 ).

[0019] In some embodiments, the 5' phosphate group-dependent 5'-3' exonuclease is a 5'→3' exonuclease that specifically acts on DNA and can selectively digest double-stranded DNA phosphorylated at the 5' end along the 5'→3' direction; preferably, the 5' phosphate group-dependent 5'-3' exonuclease is, for example, lambda exonuclease.

[0020] In some embodiments, the digestion enzyme combination consisting of the DNA glycosylase, the AP site endonuclease, and the 5' phosphate group-dependent 5'-3' exonuclease digests the contaminated DNA template along the 5'→3' direction ( Figure 2 ).

[0021] In some embodiments, the incubation conditions are 30-40°C for 5-20 minutes, such as 30-38°C for 5-15 minutes, such as 32-37°C for 5-15 minutes, such as 35-37°C for 5-15 minutes, such as 35-37°C for 5-10 minutes, such as 37°C for 5-10 minutes, such as 37°C for 8-10 minutes, such as 37°C for 10 minutes.

[0022] In some embodiments, the method further comprises a step of inactivating the digestive enzyme combination, such as high temperature treatment or addition of a denaturant, such as high temperature treatment at 93-98° C. for 1-5 minutes, such as treatment at 95° C. for 2-3 minutes. In some embodiments, the high temperature treatment can be performed alone or during high temperature denaturation in PCR amplification.

[0023] In some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease IV and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease IV and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease III and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease VIII and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, FPG enzyme and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease V and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, APE1 enzyme and T7 endonuclease I; In some embodiments, the digestive enzyme combination is SMUG enzyme, APE1 enzyme and T7 endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, APE1 enzyme and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease VIII and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease III and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, APE1 enzyme and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is endonuclease V, APE1 enzyme and T7 endonuclease I; in some embodiments, the digestive enzyme combination is endonuclease V and T7 endonuclease I.

[0024] In some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease III and lambda exonuclease; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease VIII and lambda exonuclease; in some embodiments, the digestive enzyme combination is UDG enzyme, FPG enzyme and lambda exonuclease; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease III and lambda exonuclease; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease VIII and lambda exonuclease; in some embodiments, the digestive enzyme combination is SMUG enzyme, FPG enzyme and lambda exonuclease; in some embodiments, the digestive enzyme combination is endonuclease V, FPG enzyme and lambda exonuclease; in some embodiments, the digestive enzyme combination is endonuclease V, endonuclease VIII and lambda exonuclease; in some embodiments, the digestive enzyme combination is endonuclease V, endonuclease VIII and lambda exonuclease.

[0025] In some embodiments, the DNA glycosylase, AP site endonuclease and nick site recognition endonuclease in the present disclosure refer to digestive enzymes containing DNA glycosylase activity, AP site endonuclease activity and nick site recognition endonuclease activity, respectively. When a certain digestive enzyme contains two or more of the aforementioned activities, the digestive enzyme combination can be one, two or three enzymes, for example, endonuclease V has the activity of recognizing dI and cutting it into an apurinic site, and can also recognize an apurinic site and cut it to form a nick site, for example, the digestive enzyme combination can be endonuclease V and T7 endonuclease I.

[0026] In some embodiments, the DNA glycosylase, AP site endonuclease and 5'-3' exonuclease dependent on 5' phosphate group in the present disclosure refer to digestive enzymes containing DNA glycosylase activity, AP site endonuclease activity and 5'-3' exonuclease activity dependent on 5' phosphate group, respectively. When a certain digestive enzyme contains two or more of the aforementioned activities, the digestive enzyme combination can be one, two or three enzymes, for example, endonuclease V has the activity of recognizing dI and cutting it into an apurinic site, and can also recognize an apurinic site and cut it to form a nick site, for example, the digestive enzyme combination can be endonuclease V and lambda exonuclease.

[0027] In some embodiments, the combination of digestive enzymes can be a combination of any DNA glycosylase, AP site endonuclease and nick site recognition endonuclease, or a combination of any DNA glycosylase, AP site endonuclease and 5' phosphate group-dependent 5'-3' nuclease, including but not limited to the digestive enzyme combinations listed in the preceding section.

[0028] In some embodiments, the digestive enzyme combination comprises a combination of at least 1U of DNA glycosylase, 5U of AP site endonuclease, and 0.8U of nick site recognition endonuclease, or the digestive enzyme combination comprises at least 1U of DNA glycosylase, 2.5U of AP site endonuclease, and 5U of 5' phosphate group-dependent 5'-3' exonuclease, for example, for each ng of DNA template.

[0029] In some embodiments, the digestive enzyme combination comprises a combination of at least 1U of DNA glycosylase, 5U of AP site endonuclease, and 1U of nick site recognition endonuclease, or, the digestive enzyme combination comprises at least 2U of DNA glycosylase, 5U of AP site endonuclease, and 10U of 5' phosphate group-dependent 5'-3' exonuclease, for example, for each ng of DNA template.

[0030] In some embodiments, the digestive enzyme combination comprises a combination of up to 4 U of DNA glycosylase, 20 U of an AP site endonuclease, and 10 U of a nick site recognition endonuclease, or, the digestive enzyme combination comprises up to 4 U of a DNA glycosylase, 10 U of an AP site endonuclease, and 40 U of a 5' phosphate group-dependent 5'-3' exonuclease, for example, per ng of DNA template.

[0031] In some embodiments, the digestive enzyme combination comprises a combination of up to 2U of a DNA glycosylase, 10U of an AP site endonuclease, and 5U of a nick site recognizing endonuclease, or, the digestive enzyme combination comprises up to 2U of a DNA glycosylase, 5U of an AP site endonuclease, and 20U of a 5' phosphate group-dependent 5'-3' exonuclease, for example, for each ng of DNA template.

[0032] In some embodiments, the amount of the digestive enzyme combination used in the present disclosure is in excess relative to the non-target nucleic acid template. In some embodiments, the excess of each enzyme in the digestive enzyme combination is independently at least 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more times its recommended amount above.

[0033] A second aspect of the present disclosure provides a method for removing non-target nucleic acid templates in PCR amplification, the method comprising:

[0034] (1) preparing a PCR amplification reaction system containing a target nucleic acid template and a non-target nucleic acid template, wherein the reaction system further comprises: a DNA polymerase, a primer, a buffer substance, a metal salt, a mixture of dNTPs and a digestive enzyme combination, wherein the dNTPs include dATP, dGTP, dCTP and dTTP, and also include at least one of dUTP (deoxyuridine triphosphate) and dITP (deoxyinosine triphosphate); the digestive enzyme combination includes a DNA glycosylase, an AP site endonuclease and an endonuclease that recognizes a nick site, or the digestive enzyme combination includes a DNA glycosylase, an AP site endonuclease and a 5'-3' exonuclease that is dependent on a 5' phosphate group; the non-target nucleic acid template contains at least one of dU (deoxyuridine) or dI (deoxyinosine), and the target nucleic acid template does not contain dU or dI;

[0035] (2) incubation;

[0036] (3) Perform an amplification reaction under appropriate conditions.

[0037] In some embodiments, the non-target nucleic acid template comprises double-stranded DNA. In some embodiments, the double-stranded DNA is at least partially complementary. In some embodiments, at least one strand of the double-stranded DNA contains dU and / or dI. In some embodiments, only one strand of the double-stranded DNA contains dU and / or dI. In some embodiments, both strands of the double-stranded DNA contain dU and / or dI.

[0038] In some embodiments, the non-target nucleic acid template contains dU, and the target nucleic acid template does not contain dU, regardless of whether the non-target nucleic acid template and the target nucleic acid template contain dI; or, the non-target nucleic acid template contains dI, and the target nucleic acid template does not contain dI, regardless of whether the non-target nucleic acid template and the target nucleic acid template contain dU. In some embodiments, the non-target nucleic acid template contains dU and does not contain dI, and the target nucleic acid template does not contain dU, regardless of whether the target nucleic acid template contains dI; the non-target nucleic acid template contains dI and does not contain dU, and the target nucleic acid template does not contain dI, regardless of whether the target nucleic acid template contains dU; or, the non-target nucleic acid template contains dU and contains dI, and the target nucleic acid template does not contain dU and / or does not contain dI.

[0039] In some embodiments, the non-target nucleic acid template is from the environment, such as an aerosol, such as a sequencing chamber.

[0040] In some embodiments, when the non-target nucleic acid template contains dU, the DNA glycosylase in the digestive enzyme combination is uracil DNA glycosylase (Uracil DNA Glycosylase, UDG enzyme) or single-strand selective monofunctional uracil DNA glycosylase (Single-strand selective Monofunctional Uracil-DNA Glycosylase, SMUG enzyme), and the UDG enzyme or SMUG enzyme specifically recognizes the dU site and removes uracil (Uracil, dU) to produce a pyrimidine-free site.

[0041] In some embodiments, when the non-target nucleic acid template contains dI, the DNA glycosylase in the digestive enzyme combination is alkyladenine DNA glycosylase (Alkyladenine DNA Glycosylase, AAG enzyme) or endonuclease V (Endonuclease V), and the AAG enzyme or endonuclease V specifically recognizes the dI site and removes hypoxanthine (dI) to produce a purine-free site.

[0042] In some embodiments, when the non-target nucleic acid template contains dU and dI, the DNA glycosylase in the digestive enzyme combination can be two enzymes that recognize dU and dI sites, respectively, including but not limited to any combination of the DNA glycosylases listed above, such as UDG enzyme and AAG enzyme.

[0043] In some embodiments, the AP site endonuclease can recognize the AP site and cut the phosphodiester bond to form a nick or a 1-base gap. The AP site endonuclease is, for example, at least one of APE1 (human apurinic / apyrimidinic endonuclease, Apurinic-Apyrimidinic Endonuclease 1), endonuclease III (Endonuclease III), endonuclease IV (Endonuclease IV), FPG (formamidopyrimidine [fapy] -DNA glycosylase, formamidopyrimidine [fapy] -DNA glycosylase), endonuclease V (Endonuclease V), endonuclease VIII (Endonuclease VIII), OGG1 (8-oxoguanine DNA glycosylase 1, 8-oxo guanine DNA glycosylase 1), T4 PDG (T4 pyrimidine DNA glycosylase, T4 pyrimidine DNA glycosylase), hNEIL1 (human endonuclease VIII-like1), and hNTHL1 (human nth like DNA glycosylase 1).

[0044] In some embodiments, the nick site recognition endonuclease can cut the DNA at the nick site to form double-stranded breaks (DSB), and the nick site recognition endonuclease is, for example, at least one of T7 Endonuclease I and Mismatch Endonuclease I.

[0045] In some embodiments, the 5' phosphate group-dependent 5'-3' exonuclease is a 5'→3' exonuclease that specifically acts on DNA and can selectively digest double-stranded DNA phosphorylated at the 5' end along the 5'→3' direction; preferably, the 5' phosphate group-dependent 5'-3' exonuclease is, for example, lambda exonuclease.

[0046] In some embodiments, the dUTP / dTTP=1 / N or the dITP / dGTP=1 / N, wherein N is a constant greater than zero, such as 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20; preferably, N is a constant greater than or equal to 1; more preferably, N is a constant greater than or equal to 3; most preferably, N is a constant greater than or equal to 5. Optionally, N is less than 1000 or 999, 500 or 499, 100 or 99, 50 or 49, 25 or 24, 10 or 9, 5 or 4.

[0047] In some embodiments, the DNA polymerase is a thermostable DNA polymerase, preferably Taq DNA polymerase. In some embodiments, the DNA polymerase is a DNA polymerase compatible with dUTP and / or dITP substrates.

[0048] In some embodiments, the primers comprise at least a pair of an upstream primer and a downstream primer.

[0049] In some embodiments, the metal salt comprises Mg 2+ Salt, K + Salt, Mn 2+ Salt, Na + Salt, Co 2+ Salt and Ca 2+ One or more salts.

[0050] In some embodiments, the buffer substance includes one or more of Tris, Tris-HCl, Tris base, or HEPES.

[0051] In some embodiments, the incubation conditions of step (2) are 30-40°C for 5-20 minutes, for example 30-38°C for 5-15 minutes, for example 32-37°C for 5-15 minutes, for example 35-37°C for 5-15 minutes, for example 35-37°C for 5-10 minutes, for example 37°C for 5-10 minutes, for example 37°C for 8-10 minutes, for example 37°C for 10 minutes.

[0052] In some embodiments, the amplification reaction of step (3) includes the steps of denaturation, annealing and extension; preferably includes preliminary denaturation, denaturation, annealing, extension and complete extension.

[0053] In some embodiments, the pre-denaturation and / or pre-denaturation is high-temperature denaturation at 95°C, and the digestive enzyme is denatured and inactivated at high temperature.

[0054] In some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease IV and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease IV and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease III and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease VIII and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, FPG enzyme and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease V and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, APE1 enzyme and T7 endonuclease I; In some embodiments, the digestive enzyme combination is SMUG enzyme, APE1 enzyme and T7 endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, APE1 enzyme and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease VIII and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease III and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, APE1 enzyme and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is endonuclease V, APE1 enzyme and T7 endonuclease I; in some embodiments, the digestive enzyme combination is endonuclease V and T7 endonuclease I.

[0055] In some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease III and lambda exonuclease; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease VIII and lambda exonuclease; in some embodiments, the digestive enzyme combination is UDG enzyme, FPG enzyme and lambda exonuclease; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease III and lambda exonuclease; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease VIII and lambda exonuclease; in some embodiments, the digestive enzyme combination is SMUG enzyme, FPG enzyme and lambda exonuclease; in some embodiments, the digestive enzyme combination is endonuclease V, FPG enzyme and lambda exonuclease; in some embodiments, the digestive enzyme combination is endonuclease V, endonuclease VIII and lambda exonuclease; in some embodiments, the digestive enzyme combination is endonuclease V, endonuclease VIII and lambda exonuclease.

[0056] In some embodiments, the combination of digestive enzymes can be a combination of any DNA glycosylase, AP site endonuclease and nick site recognition endonuclease, or a combination of any DNA glycosylase, AP site endonuclease and 5' phosphate group-dependent 5'-3' nuclease, including but not limited to the digestive enzyme combinations listed in the preceding section.

[0057] In some embodiments, the target nucleic acid template is a DNA template.

[0058] In some embodiments, the usage amount of the digestive enzyme combination is at least 1U of DNA glycosylase, 5U of AP site endonuclease and 0.8U of nick site recognition endonuclease per ng of DNA template; preferably, the usage amount of the digestive enzyme combination is at least 1U of DNA glycosylase, 5U of AP site endonuclease and 1U of nick site recognition endonuclease per ng of DNA template.

[0059] In some embodiments, the digestive enzyme combination is used in an amount of at least 1U of DNA glycosylase, 5U of AP site endonuclease, and 0.8U of 5' phosphate group-dependent 5'-3' exonuclease per ng of DNA template; preferably, the digestive enzyme combination is used in an amount of at least 1U of DNA glycosylase, 2.5U of AP site endonuclease, and 5U of 5' phosphate group-dependent 5'-3' exonuclease per ng of DNA template.

[0060] In some embodiments, the usage amount of the digestion enzyme combination is at least 1U of SMUG enzyme, 5U of endonuclease IV and 0.8U of mismatch endonuclease I per ng DNA template; preferably, the usage amount of the digestion enzyme combination is at least 1U of SMUG enzyme, 5U of endonuclease IV and 1U of mismatch endonuclease I per ng DNA template.

[0061] In some embodiments, the usage amount of the digestion enzyme combination is at least 1U of UDG enzyme, 5U of APE1 enzyme and 0.8U of T7 endonuclease I per ng DNA template; preferably, the usage amount of the digestion enzyme combination is at least 1U of UDG enzyme, 5U of APE1 enzyme and 1U of T7 endonuclease I per ng DNA template.

[0062] In some embodiments, the digestive enzyme combination is used in an amount of at least 1U of UDG enzyme, 2.5U of endonuclease III and 5U of λ exonuclease per ng DNA template; preferably, the digestive enzyme combination is used in an amount of at least 2U of UDG enzyme, 5U of endonuclease III and 10U of λ exonuclease per ng DNA template.

[0063] In some embodiments, the digestive enzyme combination is used in an amount of at least 1U of SMUG enzyme, 2.5U of endonuclease VIII and 5U of λ exonuclease per ng DNA template; preferably, the digestive enzyme combination is used in an amount of at least 2U of SMUG enzyme, 5U of endonuclease VIII and 10U of λ exonuclease per ng DNA template.

[0064] In one embodiment, the combination of DNA glycosylase, AP site endonuclease and nick site recognition endonuclease is provided in a ratio of 0.5-1.5U:3-7U:0.5-10U, for example 0.75-1.25U:4-6U:0.7-5U, for example 0.9-1.1U:4.5-5.5U:0.6-2U, for example 1U:5U:0.8-1U.

[0065] In one embodiment, the combination of DNA glycosylase, AP site endonuclease and 5' phosphate group dependent 5'-3' exonuclease is provided in a ratio of 0.5-1.5U:1.5-3.5U:3-7U, such as 0.75-1.25U:2-3U:4-6U, such as 1U:2.5U:5U.

[0066] In some embodiments, the amount of the digestive enzyme combination used in the present disclosure is in excess relative to the non-target nucleic acid template. In some embodiments, the excess of each enzyme in the digestive enzyme combination is independently at least 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more times its recommended amount above.

[0067] In some embodiments, the PCR amplification reaction system further includes a probe and / or a fluorescent dye, such as a Taqman fluorescent probe and / or a SYBR Green fluorescent dye.

[0068] A third aspect of the present disclosure provides a method for constructing an amplicon library, the method comprising:

[0069] (1) obtaining a DNA sample to be tested as a target nucleic acid template and obtaining a specific primer pair for amplifying the target region as a primer;

[0070] (2) performing PCR amplification using the method described in the second aspect;

[0071] (3) optionally, purifying or not purifying the amplification product;

[0072] (4) adding primers with sequencing adapter sequences and obtaining nucleic acid fragments with adapters by PCR amplification;

[0073] (5) Optionally, purify the amplified product.

[0074] In some embodiments, the specific primer pair for amplifying the target region comprises at least one pair of an upstream primer and a downstream primer.

[0075] In some embodiments, the primers with sequencing adapter sequences include a first primer with a first adapter sequence and a second primer with a second adapter sequence.

[0076] In some embodiments, the adapter sequence is a sequencing matrix-related sequence used by current or future sequencing platforms (including but not limited to iontorrent platform, illumina platform and BGI platform).

[0077] In some embodiments, the first adapter sequence is a P5 adapter sequence of the Illumina platform, and the second adapter sequence is a P7 adapter sequence of the Illumina platform, or vice versa.

[0078] In some embodiments, the first adapter sequence is a P1 adapter sequence of an ion torrent platform and the second adapter sequence is an A adapter of an ion torrent platform, or vice versa.

[0079] In some embodiments, the first adapter sequence is an upstream splint sequence for single-end tag library construction of the MGI platform, and the second adapter sequence is a downstream splint sequence for single-end tag library construction of the MGI platform, or vice versa. In some embodiments, the first adapter sequence is an upstream splint sequence for double-end tag library construction of the MGI platform, and the second adapter sequence is a downstream splint sequence for double-end tag library construction of the MGI platform, or vice versa.

[0080] In some embodiments, the primer with sequencing adapter sequence further comprises an index sequence. In some embodiments, the index sequence is, for example, 6-8 bases, preferably 8 bases.

[0081] In some embodiments, the first primer is an N5 primer and the second primer is an N7 primer, or vice versa.

[0082] In some embodiments, the purification step uses a magnetic bead method, a high salt precipitation method, a centrifugal column method or a phenol-chloroform extraction method, preferably a magnetic bead method.

[0083] A fourth aspect of the present disclosure provides a method for constructing a pathogen targeted sequencing library, the method comprising:

[0084] (1) obtaining a DNA sample to be tested as a target nucleic acid template, wherein the DNA sample is from a host and a pathogenic microorganism; obtaining a specific primer pair for amplifying a target region of a target pathogenic microorganism as a primer;

[0085] (2) The library is constructed using the method described in the third aspect.

[0086] In some embodiments, the host is, for example, a human, and the pathogenic microorganism is, for example, one or more of a fungus, a bacterium, a virus, a spirochete, a mycoplasma, a rickettsia, a chlamydia, a prion, and a parasite.

[0087] A fifth aspect of the present disclosure provides a method for detecting pathogenic microorganisms based on tNGS, the method comprising:

[0088] (1) constructing a library using the method of the fourth aspect;

[0089] (2) Sequencing on a machine.

[0090] A sixth aspect of the present disclosure provides application of the methods described in the first aspect and the second aspect in nucleic acid amplification contamination prevention.

[0091] A seventh aspect of the present disclosure provides a kit for implementing the methods described in the first and second aspects.

[0092] In one embodiment, the kit of the present disclosure comprises the digestive enzyme combination reagent of the present disclosure, i.e., a combination of DNA glycosylase, AP site endonuclease and nick site recognition endonuclease, or a combination of DNA glycosylase, AP site endonuclease and 5' phosphate group-dependent 5'-3' nuclease.

[0093] In some embodiments, when the non-target nucleic acid template contains dU, the DNA glycosylase in the digestive enzyme combination is uracil DNA glycosylase (Uracil DNA Glycosylase, UDG enzyme) or single-strand selective monofunctional uracil DNA glycosylase (Single-strand selective Monofunctional Uracil-DNA Glycosylase, SMUG enzyme), and the UDG enzyme or SMUG enzyme specifically recognizes the dU site and removes uracil (Uracil, dU) to produce a pyrimidine-free site.

[0094] In some embodiments, when the non-target nucleic acid template contains dI, the DNA glycosylase in the digestive enzyme combination is alkyladenine DNA glycosylase (Alkyladenine DNA Glycosylase, AAG enzyme) or endonuclease V (Endonuclease V), and the AAG enzyme or endonuclease V specifically recognizes the dI site and removes hypoxanthine (dI) to produce a purine-free site.

[0095] In some embodiments, when the non-target nucleic acid template contains dU and dI, the DNA glycosylase in the digestive enzyme combination can be two enzymes that recognize dU and dI sites, respectively, including but not limited to any combination of the DNA glycosylases listed above, such as UDG enzyme and AAG enzyme.

[0096] In some embodiments, the AP site endonuclease can recognize the AP site and cut the phosphodiester bond to form a nick or a 1-base gap. The AP site endonuclease is, for example, at least one of APE1 (human apurinic / apyrimidinic endonuclease, Apurinic-Apyrimidinic Endonuclease 1), endonuclease III (Endonuclease III), endonuclease IV (Endonuclease IV), FPG (formamidopyrimidine [fapy]-DNA glycosylase, formamidopyrimidine [fapy]-DNA glycosylase), endonuclease V (Endonuclease V), endonuclease VIII (Endonuclease VIII), OGG1 (8-oxoguanine DNA glycosylase 1, 8-oxo guanine DNA glycosylase 1), T4 PDG (T4 pyrimidine DNA glycosylase, T4 pyrimidine DNA glycosylase), hNEIL1 (human endonuclease VIII-like1), and hNTHL1 (human nth like DNA glycosylase 1).

[0097] In some embodiments, the nick site recognition endonuclease can cut the DNA at the nick site to form double-stranded breaks (DSB), and the nick site recognition endonuclease is, for example, at least one of T7 Endonuclease I and Mismatch Endonuclease I.

[0098] In some embodiments, the 5' phosphate group-dependent 5'-3' exonuclease is a 5'→3' exonuclease that specifically acts on DNA and can selectively digest double-stranded DNA phosphorylated at the 5' end along the 5'→3' direction; preferably, the 5' phosphate group-dependent 5'-3' exonuclease is, for example, lambda exonuclease.

[0099] In some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease IV and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease IV and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease III and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease VIII and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, FPG enzyme and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease V and T7 endonuclease I; in some embodiments, the digestive enzyme combination is UDG enzyme, APE1 enzyme and T7 endonuclease I; In some embodiments, the digestive enzyme combination is SMUG enzyme, APE1 enzyme and T7 endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, APE1 enzyme and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease VIII and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease III and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is SMUG enzyme, APE1 enzyme and mismatch endonuclease I; in some embodiments, the digestive enzyme combination is endonuclease V, APE1 enzyme and T7 endonuclease I; in some embodiments, the digestive enzyme combination is endonuclease V and T7 endonuclease I.

[0100] In some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease III and lambda exonuclease; in some embodiments, the digestive enzyme combination is UDG enzyme, endonuclease VIII and lambda exonuclease; in some embodiments, the digestive enzyme combination is UDG enzyme, FPG enzyme and lambda exonuclease; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease III and lambda exonuclease; in some embodiments, the digestive enzyme combination is SMUG enzyme, endonuclease VIII and lambda exonuclease; in some embodiments, the digestive enzyme combination is SMUG enzyme, FPG enzyme and lambda exonuclease; in some embodiments, the digestive enzyme combination is endonuclease V, FPG enzyme and lambda exonuclease; in some embodiments, the digestive enzyme combination is endonuclease V, endonuclease VIII and lambda exonuclease; in some embodiments, the digestive enzyme combination is endonuclease V, endonuclease VIII and lambda exonuclease.

[0101] In some embodiments, the DNA glycosylase, AP site endonuclease and nick site recognition endonuclease in the present disclosure refer to digestive enzymes containing DNA glycosylase activity, AP site endonuclease activity and nick site recognition endonuclease activity, respectively. When a certain digestive enzyme contains two or more of the aforementioned activities, the digestive enzyme combination can be one, two or three enzymes, for example, endonuclease V has the activity of recognizing dI and cutting it into an apurinic site, and can also recognize an apurinic site and cut it to form a nick site, for example, the digestive enzyme combination can be endonuclease V and T7 endonuclease I.

[0102] In some embodiments, the DNA glycosylase, AP site endonuclease and 5'-3' exonuclease dependent on 5' phosphate group in the present disclosure refer to digestive enzymes containing DNA glycosylase activity, AP site endonuclease activity and 5'-3' exonuclease activity dependent on 5' phosphate group, respectively. When a certain digestive enzyme contains two or more of the aforementioned activities, the digestive enzyme combination can be one, two or three enzymes, for example, endonuclease V has the activity of recognizing dI and cutting it into an apurinic site, and can also recognize an apurinic site and cut it to form a nick site, for example, the digestive enzyme combination can be endonuclease V and lambda exonuclease.

[0103] In some embodiments, the combination of digestive enzymes can be a combination of any DNA glycosylase, AP site endonuclease and nick site recognition endonuclease, or a combination of any DNA glycosylase, AP site endonuclease and 5' phosphate group-dependent 5'-3' nuclease, including but not limited to the digestive enzyme combinations listed in the preceding section.

[0104] In one embodiment, the digestive enzyme combination agent of the present disclosure is a single composition, ie, the digestive enzyme combination of the present disclosure is provided in a single composition. In one embodiment, multiple compositions of the digestive enzyme combination agent of the present disclosure, ie, the digestive enzyme combination of the present disclosure is provided in separate compositions.

[0105] In one embodiment, the combination of DNA glycosylase, AP site endonuclease and nick site recognition endonuclease is provided in a ratio of 0.5-1.5U:3-7U:0.5-10U, for example 0.75-1.25U:4-6U:0.7-5U, for example 0.9-1.1U:4.5-5.5U:0.6-2U, for example 1U:5U:0.8-1U.

[0106] In one embodiment, the combination of DNA glycosylase, AP site endonuclease and 5' phosphate group dependent 5'-3' exonuclease is provided in a ratio of 0.5-1.5U:1.5-3.5U:3-7U, such as 0.75-1.25U:2-3U:4-6U, such as 1U:2.5U:5U.

[0107] In some embodiments, the amount of one or more enzymes in the digestive enzyme combination agents of the present disclosure is in excess relative to the remaining enzymes. In some embodiments, the excess of each enzyme in the digestive enzyme combination agent is independently at least 1.5, 2, 2.5, 3, 3.5, 4, 4.5, 5, 5.5, 6, 6.5, 7, 7.5, 8, 8.5, 9, 9.5, 10, 15, 20, 25, 30, 35, 40, 45, 50 or more times its recommended amount above.

[0108] In one embodiment, the kit of the present disclosure comprises a dNTP reagent, the dNTP reagent comprises dATP, dGTP, dCTP and dTTP, and comprises at least one of dUTP and dITP. In one embodiment, dUTP / dTTP=1 / N or dITP / dGTP=1 / N, wherein N is a constant greater than zero, such as 0.1, 0.2, 0.3, 0.4, 0.5, 0.6, 0.7, 0.8, 0.9, 1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19 and 20; preferably, N is a constant greater than or equal to 1; more preferably, N is a constant greater than or equal to 3; most preferably, N is a constant greater than or equal to 5. Optionally, N is less than 1000 or 999, 500 or 499, 100 or 99, 50 or 49, 25 or 24, 10 or 9, 5 or 4.

[0109] In one embodiment, the kit of the present disclosure comprises other reagents required for implementing the methods described in the first and second aspects of the present disclosure, such as one or more of DNA polymerase, primers, buffer substances, and metal salts.

[0110] The present disclosure provides the above-mentioned digestive enzyme combination reagent and / or dNTP reagent, and use thereof in implementing the methods described in the first and second aspects of the present disclosure and / or preparing the kit described in the seventh aspect of the present disclosure. BRIEF DESCRIPTION OF THE DRAWINGS

[0111] Figure 1 : Schematic diagram of the dU / dI-mediated double-strand DNA break method;

[0112] Figure 2 : Schematic diagram of dU / dI-mediated double-stranded DNA exonuclease;

[0113] Figure 3 :The effect of adding different ratios of dUTP on the sequencing results after library amplification;

[0114] Figure 4 :Detection rate of pathogen panel with different ratios of dUTP added in multiplex amplification of tNGS;

[0115] Figure 5A :The effect of different ratios of dUTP on agarose gel electrophoresis results in a single fragment model;

[0116] Figure 5B :The effect of different ratios of dUTP on agarose gel electrophoresis results in the ladder model;

[0117] Figure 6 : Comparison of the anti-contamination effects of UDG enzyme, User enzyme and digestive enzyme combination 1 in PCR test;

[0118] Figure 7 : qPCR test of the anti-pollution effect of UDG enzyme, User enzyme and digestion enzyme combination 1;

[0119] Figure 8 : The proportion of E. coli data in library sequencing results;

[0120] Fig. 9 : Results of pathogen panel detection rate after treatment with digestive enzyme combination 1 in tNGS;

[0121] Fig.10 : Comparison of the anti-contamination effects of UDG enzyme, User enzyme and digestive enzyme combination 2 in PCR test;

[0122] Fig.11 : qPCR test of the anti-pollution effect of UDG enzyme and digestion enzyme combination 3;

[0123] Fig.12 : qPCR test of the anti-pollution effect of UDG enzyme, User enzyme and digestion enzyme combination 4;

[0124] Figure 13-16 : The upstream and downstream primer sequences of the 207-plex pathogen panel (pathogen panel: a combination of primer pairs for targeted amplification of pathogens; 207-plex: 207 pairs of primers);

[0125] Fig.17 : qPCR test of the anti-pollution effect of UDG enzyme, User enzyme and digestion enzyme combination 5;

[0126] Fig.18 : qPCR test of the anti-contamination effect of UDG enzyme, User enzyme and digestion enzyme combination 6-12. DETAILED DESCRIPTION

[0127] The technical solution of the present disclosure is further illustrated below in conjunction with the accompanying drawings and through specific implementation methods. However, the following embodiments are merely simple examples of the present disclosure and do not represent or limit the scope of protection of the present disclosure. The scope of protection of the present disclosure shall be subject to the claims.

[0128] In the following reference examples and embodiments, unless otherwise specified, all reagents and consumables used are purchased from conventional reagent manufacturers in the field; unless otherwise specified, all experimental methods and technical means used are conventional methods and means in the field.

[0129] Reference Example 1

[0130] 50ng 293FT gDNA was used as a sample for library construction, and Vazyme#TD501 was used for shearing. The sheared gDNA was end-repaired and PCR enriched using universal short primers (upstream primer TD Fwd is SEQ ID NO.1: TCGTCGGCAGCGTCAGATG, downstream primer TD Down is SEQ ID NO.2: GTCTCGTGGGCTCGGAGAT); then different proportions of dUTP were added to the 6 groups of amplification systems, namely: only dUTP was added, only dTTP was added, dUTP / dTTP=1 / 1, dUTP / dTTP=1 / 2, dUTP / dTTP=1 / 3, dUTP / dTTP=1 / 4, and amplification was performed using a dUTP-compatible library amplification enzyme (Vazyme#P507) and Vazyme#TD202 Index primers, and the amplified library was sequenced on the machine. The sequencing results are shown in Figure 2. Figure 3 shown.

[0131] like Figure 3 As shown in the figure, adding dUTP during library amplification will increase the GC ratio and duplicate rate, while reducing the mapping rate, coverage and unique rate. In particular, as the proportion of added dUTP increases, this difference becomes more obvious. That is, adding dUTP during library amplification will affect the amplification of the library, leading to an increase in the GC ratio and changing the authenticity of the library.

[0132] Reference Example 2

[0133] Prepare a mixed nucleic acid template, which contains 10 pathogenic nucleic acids and human nucleic acids (the pathogen types are shown in Table 1. Specifically, the preparation of the mixed nucleic acid template is to mix the 10 pathogenic nucleic acids in equal mass and further mix them with human gDNA, 1000ng human genome mixed with 1ng pathogenic mixed nucleic acid). Add 1ng of the prepared mixed template and use Vazyme#NA301 with pathogen panel (207-plex, sequence as Figure 13-16 Multiplex amplification was performed.

[0134] Table 1

[0135]

[0136]

[0137] Different ratios of dUTP were added to the 6 groups of multiplex amplification systems, namely: only dTTP, dUTP / dTTP=1 / 1, dUTP / dTTP=1 / 2, dUTP / dTTP=1 / 3, dUTP / dTTP=1 / 4, dUTP / dTTP=1 / 5. The amplification process was carried out according to the Vazyme#NA301 instruction manual to obtain the first round of amplification products. The products of the first round of multiplex amplification were recovered using magnetic beads (Vazyme#N411), and the products of the first round of amplification were further subjected to the second round of adapter amplification using Vazyme#N616 high-fidelity enzyme. The dUTP addition ratio of each group in the second round of amplification system was the same as that in the first round, and the primer used was Vazyme#TD202. The amplified library was sequenced on the machine, and the results are as follows: Figure 4 shown.

[0138] Figure 4 The results show the detection rate of 207 heavy pathogen panels in tNGS (each set of data was normalized to 20M, a single panel with reads greater than 50 was considered detected, and the detection rate of the panel = the number of detected panels / the total number of panels, i.e., 207). The results show that the addition of dUTP in the multiplex system affects the detection of the panel, and the detection rate of the pathogen panel gradually decreases with the increase in the proportion of added dUTP.

[0139] Reference Example 3

[0140] 1. First amplification

[0141] In order to test the removal efficiency of the traditional dUTP+UDG anti-pollution method, an amplification system (Vazyme#P507) containing 7*2 groups of different dUTP (only dUTP added, only dTTP added, dUTP / dTTP=1 / 1, dUTP / dTTP=1 / 2, dUTP / dTTP=1 / 3, dUTP / dTTP=1 / 4, dUTP / dTTP=1 / 5) was first set up, and the UDG enzyme (Vazyme#P051) was used for treatment at 25°C for 10 minutes before amplification or without treatment.

[0142] 1 ng of Staphylococcus aureus DNA was used as a template to amplify the single fragment model (the single fragment upstream primer T1-Fwd is SEQ ID NO.3: AGAGGCGATAAACGTGTCGAG, and the single fragment downstream primer T1-Down is SEQ ID NO.4: TGTTTGCCCAAATACGACCA); 1 ng of human 293TgDNA was used as a template to amplify the Ladder model (the Ladder upstream primer L1-L9 Fwd is SEQ ID NO.5-13, and the Ladder upstream primer L1-L9 Down is SEQ ID NO.14-22), and amplification was performed according to the amplification program in the table below to obtain the corresponding amplification products.

[0143]

[0144]

[0145] (Note: The digestive enzyme in the reaction system will be inactivated at high temperatures during the amplification process to avoid affecting subsequent reactions, the same below.)

[0146]

[0147] 2. Second Amplification

[0148] Further, 1 ng of the above amplified product was taken as a template for the second amplification, and the first amplification step was repeated. The second amplification system and reaction procedure were the same as the first. The agarose gel electrophoresis results of the obtained second amplified product were as follows: Figure 5A-5B shown.

[0149] like Figure 5A As shown in the figure, in the single-fragment model, the product amplified in the system of all U and dUTP / dTTP=1 / 1 as a template cannot be further amplified after being treated with UDG enzyme. In the system with a dUTP / dTTP ratio of 1 / 3 to 1 / 5, the first round of amplification products can still be amplified after being treated with UDG enzyme. And as the dUTP ratio decreases, the band of the template amplified becomes brighter. Figure 5B As shown, in the Ladder model, we found that the length of the fragment affects the effect of the removal. The longer the fragment, the easier it is to be removed. The reason is that the longer the fragment, the greater the proportion of dU carried by the fragment, so more fragments are cut off and it is more difficult to repair them into complete fragments. In many application scenarios, such as multiple amplification of qPCR and tNGS, the fragments of the amplicon are relatively small. In order to ensure the anti-contamination effect, a higher proportion of dUTP is required so that UDG can remove aerosol contamination; combined with the results of Reference Example 2, it can be seen that when a higher proportion of dUTP is used, the efficiency of multiple amplification will be affected, reducing the detection of pathogens.

[0150] Example 1

[0151] 1. First amplification

[0152] The new anti-fouling method was tested in a system with a dUTP / dTTP ratio of 1 / 5.

[0153] Prepare digestive enzyme combination 1: 2U of SMUG (NEB#M0336S), 10U of Endonuclease IV (NEB#M0304S) and 5U of Mismatch Endonuclease I (NEB#M0678S) mixed in 1 μL system.

[0154] The UDG enzyme used was Vazyme#P051, and the mixed enzymes USERⅠ-Ⅲ were: mixed enzymes USERⅠ (UDG and Endonuclease VIII, NEB#M5505S), USERⅡ (UDG and EndonucleaseⅢ, NEB#M5508S) and USERⅢ (AfuUDG and Endonuclease IV; NEB#M5509S); SYBR-Green (Invitrogen#S7585).

[0155] 1 ng of Staphylococcus aureus DNA was used as a template, and the amplification system of Vazyme#P507 was used. First, 2*6 groups of amplification systems with different dUTP (full dTTP and dUTP / dTTP=1 / 5) were set up, without any treatment, 2U of UDG enzyme treatment (25°C, treatment for 10 min), 1 μL of digestion enzyme combination 1 treatment (37°C, treatment for 5 min), and 2U of USERⅠ-Ⅲ enzyme treatment (25°C, treatment for 10 min). Amplify a single fragment (upstream primer T1-Fwd is SEQ ID NO.3, downstream primer T1-Down is SEQ ID NO.4), and obtain the first round of amplification products. The reaction system and amplification procedure refer to the Vazyme#P507 manual.

[0156] 2. Second Amplification

[0157] Further, 1 ng of the aforementioned amplified product was added as a template, and the first amplification step was repeated. The second amplification system and procedure were the same as the first amplification to obtain the second amplified product, and the amplified products were respectively detected by agarose gel electrophoresis; the CT value and clearance rate of the product after the digestive enzyme combination treatment were detected by qPCR (SYBR-Green (Invitrogen #S7585) was added to the amplification system and used according to the product manual). The results are as follows: Figure 6-7 shown.

[0158] like Figure 6As shown, the template amplified in the amplification system of dUTP / dTTP=1 / 5 cannot be re-amplified after being treated with digestion enzyme combination 1, but can still be amplified after being treated with UDG enzyme. USERⅠ-Ⅲ enzymes cannot completely remove dU-containing fragments, but can still be amplified after treatment. In addition, the amplification efficiency of digestion enzyme combination 1 and the control in the system of all dTTP is consistent, indicating that digestion enzyme combination 1 itself does not affect amplification and can more thoroughly remove dU-containing templates.

[0159] like Figure 7 As shown, the results of qPCR showed that the CT value of the dU-containing fragments was reduced by 15 after treatment with digestive enzyme combination 1. By calculating the clearance efficiency (clearance rate = 1-2^(△CT)), the results showed that the clearance efficiency after treatment with digestive enzyme combination 1 reached 100%, and the clearance efficiency after treatment with UDG and USERⅠ-Ⅲ enzymes was about 98%; it also showed that digestive enzyme combination 1 has a better anti-pollution effect.

[0160] Example 2

[0161] The ability of digestive enzyme combination 1 (configuration is the same as in Example 1) and UDG enzyme (Vazyme#P051) to remove dU-containing fragments was analyzed by high-throughput sequencing.

[0162] 50 ng of 293FT gDNA was used as a sample to construct a library. Vazyme#TD501 was used for shearing. The sheared gDNA was end-repaired. Vazyme#TD601 and Vazyme#TD202 Index primers were used to amplify the library. The constructed library was used as the target library for the test.

[0163] 50 ng of Escherichia coli gDNA was used as the sample for library construction. Vazyme#TD501 was used for shearing and the sheared gDNA was end-repaired. An amplification system of dUTP / dTTP=1 / 5 and an amplification system containing only dTTP were set up respectively. The library was amplified using Vazyme#TD601 and Vazyme#TD202 Index primers. The amplified libraries were used as libraries simulating dU contamination and control libraries without dU contamination.

[0164] Furthermore, the 293T library constructed above and the library of Escherichia coli were mixed according to the ratio set in Table 2 to obtain 5 groups of mixed libraries. Three portions were taken from each group, each with 10 ng, and they were set to be untreated, treated with UDG enzyme (25°C, 10 min), and treated with digestion enzyme combination 1 (37°C, 5 min). Subsequently, library amplification primers (P5 primer is SEQ ID NO.23: AATGATACGGCGACCACCGAGA, P7 primer is SEQ ID NO.24: CAAGCAGAAGACGGCATACGA) were used for amplification. The amplification system and procedure were carried out according to the Vazyme#N616 instruction manual. Ten cycles of amplification were performed, and the final constructed library was subjected to high-throughput sequencing. The results are shown in FIG. Figure 8 shown.

[0165] Table 2

[0166]

[0167]

[0168] like Figure 8 As shown, the sequencing results of the template-free control group without E. coli library showed no E. coli data. For the E. coli library mixed with all T without dU, the sequencing results showed that even after treatment with UDG or digestion enzyme combination 1, about 15% of E. coli data could still be detected, which also confirmed that digestion enzyme combination 1 and UDG had no effect on the all-T template. For the experimental group with the E. coli library containing dU added, about 0.5% of E. coli data could still be detected after UDG treatment, while the E. coli genome data was 0 in the group treated with digestion enzyme combination 1. This result confirmed that digestion enzyme combination 1 has a stronger ability to remove dU-containing fragments, reaching a level of basically 100% removal. In anti-pollution applications, the effect of digestion enzyme combination 1 is better than UDG.

[0169] Example 3

[0170] The effect of digestive enzyme combination 1 on pathogen panel detection was tested in a pathogen model.

[0171] 1. First library construction: Prepare mixed template and digestion enzyme combination 1, the preparation method is the same as reference example 2 and example 1. Add 1ng of the prepared mixed template, set the ratio of dUTP / dTTP in the experimental group to 1 / 5, add digestion enzyme combination 1 to the amplification system and treat at 37℃ for 5 minutes; the control group is full dTTP and does not need digestion enzyme treatment. Use Vazyme#NA301 and Vazyme#PM202 respectively with pathogen panel (207-plex, sequence as Figure 13-16Multiple amplification was performed with the same amplification system (shown in Figure 1), and the rest of the amplification system and procedures were performed according to the instructions of Vazyme#NA301 and Vazyme#PM202. The products of the first round of multiple amplification were recovered using magnetic beads (Vazyme#N411), and the products of the first round of amplification were further amplified with the Vazyme#N616 high-fidelity enzyme for the second round of adapter amplification. The dUTP ratio in the second round of amplification system was set to be the same as that in the first round. After treatment, the second round of amplification was performed, and the primer used was Vazyme#TD202.

[0172] 2. Second library construction: Repeat the first library construction steps and sequence the amplified library obtained the second time. The results are as follows: Fig. 9 Shown

[0173] Fig. 9 The results showed the detection rate of 207 severe pathogen panels in tNGS (each group of data was normalized to 20M, a single panel with reads greater than 50 was considered detected, and panel detection rate = number of detected panels / total number of panels, i.e., 207). In the digestive enzyme combination 1 treatment group, the addition of 1 / 5 (dUTP / dTTP) of dUTP and digestive enzyme combination 1 did not affect the amplification of multiple fragments, and the panel detection rate shown by the final sequencing was also unaffected, proving that digestive enzyme combination 1 can be well used in multiple amplification of tNGS.

[0174] Example 4

[0175] 1. First amplification

[0176] The new anti-fouling method was tested in a system with a dUTP / dTTP ratio of 1 / 5.

[0177] Prepare digestive enzyme combination 2: 2U of SMUG (NEB#M0336S), 5U of Endonuclease VIII (NEB#M0299S) and 10U of λ exonuclease (NEB#M0262S), mixed in 1 μL system.

[0178] The UDG enzyme used was Vazyme #P051, and the mixed enzyme USER (NEB #M5505S) contained UDG and Endonuclease VIII.

[0179] 1 ng of Staphylococcus aureus DNA was used as a template, and the amplification system of Vazyme#P507 was used. First, 2*4 groups of amplification systems with different dUTP (full dTTP and dUTP / dTTP=1 / 5) were set up, without any treatment, 2U UDG enzyme treatment (25°C, treatment for 10 min), 1 μL digestion enzyme combination 2 treatment (37°C, treatment for 5 min), and 2U USER enzyme treatment (25°C, treatment for 10 min). Amplify a single fragment (upstream primer T1-Fwd is SEQ ID NO.3, downstream primer T1-Down is SEQ ID NO.4), and obtain the first round of amplification products. The reaction system and amplification procedure refer to the Vazyme#P507 manual.

[0180] 2. Second Amplification

[0181] Further, 1 ng of the above amplified product was added as a template, and the first amplification step was repeated. The second amplification system and procedure were the same as the first amplification to obtain the second amplified product. The amplified products were subjected to agarose gel electrophoresis. The results were as follows: Fig.10 shown.

[0182] like Fig.10 As shown, the template amplified in the amplification system of dUTP / dTTP=1 / 5 cannot be re-amplified after being treated with digestion enzyme combination 2, but can still be amplified after being treated with UDG enzyme. USER enzyme cannot completely remove the dU-containing fragment, but can still be amplified after treatment. In addition, the amplification efficiency of digestion enzyme combination 2 and the control in the system of all dTTP is consistent, indicating that digestion enzyme combination 2 itself does not affect amplification and can more thoroughly remove the dU-containing template.

[0183] Example 5

[0184] 1. First amplification

[0185] The new anti-fouling method was tested in a system with a dUTP / dTTP ratio of 1 / 5.

[0186] Prepare digestive enzyme combination 3: 2U of UDG (NEB#M0372S), 10U of APE1 (NEB#M0282S) and 5U of T7 endonuclease I (NEB#M0302S), mixed in 1 μL system.

[0187] Vazyme #P051 was used as UDG enzyme.

[0188] 1 ng of Staphylococcus aureus DNA was used as a template, and the amplification system of Vazyme#P507 was used. First, 2*3 groups of amplification systems with different dUTP (full dTTP and dUTP / dTTP=1 / 5) were set up, without any treatment, 2U of UDG enzyme treatment (25°C, 10 min), and 1 μL of digestion enzyme combination 3 treatment (37°C, 5 min). Amplify a single fragment (upstream primer T1-Fwd is SEQ ID NO.3, downstream primer T1-Down is SEQ ID NO.4), and obtain the first round of amplification products. The reaction system and amplification procedure refer to the Vazyme#P507 manual.

[0189] 2. Second Amplification

[0190] Furthermore, 1 ng of the aforementioned amplified product was added as a template, and the first amplification step was repeated. The second amplification system and procedure were the same as the first amplification. SYBR-Green (Invitrogen # S7585) was added to the amplification system, and the CT value and clearance rate of the product after the digestion enzyme combination treatment were detected by qPCR. The results are as follows: Fig.11 shown.

[0191] like Fig.11 As shown, the results of qPCR showed that the CT value of the dU-containing fragment was reduced by 15 after treatment with digestive enzyme combination 3. By calculating the clearance efficiency (clearance rate = 1-2^(△CT)), the results showed that the clearance efficiency reached 100% after treatment with digestive enzyme combination 3, while the UDG clearance efficiency was around 99%; it also showed that digestive enzyme combination 3 could achieve the same digestion effect as digestive enzyme 1.

[0192] Example 6

[0193] 1. First amplification

[0194] The new anti-fouling method was tested in a system with a dUTP / dTTP ratio of 1 / 5.

[0195] Digestive enzyme combination 4 was prepared: 2 U of UDG (NEB#M0372S), 5 U of Endonuclease III (NEB#M0268S) and 10 U of λ exonuclease (NEB#M0262S), mixed in 1 μL system.

[0196] UDG enzyme used Vazyme#P051, USERⅡ(UDG and EndonucleaseⅢ, NEB#M5508S); SYBR-Green was added to the amplification system.

[0197] 1 ng of Staphylococcus aureus DNA was used as a template, and the amplification system of Vazyme#P507 was used. First, 2*4 groups of amplification systems with different dUTP (full dTTP and dUTP / dTTP=1 / 5) were set up, and no treatment was added, 2U of UDG enzyme treatment (25°C, treatment for 10 min), 1 μL of digestion enzyme combination 4 treatment (37°C, treatment for 5 min), and 2U of USERⅡ enzyme treatment (25°C, treatment for 10 min). Amplify a single fragment (upstream primer T1-Fwd is SEQ ID NO.3, downstream primer T1-Down is SEQ ID NO.4), and obtain the first round of amplification products. The reaction system and amplification procedure refer to the Vazyme#P507 manual.

[0198] 2. Second Amplification

[0199] Furthermore, 1 ng of the aforementioned amplified product was added as a template, and the first amplification step was repeated. The second amplification system and procedure were the same as the first amplification. SYBR-Green (Invitrogen # S7585) was added to the amplification system, and the CT value and clearance rate of the product after the digestion enzyme combination treatment were detected by qPCR. The results are as follows: Fig.12 shown.

[0200] like Fig.12 As shown, the results of qPCR showed that the CT value of the dU-containing fragments was reduced by 15 after treatment with digestive enzyme combination 4. By calculating the clearance efficiency (clearance rate = 1-2^(△CT)), the results showed that the clearance efficiency after treatment with digestive enzyme combination 4 reached 100%, while the clearance efficiencies after treatment with UDG and USERⅡ enzymes were both around 99%; this also shows that digestive enzyme combination 4 has a better anti-pollution effect than UDG.

[0201] Example 7

[0202] 1. First amplification

[0203] The new anti-fouling method was tested in a system with a dUTP / dTTP ratio of 1 / 5.

[0204] Prepare digestive enzyme combination 5: 2U of UDG (NEB#M0372S), 10U of Endonuclease IV (NEB#M0304S) and 5U of T7 Endonuclease I (NEB#M0302S), mixed in 1 μL system.

[0205] Vazyme #P051 was used as UDG enzyme.

[0206] The mixed enzyme USERⅠ-Ⅲ is the same as in Example 1.

[0207] 1 ng of Staphylococcus aureus DNA was used as a template, and the amplification system of Vazyme#P507 was used. First, 2*6 groups of amplification systems with different dUTP (full dTTP and dUTP / dTTP=1 / 5) were set up, without any treatment, 2U of UDG enzyme treatment (25°C, treatment for 10 min), 1 μL of digestion enzyme combination 5 treatment (37°C, treatment for 5 min), and 1U of mixed enzyme USERⅠ-Ⅲ treatment (25°C, treatment for 10 min). Amplify a single fragment (upstream primer T1-Fwd is SEQ ID NO.3, downstream primer T1-Down is SEQ ID NO.4), and obtain the first round of amplification products. The reaction system and amplification procedure refer to the Vazyme#P507 manual.

[0208] 2. Second Amplification

[0209] Furthermore, 1 ng of the aforementioned amplified product was added as a template, and the first amplification step was repeated. The second amplification system and procedure were the same as the first amplification. SYBR-Green (Invitrogen # S7585) was added to the amplification system, and the CT value and clearance rate of the product after the digestion enzyme combination treatment were detected by qPCR. The results are as follows: Fig.17 shown.

[0210] like Fig.17 As shown, the results of qPCR showed that the CT value of the dU-containing fragments was reduced by about 15 after treatment with digestive enzyme combination 5. By calculating the clearance efficiency (clearance rate = 1-2^(△CT)), the results showed that the clearance efficiency reached 100% after treatment with digestive enzyme combination 5, while the clearance efficiencies of UDG and mixed enzyme USERⅠ-Ⅲ were both around 99%; it also showed that digestive enzyme combination 5 could achieve the same digestion effect as digestive enzyme combination 1 and digestive enzyme combination 3.

[0211] Example 8

[0212] 1. First amplification

[0213] The new anti-fouling method was tested in a system with a dUTP / dTTP ratio of 1 / 5 to explore the effect of different enzyme concentrations on the removal effect.

[0214] Prepare digestive enzyme combination 6: 1U of UDG (NEB#M0372S), 5U of APE1 (NEB#M0282S) and 0.8U of T7 endonuclease I (NEB#M0302S), mixed in 1 μL system.

[0215] Digestive enzyme combination 7: contains 2U of UDG (NEB#M0372S), 10U of APE1 (NEB#M0282S) and 0.8U of T7 endonuclease I (NEB#M0302S), mixed in 1 μL system.

[0216] Digestive enzyme combination 8: contains 1U of UDG (NEB#M0372S), 5U of APE1 (NEB#M0282S) and 5U of T7 endonuclease I (NEB#M0302S), mixed in 1 μL system.

[0217] Digestive enzyme combination 9: contains 2U of UDG (NEB#M0372S), 10U of APE1 (NEB#M0282S) and 1U of T7 endonuclease I (NEB#M0302S), mixed in 1 μL system.

[0218] Digestive enzyme combination 10: contains 2U of UDG (NEB#M0372S), 10U of APE1 (NEB#M0282S) and 2U of T7 endonuclease I (NEB#M0302S), mixed in 1 μL system.

[0219] Digestive enzyme combination 11: contains 2U of UDG (NEB#M0372S), 10U of APE1 (NEB#M0282S) and 3U of T7 endonuclease I (NEB#M0302S), mixed in 1 μL system.

[0220] Digestive enzyme combination 12: contains 2U of UDG (NEB#M0372S), 10U of APE1 (NEB#M0282S) and 5U of T7 endonuclease I (NEB#M0302S), mixed in 1 μL system.

[0221] Vazyme #P051 was used as UDG enzyme.

[0222] The enzyme mix USER (NEB #M5505S) contains UDG and Endonuclease VIII.

[0223] 1 ng of Staphylococcus aureus DNA was used as a template, and the amplification system of Vazyme#P507 was used. First, 2*12 groups of amplification systems with different dUTP (all dTTP and dUTP / dTTP=1 / 5) were set up, and no treatment was added, 2U of UDG enzyme was added for treatment (25°C, 10 min), 2U of UDG enzyme and 10U of APE1 enzyme were added for treatment (37°C, 5 min), 1 μL of digestion enzyme combination 6-12 was added for treatment (37°C, 5 min), 2U of USER enzyme was added for treatment (25°C, 10 min), and 2U of USER enzyme and 5UT7 endonuclease were added for treatment (37°C, 5 min). A single fragment was amplified (upstream primer T1-Fwd is SEQ ID NO.3, downstream primer T1-Down is SEQ ID NO.4), and the first round of amplification products was obtained. The reaction system and amplification procedure refer to the Vazyme#P507 instruction manual.

[0224] 2. Second Amplification

[0225] Furthermore, 1 ng of the aforementioned amplified product was added as a template, and the first amplification step was repeated. The second amplification system and procedure were the same as the first amplification. SYBR-Green (Invitrogen # S7585) was added to the amplification system, and the CT value and clearance rate of the product after the digestion enzyme combination treatment were detected by qPCR. The results are as follows: Fig.18 shown.

[0226] like Fig.18 As shown, the results of qPCR showed that the CT value of the dU-containing fragments could be reduced by 12-17 after treatment with digestive enzyme combinations 6-12. By calculating the clearance efficiency (clearance rate = 1-2^(△CT)), the results showed that the clearance effect of digestive enzyme combinations 8 and 10-12 could reach 100% after treatment, among which digestive enzyme combination 11 had the lowest △CT value and the best clearance effect.

Claims

1. A method for removing a non-target nucleic acid template, the method comprising: A digestive enzyme combination is added to a reaction system containing a target nucleic acid template and a non-target nucleic acid template, and the reaction is incubated; the digestive enzyme combination includes a DNA glycosylase, an AP site endonuclease, and an endonuclease that recognizes a nick site, or the digestive enzyme combination includes a DNA glycosylase, an AP site endonuclease, and a 5'-3' exonuclease that is dependent on a 5' phosphate group; the non-target nucleic acid template contains at least one of dU (deoxyuridine) or dI (deoxyinosine), and the target template does not contain dU or dI.

2. A method for removing non-target nucleic acid templates in PCR amplification, the method comprising: (1) preparing a PCR amplification reaction system containing a target nucleic acid template and a non-target nucleic acid template, wherein the reaction system further comprises: a DNA polymerase, a primer, a buffer substance, a metal salt, a dNTP and a digestive enzyme combination, wherein the dNTP comprises dATP, dGTP, dCTP and dTTP, and also comprises at least one of dUTP (deoxyuridine triphosphate) and dITP (deoxyinosine triphosphate); the digestive enzyme combination comprises a DNA glycosylase, an AP site endonuclease and an endonuclease that recognizes a nick site, or the digestive enzyme combination comprises a DNA glycosylase, an AP site endonuclease and a 5'-3' exonuclease that is dependent on a 5' phosphate group; the non-target nucleic acid template comprises at least one of dU or dI, and the target nucleic acid template does not comprise dU or dI; (2) incubation; (3) Perform an amplification reaction under appropriate conditions.

3. The method according to any one of claims 1-2, wherein the non-target nucleic acid template comprises double-stranded DNA, and the double-stranded DNA is at least partially complementary.

4. According to the method according to any one of claims 1-2, when the non-target nucleic acid template contains dU, the DNA glycosylase in the digestive enzyme combination is uracil DNA glycosylase (UDG enzyme) or single-stranded selective monofunctional uracil DNA glycosylase (SMUG enzyme); when the non-target nucleic acid template contains dI, the DNA glycosylase in the digestive enzyme combination is alkyl adenine DNA glycosylase (AAG enzyme) or endonuclease V.

5. According to the method according to any one of claims 1-2, the AP site endonuclease is at least one of APE1 (human apurinic / apyrimidinic nuclease 1), endonuclease III, endonuclease IV, FPG (formamidopyrimidine [fapy]-DNA glycosylase), endonuclease V, endonuclease VIII, OGG1 (8-oxoguanine DNA glycosylase 1), T4 PDG (T4 pyrimidine dimer glycosylase), hNEIL1 (human endonuclease VIII-like 1) and hNTHL1 (human nth like DNA glycosylase 1).

6. The method according to any one of claims 1-2, wherein the endonuclease for nick site recognition is at least one of T7 endonuclease I and mismatch endonuclease I.

7. The method according to any one of claims 1 to 2, wherein the 5' phosphate group-dependent 5'-3' exonuclease is lambda exonuclease.

8. The method according to claim 2, wherein dUTP / dTTP=1 / N or dITP / dGTP=1 / N, wherein N is a constant greater than zero, preferably N is greater than or equal to 1, more preferably N is greater than or equal to 3, and most preferably N is greater than or equal to 5.

9. The method according to any one of claims 1-2, wherein the incubation conditions are 30-40°C for 5-20 minutes, preferably 30-38°C for 5-15 minutes, more preferably 35-37°C for 5-15 minutes, more preferably 35-37°C for 5-10 minutes, more preferably 37°C for 5-10 minutes, more preferably 37°C for 8-10 minutes, and most preferably 37°C for 10 minutes.

10. The method according to claim 2, wherein the target nucleic acid template is a DNA template; preferably, the amount of the digestive enzyme combination used is at least 1U of DNA glycosylase, at least 5U of AP site endonuclease and at least 0.8U of nick site recognition endonuclease per ng DNA template; or preferably, the amount of the digestive enzyme combination used is at least 1U of DNA glycosylase, at least 5U of AP site endonuclease and at least 1U of nick site recognition endonuclease per ng DNA template; further preferably, the amount of the digestive enzyme combination used is at least 1U of SMUG enzyme, at least 5U of endonuclease IV and at least 0.8U of mismatch endonuclease I per ng DNA template; or further preferably, the amount of the digestive enzyme combination used is at least 1U of UDG enzyme, at least 5U of APE1 enzyme and at least 0.8U of T7 endonuclease I per ng DNA template; Or preferably, the usage amount of the digestive enzyme combination is at least 1U of DNA glycosylase, at least 2.5U of AP site endonuclease and at least 5U of 5' phosphate group-dependent 5'-3' exonuclease per ng DNA template; or preferably, the usage amount of the digestive enzyme combination is at least 2U of DNA glycosylase, at least 5U of AP site endonuclease and at least 10U of 5' phosphate group-dependent 5'-3' exonuclease per ng DNA template; further preferably, the usage amount of the digestive enzyme combination is at least 1U of SMUG enzyme, at least 2.5U of endonuclease VIII and at least 5U of λ exonuclease (Lambda Exonuclease) per ng DNA template; or further preferably, the usage amount of the digestive enzyme combination is at least 1U of UDG enzyme, at least 2.5U of endonuclease III and at least 5U of λ exonuclease per ng DNA template.

11. The method according to claim 2, wherein the amplification reaction in step (3) comprises denaturation, annealing and extension, preferably high temperature denaturation at 95°C.

12. The method according to claim 2, wherein the DNA polymerase is a thermostable DNA polymerase, preferably Taq DNA polymerase; the primers comprise at least one pair of upstream primers and downstream primers; the metal salt comprises Mg 2+ Salt, K + Salt, Mn 2+ Salt, Na + Salt, Co 2+ Salt and Ca 2+ One or more salts, preferably Mg 2+ Salt, more preferably Mg 2+ Salt and K + Salt; the buffer substance includes one or more of Tris, Tris-HCl, Tris base or HEPES, preferably Tris.

13. A method for constructing an amplicon library, the method comprising: (1) obtaining a DNA sample to be tested as a target nucleic acid template and obtaining a specific primer pair for amplifying the target region as a primer; (2) performing PCR amplification using the method described in any one of claims 2 to 12; (3) optionally, purifying or not purifying the amplification product; (4) adding primers with sequencing adapter sequences and obtaining nucleic acid fragments with adapters by PCR amplification; (5) Optionally, purify the amplified product. The method according to claim 13 , wherein the specific primer pair for amplifying the target region comprises at least one pair of an upstream primer and a downstream primer.

15. According to the method of claim 13, the primers with sequencing adapter sequences include a first primer with a first adapter sequence and a second primer with a second adapter sequence; preferably, the first adapter sequence is a P5 adapter sequence of an Illumina platform, and the second adapter sequence is a P7 adapter sequence of an Illumina platform; preferably, the first primer is an N5 primer, and the second primer is an N7 primer.

16. A method for constructing a pathogen targeted sequencing library, the method comprising: (1) obtaining a DNA sample to be tested as a target nucleic acid template, wherein the DNA sample is from a host and a pathogenic microorganism; obtaining a specific primer pair for amplifying a target region of a target pathogenic microorganism as a primer; (2) The library is constructed using the method described in any one of claims 13 to 15.

17. A method for detecting pathogenic microorganisms based on tNGS, the method comprising: (1) constructing a library using the method of claim 16; (2) Sequencing on a machine.

18. Use of the method according to any one of claims 1 to 12 in nucleic acid amplification contamination prevention.

19. A digestive enzyme combination reagent, comprising: DNA glycosylase, AP site endonuclease and nick site recognition endonuclease, or comprising DNA glycosylase, AP site endonuclease and 5' phosphate group-dependent 5'-3' exonuclease.

20. The digestive enzyme combination agent according to claim 19, wherein: (1) the DNA glycosylase is uracil DNA glycosylase (UDG enzyme) or single-stranded selective monofunctional uracil DNA glycosylase (SMUG enzyme), or the DNA glycosylase is alkyladenine DNA glycosylase (AAG enzyme) or endonuclease V; and / or (2) the AP site endonuclease is at least one of APE1 (human apurinic / apyrimidinic nuclease 1), endonuclease III, endonuclease IV, FPG (formamidopyrimidine [fapy]-DNA glycosylase), endonuclease V, endonuclease VIII, OGG1 (8-oxoguanine DNA glycosylase 1), T4 PDG (T4 pyrimidine dimer glycosylase), hNEIL1 (human endonuclease VIII-like 1) and hNTHL1 (human nth like DNA glycosylase 1); and / or (3) the nick site recognition endonuclease is at least one of T7 endonuclease I and mismatch endonuclease I; and / or (4) The 5' phosphate group-dependent 5'-3' exonuclease is a lambda exonuclease.

21. The digestive enzyme combination agent according to claim 19, wherein: DNA glycosylase, AP site endonuclease and nick site recognition endonuclease are provided in a ratio of 0.5-1.5U:3-7U:0.5-10U, for example 0.75-1.25U:4-6U:0.7-5U, for example 0.9-1.1U:4.5-5.5U:0.6-2U, for example 1U:5U:0.8-1U, or DNA glycosylase, AP site endonuclease and 5' phosphate group-dependent 5'-3' nuclease are present in a ratio of 0.5-1.5U:1.5-3.5U:3-7U, for example 0.75-1.25U:2-3U:4-6U, for example 1U:2.5U:5U.

22. A dNTP reagent comprising dATP, dGTP, dCTP and dTTP, and at least one of dUTP and dITP.

23. The dNTP reagent according to claim 22, wherein dUTP / dTTP=1 / N or dITP / dGTP=1 / N, wherein N is a constant greater than zero, preferably N is greater than or equal to 1, more preferably N is greater than or equal to 3, and most preferably N is greater than or equal to 5.

24. A kit for carrying out the method according to any one of claims 1 to 12.

25. The kit according to claim 24, comprising the digestive enzyme combination reagent according to any one of claims 19 to 21 and / or the dNTP reagent according to claim 22 or 23, and optionally, further comprising one or more of a DNA polymerase, a primer, a buffer substance and a metal salt.

26. Use of the digestive enzyme combination reagent according to any one of claims 19 to 21 and / or the dNTP reagent according to claim 22 or 23 in preparing the kit according to claim 24 or 25.

Images