Odontobutis sinensis male molecular marker primer and application thereof

Abstract

The invention discloses an odontobutis sinensis male molecular marker primer and application thereof, the odontobutis sinensis male molecular marker primer is a primer STLM2 or a primer STLM9, the primer STLM2 comprises an upstream primer STLM2F2 and a downstream primer STLM2R2, the primer STLM9 comprises an upstream primer STLM9F2 and a downstream primer STLM9R2, and the upstream primer STLM9F2 and the downstream primer STLM9R2 are connected with the upstream primer STLM2F2 and the downstream primer STLM9R2. The invention also discloses the male molecular marker STLM2.2 or STLM9.2 of the odontobutis sinensis, a sex identification method of the odontobutis sinensis, and application of the primer or the method in sex identification of the odontobutis sinensis. The primer is good in specificity, can quickly and accurately identify the sex of the odontobutis sinensis, breaks through the technical bottleneck that the sex of the early-stage offspring seeds of the odontobutis sinensis cannot be identified, and has important scientific research value and practical application value for sex determination and sex control of the odontobutis sinensis.

Description

Technical Field

[0001] The invention belongs to the technical field of sex identification of Channa sinensis, and particularly relates to a male molecular marker primer of Channa sinensis and an application thereof. Background Art

[0002] Chinese sand channan (Odontobutis sinensis) belongs to the order Perciformes, family Odontobutidae, genus Odontobutis. Chinese sand channan is widely distributed in Hubei, Jiangxi, Hunan in the middle and upper reaches of the Yangtze River, Guangdong, Guangxi and other vast waters in the Pearl River system. It has a high meat content, delicious meat, and nourishing effects. It has a high market price and is a valuable economic fish.

[0003] However, the sex of male and female individuals of Channa sinensis cannot be identified by morphology during the embryonic and juvenile stages, which brings great difficulties to the research on gonad differentiation and the cultivation of monosex seedlings of Channa sinensis, and also greatly restricts the development of the industry of this species. So far, there are no reports of molecular marker primers that can successfully identify the genetic sex of Channa sinensis at home and abroad. Therefore, the development of a molecular marker primer that can accurately identify the genetic sex has great production application value in the monosex breeding of Channa sinensis. Summary of the invention

[0004] The first object of the present invention is to provide a male molecular marker primer for Channa sinensis.

[0005] The second object of the present invention is to provide a method for identifying the sex of Channa sinensis.

[0006] The third object of the present invention is to provide the application of the primers in sex identification of Channa sinensis.

[0007] The above-mentioned first object of the present invention can be achieved by the following technical scheme: a male molecular marker primer of Chinese sand channandra, the male molecular marker primer of Chinese sand channandra is primer STLM2 or primer STLM9, the primer STLM2 includes upstream primer STLM2_F2 and downstream primer STLM2_R2, the primer STLM9 includes upstream primer STLM9_F2 and downstream primer STLM9_R2, the nucleotide sequence of the upstream primer STLM2_F2 is shown in SEQ ID NO: 1, the nucleotide sequence of the downstream primer STLM2_R2 is shown in SEQ ID NO: 2, the nucleotide sequence of the upstream primer STLM9_F2 is shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer STLM9_R2 is shown in SEQ ID NO: 4.

[0008] Specifically, the nucleotide sequence of primer STLM2 is as follows: Upstream primer STLM2_F2: 5′-ATGTATGTATGCCAGTGAG -3′ (as shown in SEQ ID NO: 1); Downstream primer STLM2_R2: 5'-CCATGTGAAAGGGCTCAAT-3' (as shown in SEQ ID NO: 2); Specifically, the nucleotide sequence of primer STLM9 is as follows: Upstream primer STLM9_F2: 5'-CTTGAATGTCCCTGGAGTC -3' (as shown in SEQ ID NO: 3); Downstream primer STLM9_R2: 5'-CCTTTGAAATAGCCCGTAC -3' (as shown in SEQ ID NO: 4).

[0009] The second object of the present invention can be achieved by the following technical solution: A method for identifying the sex of Channa sinensis, comprising the following steps: Step (1): extracting genomic DNA of the tested Channa sinensis; Step (2): using the genomic DNA extracted in step (1) as a template, using the primer STLM2 or the primer STLM9 to perform PCR amplification, and performing electrophoresis detection after the amplification reaction is completed. If the electrophoresis result shows that the amplified product has a specific DNA band, then the detected Chinese sand tang Channa sinensis DNA sample is a male Chinese sand tang Channa sinensis; if the electrophoresis result shows that the amplified product does not have a specific DNA band, then the detected Chinese sand tang Channa sinensis DNA sample is a female Chinese sand tang Channa sinensis.

[0010] In the above method for sex identification of Channa sinensis: Preferably, the PCR reaction system used in PCR amplification in step (2) is: 2×Taq MasterMix 10 μL, upstream primer STLM2_F2 or STLM9_F2 0.8 μL at a concentration of 10 μM, downstream primer STLM2_R2 or STLM9_R2 0.8 μL at a concentration of 10 μM, ddH2O 7.4 μL, genomic DNA 1 μL, a total of 20 μL.

[0011] Preferably, the PCR reaction program used in the PCR amplification in step (2) is: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, 30 cycles, and extension at 72°C for 5 min.

[0012] Preferably, in step (2), the primer STLM2 is used for PCR amplification, and electrophoresis is performed after the amplification reaction is completed. If the electrophoresis result shows that the amplified product has a specific DNA band at 237 bp, the detected Chinese sand channandra DNA sample is a male Chinese sand channandra; in step (2), the primer STLM9 is used for PCR amplification, and electrophoresis is performed after the amplification reaction is completed. If the electrophoresis result shows that the amplified product has a specific DNA band at 435 bp, the detected Chinese sand channandra DNA sample is a male Chinese sand channandra.

[0013] The third object of the present invention can be achieved by the following technical solution: application of the primers in sex identification of Channa sinensis.

[0014] Therefore, the successful development of the male molecular marker primers of the Chinese sand channeratus of the present invention has broken through the technical bottleneck of genetic sex identification of the Chinese sand channeratus, and provided a tool for genetic sex control of the Chinese sand channeratus. The application of this technology can realize the sex identification of Chinese sand channeratus seedlings in the early stage of hatching, improve the breeding efficiency, reduce the cost, and promote the development of research work such as sex determination and sex control of Chinese sand channeratus.

[0015] Compared with the prior art, the present invention has the following advantages: (1) Based on the genome sequencing data of male and female Channa sinensis, the present invention uses methods such as genome assembly, alignment and in-depth analysis to accurately screen out the male molecular sequence of Channa sinensis, and designs primers for male molecular markers for identifying the sex of Channa sinensis for the first time. The primers can quickly and accurately identify the sex of Channa sinensis; (2) The male molecular marker primers of Channa sinensis designed by the present invention have good specificity. Any one of the two pairs of specific primers can be used to complete a PCR reaction to identify the genetic sex of Channa sinensis, which is time-saving, efficient, and resource-saving. (3) The method of the present invention achieves accurate identification of the genetic sex of Channa sinensis seedlings, breaking through the technical bottleneck of being unable to identify the sex of early Channa sinensis seedlings; (4) The primers and methods of the present invention have important scientific research value and practical application value for sex determination and sex control of Channa sinensis. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The electrophoresis diagram of the PCR products detected by the primer STLM2 of male and female individuals (16 tails) in Example 2; Figure 2 The electrophoresis diagram of the PCR products detected by the primer STLM9 of male and female individuals (16 tails) in Example 2; Figure 3The electrophoresis diagram of the PCR products detected by the primer STLM2 of male and female individuals (32 tails) in Example 3; Figure 4 This is the electrophoresis diagram of the PCR products detected by the primer STLM9 of male and female individuals (32 tails) in Example 3. DETAILED DESCRIPTION

[0017] The technical scheme of the present invention is described in detail below in conjunction with specific embodiments, so that those skilled in the art can better understand and implement the technical scheme of the present invention. The following examples and accompanying drawings are only used for exemplary description and cannot be construed as limiting the present invention. The reagents or materials used in the embodiments, if not otherwise specified, are all derived from commercial channels. Unless otherwise specified, the experimental instruments used are all conventional laboratory instruments.

[0018] Example 1 The male molecular marker primers of Channa sinensis provided in this embodiment are primer STLM2 or primer STLM9, the primer STLM2 includes an upstream primer STLM2_F2 and a downstream primer STLM2_R2, the primer STLM9 includes an upstream primer STLM9_F2 and a downstream primer STLM9_R2, the nucleotide sequence of the upstream primer STLM2_F2 is shown in SEQ ID NO: 1, the nucleotide sequence of the downstream primer STLM2_R2 is shown in SEQ ID NO: 2, the nucleotide sequence of the upstream primer STLM9_F2 is shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer STLM9_R2 is shown in SEQ ID NO: 4.

[0019] Specifically, the nucleotide sequence of primer STLM2 is as follows: Upstream primer STLM2_F2: 5′-ATGTATGTATGCCAGTGAG -3′ (as shown in SEQ ID NO: 1); Downstream primer STLM2_R2: 5′-CCATGTGAAAGGGCTCAAT-3′ (as shown in SEQ ID NO: 2); Specifically, the nucleotide sequence of primer STLM9 is as follows: Upstream primer STLM9_F2: 5'-CTTGAATGTCCCTGGAGTC-3' (as shown in SEQ ID NO: 3); Downstream primer STLM9_R2: 5'-CCTTTGAAATAGCCCGTAC-3' (as shown in SEQ ID NO: 4).

[0020] The design process of the male molecular marker primers of Channa sinensis provided in this embodiment is as follows: (1) Method Overview The male molecular marker of Channa sinensis in this embodiment uses a whole genome high-throughput sequencing strategy, combined with genome assembly technology, double-end sequencing data fine comparison technology, and characteristic sequence detection technology to achieve the identification of sex-specific markers. Through genome assembly, female and male genome sequences are obtained respectively, and according to the sequence comparison results, the sequence characteristics between female and male genome sequences are analyzed, and the genome sequences associated with gender identification are detected and analyzed. Further based on the sex-specific sequences screened out by the high-throughput sequencing data analysis results, sex-specific primers are designed, and sex-specific primers show different PCR characteristics in female and male samples. Species with XY sex-determining mechanism show that male samples have target bands, and female samples have no target bands.

[0021] (2) Technical route Specifically include: Based on the whole genome sequencing data of three female samples of Chinese sand snakehead with known sex (STL-F1, STL-F4, STL-F8) and three male samples of Chinese sand snakehead (STL-M1, STL-M8, STL-M9), it was preliminarily determined whether the species to be studied belongs to the genetically determined sex control mechanism (GSD) or the environmentally determined sex control mechanism (ESD). This part includes the denovo assembly of the female genome and the male genome, and the comparison of the female genome sequence with the male genome sequence.

[0022] If female-specific genomic DNA sequences and male-specific genomic DNA sequences are detected, it is preliminarily determined to be a genetically determined sex determination mechanism (GSD), and further determined to be an XY type sex determination mechanism or a ZW type sex determination mechanism. This step is determined by combining the sex-specific gene sequences obtained by sequencing analysis and the PCR experimental results.

[0023] Based on the verification results of the previous step, female and male samples are collected in batches to verify the reliability of sex-specific molecular markers on a larger scale. If it belongs to the XY type sex determination mechanism, DNA is extracted from the collected female samples and mixed in equal amounts before sequencing to remove false-positive Y-specific sequences; if it belongs to the ZW type, male samples are selected for mixed sequencing to remove false-positive W-specific sequences.

[0024] Based on the mixed sample sequencing data, the Y / W specific sequences were further screened and confirmed.

[0025] Assemble XY, ZW chromosome sequences and acquire sex chromosomes.

[0026] (3) Analysis steps (3.1) Sequencing data quality control: Illumina high-throughput sequencing results initially exist as raw image data files, which are converted into raw sequencing sequences (Raw Reads) after base calling by CASAVA software. The raw sequencing sequences obtained by sequencing will contain sequencing adapter sequences and low-quality sequences. In order to ensure the quality of information analysis data, the raw sequences are filtered to obtain high-quality Clean Reads. All subsequent analyses are based on Clean Reads. The raw sequencing data are filtered using fastp 0.23.2 software, with filtering parameters: -q 20 -l 150, and other parameters are default.

[0027] (3.2) Genomic assessment: Genome size evaluation was performed using jellyfish (version: 2.3.0, https: / / github.com / gmarcais / Jellyfish) and GenomeScope2 (version: 2.0, https: / / github.com / tbenavi1 / genomescope2.0). Jellyfish was used for kmer distribution statistics with the K value set to 21, and GenomeScope2 was used for genome size evaluation with the parameters set to diploid and the K value set to 21.

[0028] Genome evaluation: The female data predicted that the genome size was 838,759,995-871,597,817bp, with unique sequences accounting for 61.2%, repetitive sequences accounting for 38.8%, and heterozygosity being 0.438%. The male data predicted that the genome size was 1,078,176,779-1,093,806,426bp, with unique sequences accounting for 47.9%, repetitive sequences accounting for 52.1%, and heterozygosity being 0.377%. The Kmer distribution diagrams of the female and male genomes both showed a single peak similar to the normal distribution, with no obvious heterozygous peak and repetitive peak, and it was speculated to be a common diploid species.

[0029] (3.3) Genome assembly: The genome sequence was assembled using SOAP Denovo2 (version 2.04) genome assembly software, using a multi-Kmer assembly strategy. The sequencing data were assembled into scaffold sequences based on the overlap and pair-end relationships of the sequencing data. The scaffold sequences were used as reference genome sequences for subsequent analysis after GapCloser (version 1.12).

[0030] The female genome (Female) was assembled using STL-F1 sequencing data; the male genome (Male) was assembled using STL-M1 sequencing data.

[0031] (3.4) Sequencing reads alignment: Sequence alignment was performed using the bwa (0.7.17-r1188) sequence alignment software. The paired-end sequencing sequences of female samples and male samples were aligned to the female and male reference genomes, respectively. The alignment used the mem alignment method and default parameters. The SAMtools (1.14) software and the sort parameter were used to sort the alignment results to obtain the aligned bam files. In order to improve the accuracy of the alignment, the SAMtools (1.14) view program and the -bF 12 parameter were used to screen the paired-end aligned sequencing reads for subsequent analysis.

[0032] (3.5) Gender-specific sequence detection: A. Male-specific sequence detection: According to the results of the double-end sequence alignment after screening, under the condition of the male reference genome, the sequences that are covered by all male samples but not covered by any female sample or female mixed pool samples are screened as male-specific sequences.

[0033] B. Female-specific sequence detection: According to the double-end sequence alignment results after screening, under the condition of the female reference genome, the sequences that are covered by all female samples but not covered by any male sample are screened as female-specific sequences.

[0034] The first round of analysis was conducted on sequencing data of 3 male samples and 3 female samples, and a certain number of female-specific sequences and male-specific sequences were detected in the first round.

[0035] In the first round of screening results, there were obviously more male-specific sequences than female-specific sequences, and it was speculated that the sand snakehead adopted an XY type sex determination mechanism. Based on the results of the first round of verification, in the second round, one female mixed pool data (mixed from the sequencing data of 14 female individuals) was added to conduct a second round of re-screening of male-specific sequences to remove false positive specific sequences.

[0036] After two rounds of screening, there may be some invalid specific sequences in the specific sequences, such as repeated sequences, sequences with a large proportion of N bases, etc. These sequences are prone to assembly errors and cannot be verified by experiments later. They are defined as invalid specific sequences. Such sequences will be manually excluded. After several rounds of screening, the specific sequences are shown in Table 1 below and the gender-specific sequence length distribution table is shown in Table 2 below: Table 1 Sex-specific sequence information

[0037] Description: Sequence Type: sequence type (Male: male-specific sequence, Female: female-specific sequence) SeqNum: number of sequences; Total length (nt): total length of assembled sequences; Max length (nt): maximum sequence length; Min length (nt): minimum sequence length; Average length (nt): average sequence length.

[0038] Table 2 Distribution of sex-specific sequence lengths

[0039] (3.6) Specific sequence annotation: The male-specific sequences were compared with the NCBI nt database (nt, Nucleotide collection) and nr database (nr, Non-redundant proteinsequences) using BLASTN 2.15.0+ and BLASTX 2.15.0+, respectively, for annotation.

[0040] Finally, two molecular markers STLM2.2 or STLM9.2 of male Channa sinensis were screened and obtained.

[0041] Specifically, the nucleotide sequence of the molecular marker STLM2.2 is as follows: ATGTATGTATGCCAGTGAG CCTCCGAAAACTAATTTCCTCATGCTAATGCATGACAATAAAGATTCTTGATATTGCTTGAGAAAATTAAGGTTGCTTGAGAAGGAAAATTCTTCTCACAGAAGGAGCGCTCCCAGCTTCACTACGAGCCTTTTGCCATGCCTGAGGAAAAAGAAAAATGTCAGTATATTTTACAGCAAAAAACATTGCACATTCAGC AT TGAGCCCTTTCACATGG (as shown in SEQ ID NO: 5);

[0042] Note: The underlined parts correspond to the sequence of the upstream primer and the complementary sequence of the downstream primer.

[0043] Specifically, the nucleotide sequence of the molecular marker STLM9.2 is as follows: CTTGAATGTCCCTGGAGTCCGACTGAGTTTGTGGTGTTAGTAACCGATGTGTTTGTAGGTTGACGTTGTAATCTTTGGGGTAACGGAGGCGGTCTCTGGGGTAACGGGGGTGGTATCTGCTGTGTGTCGGTGGCAGAGGAGACCATCAAAGGAGCTGGAATACCCGTAGGTTGGTGTGAGAGTGGTGAAGAGATCCGCGTCCGAGACGTGGTCGGTGT AGGAACCCTCTGGGAGTGTGGTGTAGTGGCCACATTATGTGAAGCAGCTGTGTCGAGGATCCGTTGGAGTGGGGGTTCGTTCTGTTGACCATCTATACTATCCCTCTTCCCGGGTACGAGCGCCAGGGCGGTCTGAATTTCGGTCCTGGTCAGTTCCAAAGTCCGTTGCGTAATGCGCGTAAAATTACGCACAGCCCAA GTACGGGCTATTTCAAAGG (as shown in SEQ ID NO: 6);

[0044] Note: The underlined parts correspond to the sequence of the upstream primer and the complementary sequence of the downstream primer.

[0045] (3.7) Primer design: Based on the sex-specific sequences screened out by high-throughput sequencing data analysis, PCR verification primers were designed using Primer3 version 4.1.0 software (https: / / bioinfo.ut.ee / primer3-0.4.0 / ). Sex-specific primers showed different PCR characteristics in female and male samples. Species with XY sex determination mechanism showed that male samples had the target bands, while female samples had no target bands.

[0046] The designed primer information is shown in Table 3: Table 3 Primer information .

[0047] Example 2 The primers in Example 1 were used to identify the sex of Channa sinensis in the following manner: 1. Sample information The verification samples of Channa tangensis include 8 males and 8 females, totaling 16 samples. The following Table 4 shows the sample information: Table 4 Batch verification sample information

[0048] 2. Genomic DNA Extraction The genomic DNA was extracted using the universal column-type genomic DNA extraction kit (Cat. No. CW2298M) produced by Jiangsu Kangwei Century Technology Co., Ltd. The extraction method is described in the kit manual.

[0049] 3. PCR amplification 3.1 Reagents and consumables DNA polymerase: 2×Taq MasterMix (Dye) (purchased from Jiangsu Kangwei Century Technology Co., Ltd., catalog number: CW0682L); sample templates are shown in Table 4; primers are shown in Table 3; RNase free water.

[0050] 3.2 PCR reaction system The PCR reaction system is shown in Table 5 below, and the PCR reaction conditions are shown in Table 6 below: Table 5 PCR reaction system

[0051] Table 6 PCR reaction conditions .

[0052] 4. Agarose gel image Glue concentration: 1% (wt), voltage 180V, time 30min; Marker: M is DM2000, purchased from Jiangsu Kangwei Century Biotechnology Co., Ltd., catalog number CW0632M; DM2000 DNA Marker consists of 6 DNA fragments, namely 2,000 bp, 1,000 bp, 750 bp, 500 bp, 250 bp and 100 bp. Take 3 μL and perform electrophoresis directly. During electrophoresis, the amount of the 750 bp DNA fragment is about 90 ng, showing a bright band, and the amount of DNA in other bands is about 30 ng.

[0053] The agarose gel images of 8 male samples and 8 female samples using primer STLM2 are shown in Figure 2. Figure 1 shown.

[0054] The agarose gel images of 8 male samples and 8 female samples using primer STLM9 are shown in Figure 2 shown.

[0055] Figure 1 and Figure 2 The lane numbers are consistent with the sample numbers in Table 4, and the primer numbers correspond to Table 3.

[0056] from Figure 1It can be seen that the primer STLM2 was used for PCR amplification, and electrophoresis was performed after the amplification reaction. The electrophoresis results of 8 male samples showed that the amplified product had a specific DNA band at 237bp, so the DNA sample of Channa sinensis detected was a male Channa sinensis, while the electrophoresis results of 8 female samples showed that the amplified product did not have a specific DNA band at 237bp, so the DNA sample of Channa sinensis detected was a female Channa sinensis.

[0057] from Figure 2 It can be seen that primer STLM9 was used for PCR amplification, and electrophoresis was performed after the amplification reaction. The electrophoresis results of 8 male samples showed that the amplified product had a specific DNA band at 435bp, so the detected Chinese sand channandra DNA sample was a male Chinese sand channandra, while the electrophoresis results of 8 female samples showed that the amplified product did not have a specific DNA band at 435bp, so the detected Chinese sand channandra DNA sample was a female Chinese sand channandra.

[0058] 5. Results statistics and description The statistics of PCR using primer STLM2 are shown in Table 7 below, and the statistics of PCR using primer STLM9 are shown in Table 8 below: Table 7 Statistics of PCR using primer STLM2

[0059] Note: In the fourth column of Table 7, 1 represents male and 0 represents female.

[0060] Table 8 Statistics of PCR using primer STLM9

[0061] Note: In the fourth column of Table 8, 1 represents male and 0 represents female.

[0062] It can be seen from Tables 7 and 8 that the identification results of the two pairs of male molecular marker specific primers screened this time are consistent with the physiological sex of each sample, and the two pairs of male molecular marker specific primers screened this time can achieve the purpose of identifying the male and female sex of Channa sinensis. Further, the above primers can be made into a kit or biological preparation for the identification of the sex of Channa sinensis.

[0063] Example 3 The sex identification of Channa sinensis was further verified by using 16 males and 16 females, using the same method as in Example 2. The results are as follows: Figure 3-Figure 4 As shown, from Figure 3It can be seen that the primer STLM2 was used for PCR amplification, and electrophoresis was performed after the amplification reaction. The electrophoresis results of 16 male Channa sinensis showed that the amplified product had a specific DNA band at 237bp, while the electrophoresis results of 16 female Channa sinensis showed that the amplified product did not have a specific DNA band at 237bp; Figure 4 It can be seen that the primer STLM9 was used for PCR amplification, and electrophoresis was performed after the amplification reaction. The electrophoresis results of 16 male Channa sinensis showed that the amplified product had a specific DNA band at 435bp, while the electrophoresis results of 16 female Channa sinensis showed that the amplified product did not have a specific DNA band at 435bp.

[0064] The above embodiments are only used to illustrate the present invention, and the protection scope of the present invention is not limited to the above embodiments. A person skilled in the art can achieve the purpose of the present invention based on the above disclosure of the present invention, and any improvement and deformation based on the concept of the present invention shall fall within the protection scope of the present invention, and the specific protection scope shall be subject to the claims.

Claims

1. A male molecular marker primer for Channa sinensis, characterized in that: The male molecular marker primer of Chinese sand snakehead is primer STLM2 or primer STLM9, the primer STLM2 includes upstream primer STLM2_F2 and downstream primer STLM2_R2, the primer STLM9 includes upstream primer STLM9_F2 and downstream primer STLM9_R2, the nucleotide sequence of the upstream primer STLM2_F2 is shown in SEQ ID NO: 1, the nucleotide sequence of the downstream primer STLM2_R2 is shown in SEQ ID NO: 2, the nucleotide sequence of the upstream primer STLM9_F2 is shown in SEQ ID NO: 3, and the nucleotide sequence of the downstream primer STLM9_R2 is shown in SEQ ID NO:

4.

2. A method for identifying the sex of Channa sinensis, characterized in that: The following steps are involved: Step (1): extracting genomic DNA of the tested Channa sinensis; Step (2): using the genomic DNA extracted in step (1) as a template, using the primer STLM2 or the primer STLM9 described in claim 1 to perform PCR amplification, and performing electrophoresis detection after the amplification reaction is completed. If the electrophoresis result shows that the amplified product has a specific DNA band, then the detected Chinese sand channandra DNA sample is a male Chinese sand channandra; if the electrophoresis result shows that the amplified product does not have a specific DNA band, then the detected Chinese sand channandra DNA sample is a female Chinese sand channandra.

3. The method for sex identification of Channa sinensis according to claim 2, characterized in that: The PCR reaction system used in step (2) for PCR amplification is: 2×Taq MasterMix 10 μL, upstream primer STLM2_F2 or STLM9_F2 0.8 μL at a concentration of 10 μM, downstream primer STLM2_R2 or STLM9_R2 0.8 μL at a concentration of 10 μM, ddH2O 7.4 μL, genomic DNA 1 μL, a total of 20 μL.

4. The method for sex identification of Channa sinensis according to claim 2, characterized in that: The PCR reaction program used in step (2) of PCR amplification is: pre-denaturation at 94°C for 3 min, denaturation at 94°C for 30 sec, annealing at 60°C for 30 sec, extension at 72°C for 30 sec, 30 cycles, and extension at 72°C for 5 min.

5. The method for sex identification of Channa sinensis according to claim 2, characterized in that: In step (2), the primer STLM2 is used for PCR amplification, and after the amplification reaction is completed, electrophoresis detection is performed, and the electrophoresis result shows that the amplification product has a specific DNA band at 237 bp, then the detected Chinese sand channandra DNA sample is a male Chinese sand channandra; in step (2), the primer STLM9 is used for PCR amplification, and after the amplification reaction is completed, electrophoresis detection is performed, and the electrophoresis result shows that the amplification product has a specific DNA band at 435 bp, then the detected Chinese sand channandra DNA sample is a male Chinese sand channandra.

6. Use of the primers described in claim 1 in sex identification of Channa sinensis.

Images