Klebsiella pneumoniae and application of klebsiella pneumoniae detection reagent in preparation of drug resistance detection product

Abstract

The invention discloses application of klebsiella pneumoniae and a detection reagent thereof in preparation of a drug resistance detection product, and belongs to the field of microbiology. The preservation number of the klebsiella pneumoniae is CCTCC (China Center For Type Culture Collection) M20242224, the klebsiella pneumoniae can produce rare carbapenemase, the carbapenemase is a klebsiella pneumoniae carbapenemase (KPC) subtype which is not reported yet, and the klebsiella pneumoniae carbapenemase is resistant to a plurality of antibacterial drugs, and has the advantages that the klebsiella pneumoniae carbapenemase can be used for preparing the klebsiella pneumoniae carbapenemase, the klebsiella pneumoniae carbapenemase can be used for preparing the klebsiella pneumoniae carbapenemase; the invention relates to a multi-drug-resistant bacterium standard strain, in particular to novel enzyme-containing inhibitor drugs such as ceftazidime-avibactam, imipenem-renobactam and meropenem-vibro bactam, and the multi-drug-resistant bacterium standard strain has a clinical application prospect as the multi-drug-resistant bacterium standard strain.

Description

Technical Field

[0001] The invention relates to the technical fields of microbiology, biochemistry and fermentation engineering, and in particular to application of a strain of Klebsiella pneumoniae and a detection reagent thereof in preparing a drug resistance detection product. Background Art

[0002] Klebsiella pneumoniae is the most important type of bacteria in the genus Klebsiella in the order Enterobacteriaceae. The diseases caused by Klebsiella pneumoniae account for more than 95% of Klebsiella infections. It is an important conditional pathogen and nosocomial infection bacteria with strong pathogenicity to humans in the genus Klebsiella in the order Enterobacteriaceae. In clinical practice, carbapenem-resistant Klebsiella pneumoniae (CRKP) has attracted widespread attention due to its rapid growth, difficulty in treatment and high mortality. CRKP in immunocompromised patients is usually sudden and fatal. A cohort study on the impact of CRKP infection on the mortality of patients with sepsis showed that the 30-day mortality rate of infected patients was significantly higher than 33.4%. The resistance mechanism of CRKP to carbapenem antibiotics can be divided into two categories. One is the non-carbapenemase-producing mechanism: loss of bacterial outer membrane protein expression accompanied by production of extended-spectrum β-lactamases (ESBLs) and cephalosporinase (AmpC); overexpression of efflux pumps; reduced membrane permeability; altered antimicrobial drug target sites; and biofilm formation. The other is the production of a type of β-lactamase that can hydrolyze imipenem or meropenem, namely carbapenemase, which is the most common resistance mechanism. Carbapenemases can be divided into three categories according to the Amber classification: Class A serine carbapenemases (such as KPC, GES, SME, IMI, NMC), Class B metallo-β-lactamases (MBLs) (NDM, IMP, VIM and species-specific metallo-β-lactamases CphA, CfiA, CcrA) and Class D oxacillinase (OXA) (such as OXA-48). Klebsiella pneumoniae carbapenemase (KPC) is the most widely prevalent enzyme type in the world and in my country, with about 60 subtypes.

[0003] CRKP strains are usually only sensitive to a few drugs such as tigecycline, polymyxin, and new β-lactam-lactamase inhibitor combinations (BLBLIs), and are highly resistant to most β-lactams, carbapenems, and quinolones, and have varying resistance to aminoglycosides. There are very limited drugs for the clinical treatment of CRE. In 2017, the World Health Organization (WHO) listed it as an extremely important drug-resistant bacteria that requires new antimicrobial drugs. In recent years, a variety of new BLBLIs have been developed, including ceftazidime-avibactam (CAZ-AVI, CZA), imipenem-relebactam (IMI-REL, IMR), meropenem-vaborbactam (MER-VAB, MEV), etc. Although these drugs are usually effective in treating infections caused by KPC-carrying strains, the occurrence of drug resistance has been reported in recent years, which poses challenges to clinical treatment and often leads to adverse outcomes.

[0004] Drug resistance is usually caused by mutations in the KPC gene. Therefore, there is an urgent need for drug resistance detection products that can effectively detect KPC variants. Since drug resistance detection needs to be designed based on known variants, as new variants emerge, conventional techniques and reagents may not be able to detect new variants, and continuous improvement is needed to meet clinical needs. Summary of the invention

[0005] The purpose of the present invention is to provide a strain of Klebsiella pneumoniae containing a new KPC variant (not yet reported) and the use of its detection reagent in the preparation of drug resistance detection products. The strain can be used as a standard strain of the new subtype, and the detection reagent of the strain can be used in the preparation of drug resistance detection products.

[0006] In order to achieve the above object, the present invention adopts the following technical solution:

[0007] In a first aspect of the present invention, a strain of Klebsiella pneumoniae is provided. The deposit number of the Klebsiella pneumoniae is CCTCC NO: M 20242224.

[0008] In a second aspect of the present invention, a fermentation agent is provided, the fermentation agent comprising:

[0009] Fermentation of the Klebsiella pneumoniae to obtain a fermentation broth;

[0010] Or the fermentation liquid is spray-dried to obtain a dry powder bacterial agent.

[0011] In a third aspect of the present invention, a carbapenemase is provided, characterized in that the amino acid sequence of the carbapenemase is shown as SEQ ID NO.2.

[0012] In a fourth aspect of the present invention, there is provided a use of the detection reagent for Klebsiella pneumoniae in the preparation of a detection product for drug-resistant Klebsiella pneumoniae.

[0013] The drug-resistant Klebsiella pneumoniae is a drug-resistant Klebsiella pneumoniae containing the specific molecular target shown in SEQ ID NO:1.

[0014] Furthermore, the detection reagent for the Klebsiella pneumoniae or the fermentation bacteria comprises a primer pair for detecting a specific molecular target, and the specific molecular target is a nucleic acid molecule shown in SEQ ID NO:1.

[0015] The nucleotide sequences of the primer pairs are shown in SEQ ID NO.3-SEQ ID NO.4.

[0016] The specific primer pair was F-CGTCTAGTTCTGCTGTCTTG and R-CTTGTCATCCTTGTTAGGCG.

[0017] The carbapenemase detection reagent comprises an immune colloidal gold test strip for detecting carbapenemase.

[0018] In a fourth aspect of the present invention, a drug resistance detection product is provided, which includes one of the detection reagents for Klebsiella pneumoniae or the fermentation bacteria and the detection reagents for carbapenemase.

[0019] One or more technical solutions in the embodiments of the present invention have at least the following technical effects or advantages:

[0020] The invention provides a strain of Klebsiella pneumoniae and an application of a detection reagent thereof in preparing a drug resistance detection product. The Klebsiella pneumoniae (Klebsiella pneumoniae) has a deposit number of CCTCC M 20242224, and the strain can produce a rare carbapenemase, which is a Klebsiella pneumoniae carbapenemase (KPC) subtype that has not been reported yet, and is resistant to multiple antimicrobial drugs, especially novel enzyme inhibitor drugs such as ceftazidime-avibactam, imipenem-relebactam, and meropenem-vilbobactam. The strain has clinical application prospects as a standard strain of multidrug-resistant bacteria.

[0021] The Klebsiella pneumoniae of the present invention is deposited on October 16, 2024, and the deposit number is CCTCC NO: M20242224. Its classification name is Klebsiella pneumoniae TJKP220321384, and the depository name is China Center for Type Culture Collection, with an address of Wuhan University, Wuhan City, Hubei Province, China, zip code: 430072. BRIEF DESCRIPTION OF THE DRAWINGS

[0022] In order to more clearly illustrate the technical solutions in the embodiments of the present invention, the following briefly introduces the drawings required for use in the description of the embodiments. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without creative work.

[0023] Figure 1 is a phylogenetic tree of Klebsiella pneumoniae of the present invention;

[0024] Figure 2 The search results of the specific molecular target of the present invention in the NCBI database;

[0025] Figure 3 It is the comparison result of the specific molecular target of the present invention, namely the novel KPC variant sequence, and KPC-2 with Gene ID KJ151293.1 in the NCBI database. DETAILED DESCRIPTION

[0026] The present invention will be described in detail below in conjunction with specific implementations and examples, and the advantages and various effects of the present invention will be more clearly presented. It should be understood by those skilled in the art that these specific implementations and examples are used to illustrate the present invention, rather than to limit the present invention.

[0027] Throughout the specification, unless otherwise specifically stated, the terms used herein should be understood as meanings commonly used in the art. Therefore, unless otherwise defined, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art to which the present invention belongs. In the event of a conflict, the present specification takes precedence.

[0028] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or obtained by existing methods.

[0029] The following is a detailed description of a strain of Klebsiella pneumoniae and its application in combination with examples and experimental data. Example 1: Isolation, purification and identification of Klebsiella pneumoniae

[0030] (1) Isolation of Klebsiella pneumoniae

[0031] The bronchoscopic lavage fluid specimens from patients with respiratory tract infection were inoculated on sheep blood plates and vancomycin-containing chocolate plates and incubated overnight at 35°C. The large white moist colonies grown on the plates were further identified.

[0032] (2) Identification of Klebsiella pneumoniae

[0033] The strain was identified as Klebsiella pneumoniae by matrix-assisted laser desorption ionization-time of flight mass spectrometry and 16S rDNA sequencing. The results of strain identification are shown in Figure 1 We named the bacterium TJKP220321384. It was deposited in the China Center for Type Culture Collection (deposit address: Wuhan University, Wuhan, China) on October 16, 2024, and its classification name was Klebsiella pneumoniae, and the deposit number was CCTCC M 20242224.

[0034] Example 2, drug sensitivity test of TJKP220321384

[0035] The drug sensitivity test of TJKP220321384 was performed using the broth microdilution method. The drug sensitivity test method and result interpretation were based on the drug sensitivity test standard CLSIM100 ED34 released by the Clinical and Laboratory Standards Institute (CLSI) in 2024. Tigecycline was interpreted according to the breakpoints of the Food and Drug Administration (FDA).

[0036] The results showed that the minimum inhibitory concentration (MIC) and sensitivity of commonly used antimicrobial drugs to TJKP220321384 were as follows: ceftazidime>128μg / ml resistant, ceftazidime-avibactam>128μg / ml resistant, imipenem 4μg / ml resistant, imipenem-relebactam 4μg / ml intermediate, meropenem 32μg / ml resistant, meropenem-virbobactam 16μg / ml resistant, cefepime 128μg / ml resistant, aztreonam>128μg / ml resistant, ciprofloxacin>128μg / ml resistant, amikacin>128μg / ml resistant, trimethoprim-sulfamethoxazole>128μg / ml resistant, polymyxin E 1μg / ml sensitive, polymyxin B 0.5μg / ml sensitive, tigecycline 4μg / ml intermediate.

[0037] The results show that TJKP220321384 of this patent application is a super-resistant bacteria, which is resistant to commonly used antibacterial drugs and new β-lactamase inhibitor combination preparations (ceftazidime-avibactam, imipenem-relebactam, meropenem-vilbobactam), and only retains sensitivity to polymyxins. It can be used as a standard strain for detecting super-resistant bacteria.

[0038] Example 3, Detection of TJKP220321384

[0039] 1. TJKP220321384 Carbapenemase detection

[0040] The carbapenemase gene carried by TJKP220321384 was detected using the GeneXpert Carba-R kit (purchased from Cepheid, catalog number GXCARBAR-CN-10), and the results showed that the strain carried the KPC type carbapenemase gene. The gene sequence of the new mutant subtype of KPC is shown in SEQ ID NO.1, and the protein sequence of the new mutant subtype of KPC is shown in SEQ ID NO.2.

[0041] 2. TJKP220321384 carbapenemase gene KPC mutation detection

[0042] KPC mutation detection was completed using whole genome sequencing and polymerase chain reaction (PCR) amplification sequencing.

[0043] (1) Whole genome sequencing of specific molecular target genes of standard strains

[0044] Whole genome sequencing was performed using PacBio Sequel IIe and Illumina NovaSeq X Plus platforms, and drug resistance genes were annotated using the CARD database. The results showed that an IncR-type plasmid with a size of 139,340 bp carried a 900 bp long KPC gene.

[0045] The gene sequence of the new KPC mutant subtype is shown in SEQ ID NO.1. The sequence was compared with the NCBI database (https: / / blast.ncbi.nlm.nih.gov / ). The results showed that the KPC gene of TJKP220321384 did not match any of the currently reported KPC subtypes. Figure 2 ; Compared with the main prevalent KPC subtype KPC-2, there is an 18-base insertion, such as Figure 3 The results of the comparison with KPC-2 with Gene ID KJ151293.1 in the NCBI database are shown.

[0046] (2) PCR amplification and sequencing of specific molecular target genes of standard strains

[0047] The target gene is amplified using a primer pair targeting the KPC gene, and the nucleotide sequence of the primer pair is shown in SEQ ID NO.3-SEQ ID NO.4.

[0048] Table 1

[0049] name Sequence (5'-3') F CGTCTAGTTCTGCTGTCTTG(SEQ ID NO.3) R CTTGTCATCCTTGTTAGGCG(SEQ ID NO.4)

[0050] The information of PCR reaction system and reaction procedure is shown in Tables 2 and 3 below:

[0051] Table 2

[0052] System components volume Strain DNA template 1μL TakaRa Primer STAR Max 12.5μL Forward primer 1μL Reverse primer 1μL <![CDATA[ddH2O]]> 9.5μL Total volume 25μL

[0053] Table 3

[0054]

[0055]

[0056] The KPC gene fragment obtained by amplification was sequenced and confirmed to be consistent with the whole genome sequencing, which is a newly discovered KPC variant. Therefore, this strain can be used as a standard strain for special drug-resistant gene detection and for the development of colloidal gold detection kits. The nucleic acid molecules amplified by the primers were sequenced and compared with the SEQ ID NO.1 sequence, and the comparison result was 100%.

[0057] 3. Expression and purification of TJKP220321384 specific molecular target protein

[0058] The specific target gene fragment was amplified based on the known sequence and specific primers, and the PCR product was purified and cloned into the pCR-Blunt vector (Invitrogen, Thermo Fisher Scientific). The recombinant expression vector of the specific molecular target was constructed, and the recombinant plasmid was transformed into Escherichia coli TOP10 (Invitrogen, Thermo Fisher Scientific), screened with MH agar containing 50 μg / ml kanamycin and 50 μg / ml ampicillin, and verified by sequencing.

[0059] Bacterial cells that successfully expressed specific proteins were resuspended in 15mM sodium phosphate buffer (pH 7.0). Cells were destroyed by ultrasonic treatment and debris was removed by centrifugation at 15000×g for 30 minutes at 4°C. The crude extract was then passed through a 0.45-μm microporous membrane filter (MilliporeSigma, Burlington, MA, United States) and loaded into a 10ml Poly-Prep column (Bio-Rad, Hercules, CA, USA) at a flow rate of 1ml / min, which was filled with aminophenylboronic acid agarose (Sigma). The enzyme protein was then eluted with a linear borate gradient (0 to 0.5M) in 20mM triethanolamine HCl and 0.5M NaCl (pH 7.0) at a flow rate of 1ml / min. The fractions showing β-lactamase activity were collected and their purity was assessed by electrophoresis on a sodium dodecyl sulfate polyacrylamide gel stained with Bio-Safe Coomassie stain (Bio-Rad). The purified specific molecular target protein obtained in this way can be used in the development of colloidal gold kits for drug resistance detection.

[0060] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be equivalent replacement methods and are included in the protection scope of the present invention.

[0061] Finally, it should be noted that the terms "comprises," "includes," or any other variations thereof are intended to cover non-exclusive inclusion, such that a process, method, article, or apparatus that includes a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements that are inherent to such process, method, article, or apparatus.

[0062] Although the preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0063] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the present invention. Thus, if these modifications and variations of the present invention fall within the scope of the claims of the present invention and their equivalents, the present invention is also intended to include these modifications and variations.

Claims

1. A strain of Klebsiella pneumoniae, characterized in that: The classification name of the Klebsiella pneumoniae is Klebsiella pneumoniae, and the preservation number is CCTCC M 20242224.

2. A fermentation agent, characterized in that: The fermentation agent comprises: Fermentation broth obtained by fermenting the Klebsiella pneumoniae according to claim 1; Or the fermentation liquid is spray-dried to obtain a dry powder bacterial agent.

3. A carbapenemase, characterized in that The amino acid sequence of the carbapenemase is shown in SEQ ID NO.

2.

4. Use of a detection reagent for Klebsiella pneumoniae according to claim 1 or a fermentation agent according to claim 2 or a detection reagent for carbapenemase according to claim 3 in the preparation of a drug resistance detection product.

5. The use according to claim 4, characterized in that: The detection reagent for the Klebsiella pneumoniae or the fermentation bacteria comprises a primer pair for detecting a specific molecular target, and the specific molecular target is a nucleic acid molecule shown in SEQ ID NO.

1.

6. The use according to claim 5, characterized in that: The nucleotide sequences of the primer pairs are shown in SEQ ID NO.3-SEQ ID NO.

4.

7. The use according to claim 4, characterized in that: The carbapenemase detection reagent includes a colloidal gold immunochromatography detection kit for detecting carbapenemase.

8. A drug resistance detection product, characterized in that: The drug resistance detection product comprises one of the detection reagent for Klebsiella pneumoniae according to claim 1 or the fermentation agent according to claim 2, and the detection reagent for carbapenemase according to claim 3.

9. A drug resistance detection product according to claim 6, characterized in that: The detection reagent for Klebsiella pneumoniae includes a PCR detection kit, which contains a specific primer pair with a nucleotide sequence as shown in SEQ ID NO.3-SEQ ID NO.4.

Images