Recombinant yarrowia lipolytica capable of efficiently and rapidly producing sclareol as well as construction method and application of recombinant yarrowia lipolytica

Abstract

The invention belongs to the technical field of bioengineering, and discloses a recombinant yarrowia lipolytica capable of efficiently and rapidly producing sclareol, which is characterized in that optimized sclareol synthase related coding genes ScLPPS, ScSCS, GGPPS1, GGPPS2, ERG20 and tHMGR coding genes are inserted into a yarrowia lipolytica genome; inserting optimized pentadienol utilization pathway coding genes such as IPK, THIM and IDI coding genes; and inserting an optimized ATP: citrate lyase coding gene ACLY to obtain the ATP: citrate lyase coding gene ACLY. The recombinant yarrowia lipolytica is based on knockout of a yarrowia lipolytica strain responsible for coding a non-homologous recombination gene ku70, so that the homologous recombination capability of the yarrowia lipolytica strain is enhanced, gene integration is realized through the homologous recombination function of the yarrowia lipolytica, the genetic stability of the introduced gene can be greatly improved, and the recombinant yarrowia lipolytica strain has a good application prospect. The construction method of the recombinant yarrowia lipolytica strain is efficient and simple to operate.

Description

Technical Field

[0001] The invention belongs to the technical field of bioengineering, and in particular to a recombinant Yarrowia lipolytica for efficiently and rapidly producing sclareol, a construction method and an application thereof. Background Art

[0002] Diterpenes are the most diverse class of terpenoids, with more than 18,000 structures, and are the main secondary metabolites in nature. These molecules have a variety of biological activities, such as pleasant aroma, anticancer effects, and antimicrobial effects, and therefore have a wide range of applications in pharmaceuticals, agriculture, and food. Sclareol, a natural diterpene alcohol isolated from sage, is the most commonly used raw material for the production of semi-synthetic ambroxan. This compound is an important alternative to ambergris, a waxy substance extracted from sperm whales that has a long history of use in perfumes. In addition, due to its unique biological activity, sclareol is also considered a potential candidate pharmacophore for the treatment of Parkinson's disease.

[0003] Currently, the main source of sclareol still relies heavily on traditional plant extraction, and most of the sclareol is extracted from the sepals of sage. However, as part of a complex mixture, the concentration of sclareol in plants is low, requiring a laborious and costly purification process. In addition, it should be noted that due to the different accumulation levels of sclareol in sage and the differences in extraction processes, the yield of sclareol varies greatly, and it is difficult to ensure stable sclareol production capacity through plant extraction. In addition, the rapid development of synthetic biology has made microorganisms a potential alternative to traditional methods for producing sclareol.

[0004] Yarrowia lipolytica is also an FDA-certified non-conventional safe oil-producing yeast. Its advantages are sufficient intracellular acetyl CoA / cofactor supply and good cell tolerance. The produced oil can also encapsulate lipophilic terpenes to enhance terpenoid storage capacity. In addition, Gibson, Gateway, BioBricks, and in vivo one-step assembly methods have been established in Yarrowia lipolytica; as well as genome manipulation tools including TALEN, CRISPR / Cas9, CRISPRa, CRISPRi, Cpf1, base editors, Cre / Loxp, URA / TRPBlaster, and metabolic engineering techniques including push-pull strategy, multi-copy integration strategy, promoter / terminator engineering, regionalization strategy, random integration / piggyBac transposition screening system, computer-aided genome-scale metabolic network design and other DNA assembly tools.

[0005] At present, there are many reports on the high production of sclareol by heterologous Yarrowia lipolytica, but the production of sclareol by Yarrowia lipolytica has the problems of low yield and low production efficiency. By recombining Yarrowia lipolytica po1f, the engineered bacteria were fermented in a 5L fermenter for 8 days, consuming 180g / L of sugar, and the sclareol yield obtained was 8510mg / L (CN117264792B). Recombining Yarrowia lipolytica Po1fΔku70, the engineered bacteria were fermented in a shake flask for 5 days, consuming 60g / L of sugar, and the sclareol yield obtained was 919mg / L (CN114989997B). Therefore, the existing strategy for recombining Yarrowia lipolytica to produce sclareol has a long fermentation cycle on the one hand and a low conversion efficiency of glucose to sclareol on the other. Summary of the invention

[0006] The purpose of the present invention is to overcome the deficiencies in the prior art and provide a recombinant Yarrowia lipolytica for efficiently and rapidly producing sclareol, a construction method and an application thereof.

[0007] The technical solution adopted by the present invention to solve its technical problem is:

[0008] A recombinant Yarrowia lipolytica for efficiently and rapidly producing sclareol, wherein the recombinant Yarrowia lipolytica is obtained by inserting optimized sclareol synthase-related coding genes ScLPPS, ScSCS, GGPPS1, GGPPS2, ERG20, and tHMGR coding genes into the Yarrowia lipolytica genome; then inserting optimized pentadienol utilization pathway (IUP) coding genes IPK, THiM, and IDI coding genes; and finally inserting optimized ATP:citrate lyase coding gene ACLY;

[0009] Among them, the gene sequences of the optimized sclareol synthase-related encoding genes ScLPPS, ScSCS, GGPPS1, GGPPS2, ERG20, and tHMGR encoding genes are shown in SEQ ID NO.1 to SEQ ID NO.6, respectively;

[0010] The gene sequences of the optimized pentadienol utilization pathway encoding genes IPK, THiM, and IDI are shown in SEQ ID NO.7 to SEQ ID NO.9 respectively;

[0011] The gene sequence of the citrate lyase encoding gene ACLY is shown in SEQ ID NO.10.

[0012] Furthermore, the recombinant Yarrowia lipolytica is obtained by inserting into the Yarrowia lipolytica genome an expression cassette of sclareol synthase-related encoding genes tHMGR, ERG20, GGPPS1, GGPPS2, ScLPPS, and ScSCS, an expression cassette of IUP pathway encoding genes THiM, IPK, and ID, and an expression cassette of ATP:citrate lyase encoding gene ACLY.

[0013] Furthermore, the sclareol synthase-related gene expression cassette, the IUP pathway encoding gene expression cassette and the ACLY encoding gene expression cassette are introduced into the Yarrowia lipolytica in the form of plasmids and then integrated into the Yarrowia lipolytica genome.

[0014] Furthermore, the Yarrowia lipolytica is Yarrowia lipolytica Po1fΔku70;

[0015] Alternatively, the promoter of the sclareol synthase encoding gene expression cassette is P TEFin Promoter, P TEF Promoter or P EXP promoter; the terminator of the gene encoding the sclareol synthase is T of Yarrowia lipolytica XPR2T Terminator, T CYC1t Terminator or T lip1t terminator;

[0016] Alternatively, the promoter of the IUP pathway encoding gene expression cassette is P of Yarrowia lipolytica. TEFin Promoter, P TEF Promoter or P EXP promoter; the IUP pathway encoding gene terminator is T of Yarrowia lipolytica XPR2T Terminator, T CYC1t Terminator or T lip1t terminator;

[0017] Alternatively, the promoter of the ACLY expression cassette is P TEFin Promoter, P TEF Promoter or P EXP The ACLY terminator is T of Yarrowia lipolytica XPR2T Terminator, T CYC1t Terminator or T lip1t Terminator.

[0018] The method for constructing the recombinant Yarrowia lipolytica as described above comprises the following steps:

[0019] (1) Construction of recombinant plasmid sclareol synthase encoding gene expression cassette:

[0020] According to the nucleotide sequence of the gene encoding lysine pyrophosphate synthase from Salvia sclarea provided by NCBI, its GenBank accession number is HQ641451.1, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized lysine pyrophosphate synthase encoding gene SsLPPS, whose gene sequence is SEQ ID No. 1, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-SsLPPS;

[0021] According to the nucleotide sequence of the sclareol synthase encoding gene from Salvia sclarea provided by NCBI, its GenBank accession number is JQ478435.1, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized sclareol synthase encoding gene SsSCS, whose gene sequence is SEQ ID No. 2, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-SsSCS;

[0022] According to the nucleotide sequence of the geranylgeranyl pyrophosphate synthase encoding gene from Platycodon grandiflorus (GenBank accession number: ON595532.1) provided by NCBI, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized geranylgeranyl pyrophosphate synthase 1 encoding gene GGPPS1, whose gene sequence is SEQ ID No. 3, and inserted into plasmid pUC57 to obtain plasmid pUC57-GGPPS1;

[0023] According to the nucleotide sequence of the geranylgeranyl pyrophosphate synthase 2 encoding gene synthase from Gardenia jasminoides (GenBank accession number: XM_448787.1) provided by NCBI, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named as geranylgeranyl pyrophosphate synthase 2 encoding gene GGPPS2, whose gene sequence is SEQ ID No. 4, and inserted into plasmid pUC57 to obtain plasmid pUC57-GGPPS2;

[0024] According to the nucleotide sequence of the farnesyl pyrophosphate synthase encoding gene from Candida glabrata (GenBank accession number: KY631921.1) provided by NCBI, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named as the farnesyl pyrophosphate synthase encoding gene ERG20, whose gene sequence is SEQ ID No. 5, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-ERG20;

[0025] According to the nucleotide sequence of the mevalonate pathway rate-limiting enzyme encoding gene from Kluyveromyces lactis (GenBank accession number: MT019283.1) provided by NCBI, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named as the mevalonate pathway rate-limiting enzyme encoding gene tHMG, whose gene sequence is SEQ ID No. 6, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-tHMG;

[0026] (2) Construction of recombinant plasmid IUP pathway encoding gene expression cassette:

[0027] According to the nucleotide sequence of the phosphokinase encoding gene synthase from Methanocaldococcusjannaschii (GenBank accession number: NZ_JAXJXF010000032.1) provided by NCBI, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named as the phosphokinase encoding gene IPK, whose gene sequence is SEQ ID No.7, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-IPK;

[0028] According to the nucleotide sequence of the hydroxyethylthiazole kinase encoding gene from Escherichia coli str. K-12 provided by NCBI (GenBank accession number: NC_000913.3), after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named as the hydroxyethylthiazole kinase encoding gene THiM, whose gene sequence is SEQ ID No. 8, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-THiM;

[0029] According to the nucleotide sequence of the isopentenyl pyrophosphate isomerase encoding gene from house mouse (Mus musculus) provided by NCBI (GenBank accession number: ID: 319554), after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named isopentenyl pyrophosphate isomerase encoding gene IDI, whose gene sequence is SEQ ID No. 9, and inserted into plasmid pUC57 to obtain plasmid pUC57-IDI;

[0030] (3) Construction of recombinant plasmid ACLY encoding gene expression cassette:

[0031] According to the nucleotide sequence of the ATP citrate lyase encoding gene from human (Homo sapiens) provided by NCBI (GenBank accession number: CCDS11412.1), after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named ATP citrate lyase encoding gene ACLY, whose gene sequence is SEQ ID No. 10, and inserted into plasmid pUC57 to obtain plasmid pUC57-ACLY;

[0032] (4) The plasmids pUC57-SsLPPS, pUC57-tHMG, pUC57-ERG20, pUC57-GGPPS1, pUC57-GGPPS2, and pUC57-SsLPPS were introduced into Yarrowia lipolytica Polf-Δku70 to obtain the recombinant bacterium ZHMW-1, which is a recombinant Yarrowia lipolytica producing sclareol; the recombinant plasmids pUC57-IPK, pUC57-THiM, and pUC57-IDI were introduced into the recombinant bacterium ZHMW-1 to obtain the recombinant bacterium ZHMW-2, which is a recombinant Yarrowia lipolytica producing high sclareol; the recombinant plasmid pUC57-ACLY was introduced into the recombinant bacterium ZHMW-2 to obtain the recombinant bacterium ZHMW-3, which is a recombinant Yarrowia lipolytica producing high sclareol.

[0033] Use of the recombinant Yarrowia lipolytica as described above in the fermentation production of sclareol.

[0034] The method for producing sclareol by fermentation using the recombinant Yarrowia lipolytica as described above comprises the following steps:

[0035] Activate the recombinant bacteria, and culture them in YPD liquid medium at 28-30°C and 200-240rpm for 16 hours to obtain seed solution;

[0036] The seed liquid was inoculated into the fermentation medium at an inoculum volume ratio of 1%, and the culture was shaken at 30°C and 220 rpm for 1 day, and then an organic solvent of 10-25% of the volume of the fermentation liquid was added, and the culture was shaken for 3 more days;

[0037] After the fermentation was completed, the fermentation broth was centrifuged at 5000 rpm for 15 min, and the upper organic phase was collected;

[0038] The fermentation medium contains 40-80 g / L glucose, 10 g / L yeast powder, 20 g / L trypsin, 2 g / L prenol and 2.5 g / L isoprene alcohol, and the solvent is water.

[0039] Further, the fermentation conditions were 30°C, 220 rpm;

[0040] Alternatively, the fermentation medium contains 60 g / L glucose;

[0041] Alternatively, the organic solvent is decane or n-dodecane.

[0042] The method for producing sclareol by fermentation using the recombinant Yarrowia lipolytica as described above comprises the following steps:

[0043] A single colony of the recombinant Yarrowia lipolytica was picked and inoculated into a YPD liquid culture medium, and cultured at 28-30°C and 200-240rpm for 1 day to obtain a seed solution, and the seed solution was inoculated into a fermentation medium at an inoculation rate of 5%, and fermented at 30°C, with a stirring speed of 550rpm, an aeration ratio of 1vvm, and dissolved oxygen of 10%-20%. 8M sodium hydroxide was added to adjust the pH to 6.2, and the glucose content was ensured to be not less than 5g / L by feeding. The glucose concentration of the feeding glucose mother solution was 800g / L, 20g / L prenol and 25g / L isoprenol, and the fermentation was carried out for 120h.

[0044] Further, the fermentation conditions were 30°C, 220 rpm;

[0045] Alternatively, the fermentation medium components are 60 g / L glucose, 10 g / L yeast powder, 20 g / L trypsin, 2 g / L prenol and 2.5 g / L isoprene alcohol, and the solvent is water.

[0046] The advantages and positive effects achieved by the present invention are:

[0047] 1. The recombinant Yarrowia lipolytica constructed by the present invention is based on a Yarrowia lipolytica strain that has been knocked out of the non-homologous recombination gene ku70, so that its homologous recombination ability is enhanced, and the integration of genes is achieved through the homologous recombination function of Yarrowia lipolytica itself, which can greatly improve the genetic stability of the introduced genes. The construction method of the recombinant Yarrowia lipolytica strain is efficient and simple to operate. The present invention constructs a recombinant Yarrowia lipolytica strain that produces sclareol by genetic engineering means, which provides an effective idea for the metabolic engineering transformation of Yarrowia lipolytica.

[0048] 2. Yarrowia lipolytica is a safety-certified oleaginous yeast with a strong ability to synthesize oils. The target product, sclareol, is easily soluble in a fat-soluble environment, which provides a good intracellular environment for the production of sclareol in Yarrowia lipolytica.

[0049] 3. The recombinant Yarrowia lipolytica strain of the present invention achieves efficient synthesis of sclareol by overexpressing genes related to the IUP pathway.

[0050] 4. The recombinant Yarrowia lipolytica strain of the present invention significantly improves the conversion efficiency of glucose to sclareol by introducing ATP citrate lyase.

[0051] 5. The method for collecting products provided by the present invention adopts a method of simultaneous fermentation and extraction, and the produced sclareol is extracted into the organic phase in a timely manner, which relieves the pressure of intracellular dissolution of sclareol and effectively increases the yield of sclareol.

[0052] 6. The present invention first discovered that the optimized sclareol synthase-related coding genes tHMG, ERG20, GGPPS1, GGPPS2, SsLPPS, and SsSCS inserted into Yarrowia lipolytica in combination with the IUP expression cassette (THiM, IDI, IPK) and the ACLY expression cassette can efficiently produce sclareol.

[0053] 7. The present invention discovered that the coding genes related to sclareol synthase can be expressed in Yarrowia lipolytica to enable it to produce sclareol. At the same time, the present invention is the first to achieve mass production of sclareol by combining an IUP expression cassette, and for the first time, the ACLY expression cassette is applied to the production of sclareol, which greatly improves the production efficiency of sclareol and realizes efficient and rapid production of sclareol. Continuing to transform this strain has broad prospects for industrial application.

[0054] 8. Yarrowia lipolytica can synthesize a large amount of acetyl-CoA as the starting substrate of the mevalonate (MVA) pathway, making it an ideal cell factory for synthesizing acetyl-CoA derivatives (such as terpenes or polyketides), providing more geranyl diphosphate (GPP), farnesyl diphosphate (FPP) and geranyl diphosphate (GGPP) for the accumulation of various terpenoids. On the other hand, a large amount of oil accumulates in lipid droplets, which can store lipophilic terpenoids and become a valuable host for the production of terpenoids. In the mevalonate pathway (MVA), IPP and DMAPP are the common precursors of all terpenes. DMAPP can successively generate different isopentenyl diphosphate precursors by condensing with different amounts of IPP. DMAPP and one molecule of IPP generate the monoterpene precursor GPP (C10) under the catalysis of geranyl diphosphate synthase (GPP synthase). GPP and one molecule of IPP generate the sesquiterpene precursor FPP (C15) under the catalysis of farnesyl diphosphate synthase (FPP synthase). FPP can produce different terpene compounds under the action of different terpene synthases. BRIEF DESCRIPTION OF THE DRAWINGS

[0055] Figure 1 Schematic diagram of sclareol biosynthesis of the recombinant strain ZHMW-3 of the present invention;

[0056] Figure 2 This is a nucleic acid gel image of the gene related to sclareol synthesis of the recombinant strain of the present invention;

[0057] Figure 3 This is a gel map of the nucleic acid encoding gene of the IUP pathway of the recombinant strain of the present invention;

[0058] Figure 4 It is a nucleic acid gel image of the recombinant strain ACLY encoding gene in the present invention;

[0059] Figure 5 This is a GC-MS detection diagram of sclareol produced by the recombinant bacteria of the present invention;

[0060] Figure 6 The figure is a comparison of the production of sclareol by the recombinant bacteria ZHMW-1, ZHMW-2 and ZHMW-3 of the present invention;

[0061] Figure 7 This is a diagram showing the fermentation results of the recombinant bacteria ZHMW-3 in the present invention in a 5L fermenter. DETAILED DESCRIPTION

[0062] The present invention will be further described below in conjunction with the embodiments. The following embodiments are descriptive rather than restrictive, and the protection scope of the present invention cannot be limited by the following embodiments.

[0063] The various experimental operations involved in the specific embodiments are all routine techniques in the art. For parts not specially annotated in this document, ordinary technicians in the art can implement them by referring to various commonly used reference books, scientific and technological literature or related instructions, manuals, etc. before the filing date of this invention.

[0064] A recombinant Yarrowia lipolytica for efficiently and rapidly producing sclareol, wherein the recombinant Yarrowia lipolytica is obtained by inserting optimized sclareol synthase-related coding genes ScLPPS, ScSCS, GGPPS1, GGPPS2, ERG20, and tHMGR coding genes into the Yarrowia lipolytica genome; then inserting optimized pentadienol utilization pathway (IUP) coding genes IPK, THiM, and IDI coding genes; and finally inserting optimized ATP:citrate lyase coding gene ACLY;

[0065] Among them, the gene sequences of the optimized sclareol synthase-related encoding genes ScLPPS, ScSCS, GGPPS1, GGPPS2, ERG20, and tHMGR encoding genes are shown in SEQ ID NO.1 to SEQ ID NO.6, respectively;

[0066] The gene sequences of the optimized pentadienol utilization pathway encoding genes IPK, THiM, and IDI are shown in SEQ ID NO.7 to SEQ ID NO.9 respectively;

[0067] The gene sequence of the citrate lyase encoding gene ACLY is shown in SEQ ID NO.10.

[0068] Preferably, the recombinant Yarrowia lipolytica is obtained by inserting into the Yarrowia lipolytica genome an expression cassette of sclareol synthase-related encoding genes tHMGR, ERG20, GGPPS1, GGPPS2, ScLPPS, and ScSCS, an expression cassette of IUP pathway encoding genes THiM, IPK, and ID, and an expression cassette of ATP:citrate lyase encoding gene ACLY.

[0069] Preferably, the sclareol synthase-related gene expression cassette, the IUP pathway encoding gene expression cassette and the ACLY encoding gene expression cassette are introduced into the Yarrowia lipolytica in the form of plasmids and then integrated into the Yarrowia lipolytica genome.

[0070] Preferably, the Yarrowia lipolytica is Yarrowia lipolytica Po1fΔku70;

[0071] Alternatively, the promoter of the sclareol synthase encoding gene expression cassette is P TEFin Promoter, P TEFPromoter or P EXP promoter; the terminator of the gene encoding the sclareol synthase is T of Yarrowia lipolytica XPR2T Terminator, T CYC1t Terminator or T lip1t terminator;

[0072] Alternatively, the promoter of the IUP pathway encoding gene expression cassette is P of Yarrowia lipolytica. TEFin Promoter, P TEF Promoter or P EXP promoter; the IUP pathway encoding gene terminator is T of Yarrowia lipolytica XPR2T Terminator, T CYC1t Terminator or T lip1t terminator;

[0073] Alternatively, the promoter of the ACLY expression cassette is P TEFin Promoter, P TEF Promoter or P EXP The ACLY terminator is T of Yarrowia lipolytica XPR2T Terminator, T CYC1t Terminator or T lip1t Terminator.

[0074] The method for constructing the recombinant Yarrowia lipolytica as described above, Figure 1 As shown, the following steps are included:

[0075] (4) Construction of recombinant plasmid sclareol synthase encoding gene expression cassette:

[0076] According to the nucleotide sequence of the gene encoding lysine pyrophosphate synthase from Salvia sclarea provided by NCBI, its GenBank accession number is HQ641451.1, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized lysine pyrophosphate synthase encoding gene SsLPPS, whose gene sequence is SEQ ID No. 1, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-SsLPPS;

[0077] According to the nucleotide sequence of the sclareol synthase encoding gene from Salvia sclarea provided by NCBI, its GenBank accession number is JQ478435.1, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized sclareol synthase encoding gene SsSCS, whose gene sequence is SEQ ID No. 2, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-SsSCS;

[0078] According to the nucleotide sequence of the geranylgeranyl pyrophosphate synthase encoding gene from Platycodon grandiflorus (GenBank accession number: ON595532.1) provided by NCBI, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized geranylgeranyl pyrophosphate synthase 1 encoding gene GGPPS1, whose gene sequence is SEQ ID No. 3, and inserted into plasmid pUC57 to obtain plasmid pUC57-GGPPS1;

[0079] According to the nucleotide sequence of the geranylgeranyl pyrophosphate synthase 2 encoding gene synthase from Gardenia jasminoides (GenBank accession number: XM_448787.1) provided by NCBI, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named as geranylgeranyl pyrophosphate synthase 2 encoding gene GGPPS2, whose gene sequence is SEQ ID No. 4, and inserted into plasmid pUC57 to obtain plasmid pUC57-GGPPS2;

[0080] According to the nucleotide sequence of the farnesyl pyrophosphate synthase encoding gene from Candida glabrata (GenBank accession number: KY631921.1) provided by NCBI, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named as the farnesyl pyrophosphate synthase encoding gene ERG20, whose gene sequence is SEQ ID No. 5, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-ERG20;

[0081] According to the nucleotide sequence of the mevalonate pathway rate-limiting enzyme encoding gene from Kluyveromyces lactis (GenBank accession number: MT019283.1) provided by NCBI, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named as the mevalonate pathway rate-limiting enzyme encoding gene tHMG, whose gene sequence is SEQ ID No. 6, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-tHMG;

[0082] Sclareol-related nucleic acid detection gel image Figure 2 As shown, the full length of SsLPPS gene is 2358 bp, the full length of SsSCS gene is 1725 bp, the full length of GGPPS1 gene is 1098 bp, the full length of GGPPS2 gene is 1155 bp, the full length of ERG20 gene is 1056 bp, and the full length of tHMG gene is 2984 bp.

[0083] (5) Construction of recombinant plasmid IUP pathway encoding gene expression cassette:

[0084] According to the nucleotide sequence of the phosphokinase encoding gene synthase from Methanocaldococcusjannaschii (GenBank accession number: NZ_JAXJXF010000032.1) provided by NCBI, after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named as the phosphokinase encoding gene IPK, whose gene sequence is SEQ ID No.7, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-IPK;

[0085] According to the nucleotide sequence of the hydroxyethylthiazole kinase encoding gene from Escherichia coli str. K-12 provided by NCBI (GenBank accession number: NC_000913.3), after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named as the hydroxyethylthiazole kinase encoding gene THiM, whose gene sequence is SEQ ID No. 8, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-THiM;

[0086] According to the nucleotide sequence of the isopentenyl pyrophosphate isomerase encoding gene from house mouse (Mus musculus) provided by NCBI (GenBank accession number: ID: 319554), after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named isopentenyl pyrophosphate isomerase encoding gene IDI, whose gene sequence is SEQ ID No. 9, and inserted into plasmid pUC57 to obtain plasmid pUC57-IDI;

[0087] IUP related pathway gene nucleic acid detection gel image Figure 3 As shown, the full length of the IPK gene is 801 bp, the full length of the THiM gene is 789 bp, and the full length of the IDI gene is 852 bp.

[0088] (6) Construction of recombinant plasmid ACLY encoding gene expression cassette:

[0089] According to the nucleotide sequence of the ATP citrate lyase encoding gene from human (Homo sapiens) provided by NCBI (GenBank accession number: CCDS11412.1), after codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized nucleotide sequence, named ATP citrate lyase encoding gene ACLY, whose gene sequence is SEQ ID No. 10, and inserted into plasmid pUC57 to obtain plasmid pUC57-ACLY;

[0090] ACLY gene nucleic acid detection gel image Figure 4 As shown, the full length of ACLY gene is 3306 bp.

[0091] (4) The plasmids pUC57-SsLPPS, pUC57-tHMG, pUC57-ERG20, pUC57-GGPPS1, pUC57-GGPPS2, and pUC57-SsLPPS were introduced into Yarrowia lipolytica Polf-Δku70 to obtain the recombinant bacterium ZHMW-1, which is a recombinant Yarrowia lipolytica producing sclareol; the recombinant plasmids pUC57-IPK, pUC57-THiM, and pUC57-IDI were introduced into the recombinant bacterium ZHMW-1 to obtain the recombinant bacterium ZHMW-2, which is a recombinant Yarrowia lipolytica producing high sclareol; the recombinant plasmid pUC57-ACLY was introduced into the recombinant bacterium ZHMW-2 to obtain the recombinant bacterium ZHMW-3, which is a recombinant Yarrowia lipolytica producing high sclareol.

[0092] Use of the recombinant Yarrowia lipolytica as described above in the fermentation production of sclareol.

[0093] The method for producing sclareol by fermentation using the recombinant Yarrowia lipolytica as described above comprises the following steps:

[0094] Activate the recombinant bacteria, and culture them in YPD liquid medium at 28-30°C and 200-240rpm for 16 hours to obtain seed solution;

[0095] The seed liquid was inoculated into the fermentation medium at an inoculum volume ratio of 1%, and the culture was shaken at 30°C and 220 rpm for 1 day, and then an organic solvent of 10-25% of the volume of the fermentation liquid was added, and the culture was shaken for 3 more days;

[0096] After the fermentation was completed, the fermentation broth was centrifuged at 5000 rpm for 15 min, and the upper organic phase was collected;

[0097] The fermentation medium contains 40-80 g / L glucose, 10 g / L yeast powder, 20 g / L trypsin, 2 g / L prenol and 2.5 g / L isoprene alcohol, and the solvent is water.

[0098] The fermentation medium contains 60 g / L glucose, 10 g / L yeast powder, 20 g / L trypsin, 2 g / L prenyl alcohol and 2.5 g / L isoprene alcohol, and the solvent is water.

[0099] Preferably, the fermentation conditions are 30°C, 220rpm;

[0100] Alternatively, the fermentation medium contains 60 g / L glucose;

[0101] Alternatively, the organic solvent is decane or n-dodecane.

[0102] The method for producing sclareol by fermentation using the recombinant Yarrowia lipolytica as described above comprises the following steps:

[0103] A single colony of the recombinant Yarrowia lipolytica was picked and inoculated into a YPD liquid culture medium, and cultured at 28-30°C and 200-240rpm for 1 day to obtain a seed solution, and the seed solution was inoculated into a fermentation medium at an inoculation rate of 5%, and fermented at 30°C, with a stirring speed of 550rpm, an aeration ratio of 1vvm, and dissolved oxygen of 10%-20%. 8M sodium hydroxide was added to adjust the pH to 6.2, and the glucose content was ensured to be not less than 5g / L by feeding. The glucose concentration of the feeding glucose mother solution was 800g / L, 20g / L prenol and 25g / L isoprenol, and the fermentation was carried out for 120h.

[0104] Preferably, the fermentation conditions are 30°C, 220rpm;

[0105] Alternatively, the fermentation medium components are 60 g / L glucose, 10 g / L yeast powder, 20 g / L trypsin, 2 g / L prenol and 2.5 g / L isoprene alcohol, and the solvent is water.

[0106] Specifically, the relevant preparation and detection are as follows:

[0107] Plasmid construction used competent Escherichia coli DH5α purchased from Nanjing Qingke Biotechnology Co., Ltd.;

[0108] The competent cells of wild-type and recombinant Yarrowia lipolytica were prepared according to the operating method of the yeast transformation kit Frozen-EZ Yeast Transformation IITM, and the specific method was as follows: resuspend with 1 mL of EZ1, centrifuge at 4°C and 4000 rpm for 3 min to collect the cells again; discard the supernatant, suspend the cells with 100 μL of EZ2, divide into 50L portions, and store at -80°C to obtain the competent cells of Yarrowia lipolytica;

[0109] Nucleic acid gel preparation and detection were performed according to conventional methods;

[0110] Qualitative and quantitative analysis of sclareol: The organic phase in the fermentation broth to be tested was filtered through an organic nylon filter (0.22um) and tested by GC-MS. Testing conditions: injection port temperature 250°C, injection volume 1ul, split ratio 20:1; chromatographic column: HP-5ms (30m*0.25mM); chromatographic conditions: initial temperature 60°C, rising to 150°C at a rate of 10°C / min, then rising to 280°C at 20°C / min, and holding for 2min. Use sclareol standard for qualitative and quantitative analysis.

[0111] Unless otherwise specified, the materials and reagents used in the examples of the present invention can be obtained from commercial sources. Experimental methods without specific conditions in the examples are usually carried out under conventional conditions or under conditions recommended by the manufacturer.

[0112] Yarrowia lipolytica Po1fΔku70 (MatA, ura3-302, leu2-270, xpr2-322, axp2-delta, NU49, XPR2::SUC2 MYA2613Δku70::hisG) is Yarrowia lipolytica. The original strain MYA2613 was purchased from the American Type Culture Collection (ATCC), and the coding gene ku70 responsible for non-homologous recombination was knocked out to obtain Yarrowia lipolytica Po1fΔku70 (MYA2613Δku70) (see Gao S, Tong Y, Zhu L, et al. Iterative integration of multiple-copy pathway genes in Yarrowia lipolytica for heterologous β-carotene production [J]. Metabolic Engineering, 2017: 192.).

[0113] Example 1 Amplification of genetic elements and preparation of target plasmids

[0114] 1. Preparation of target gene

[0115] According to the nucleotide sequences of sclareol synthase-encoding related genes tHMG, ERG20, GGPPS1, GGPPS2, SsLPPS, SsSCS, and IUP pathway-related genes THiM, IDI, IPK and ACLY provided by NCBI, after specific codon optimization, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the optimized sclareol synthase-encoding related genes tHMG, ERG20, GGPPS1, GGPPS2, SsLPPS, SsSCS, and IUP pathway-related genes THiM, IDI, IPK and ACLY, and inserted them into plasmid pUC57 to obtain plasmids pUC57-SsLPPS, pUC57-tHMG, pUC57-ERG20, pUC57-GGPPS1, pUC57-GGPPS2, pUC57-SsLPPS, pUC57-IPK, pUC57-THiM, pUC57-IDI, and pUC57-ACLY. The optimized nucleotide sequences of ScLPPS, ScSCS, GGPPS1, GGPPS2, ERG20, tHMGR, IPK, THiM, IDI, and ACLY are shown in SEQ ID NOs. 1-10.

[0116] According to the nucleotide sequence (M37309.1) of the 3(B)-isopropylmalate dehydrogenase encoding gene leu in Yarrowia lipolytica provided on NCB1, Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize leu, and the 3(B)-isopropylmalate dehydrogenase encoding gene was inserted into the plasmid PUC to obtain the plasmid pUC-leu.

[0117] According to the nucleotide sequence of the orotate nuclease-5'-phosphate degrading enzyme encoding gene ura in Yarrowia lipolytica provided by NCBI (genebank accession number AJ306421.1) and hisG tag (genebank accession number AF324729.1), Nanjing Qingke Biotechnology Co., Ltd. was commissioned to synthesize the two hisG tag encoding gene sequences and inserted into the plasmid pUC. Specifically, pUC57 was used as the backbone, and the backbone was recovered after digestion with ECORI and HindIII. The hisG tag encoding gene was cloned in one step using ClonExpress MultiS One Step Cloning Kit to construct the plasmid pUC-hisG-hisG. This was used as the backbone, and the backbone was recovered after digestion with HindIII. The ura encoding gene was cloned using ClonExpress MultiS One Step Cloning Kit. The kit realizes one-step cloning and constructs two hisG tag encoding gene sequences, so that the orotate nucleoside-5'-phosphate dephosphorylation enzyme encoding gene is inserted into the two hisG tag encoding gene sequences to realize ura tag recovery and obtain the plasmid pUC-hisG-ura-hisG.

[0118] The genomic DNA of Yarrowia lipolytica Polf-Δku70 was used as a template and SsLPPS-F (SEQ ID NO.11) and SsLPPS-R (SEQ ID NO.12) were used as primers to amplify lisdendioyl pyrophosphate synthase SsLPPS.

[0119] The sclareol synthase SsSCS was amplified using Yarrowia lipolytica Polf-Δku70 genomic DNA as a template and SsSCS-F (SEQ ID NO.13) and SsSCS-R (SEQ ID NO.14) as primers.

[0120] The genomic DNA of Yarrowia lipolytica Polf-Δku70 was used as a template and GGPPS1-F (SEQ ID NO. 15) and GGPPS1-R (SEQ ID NO. 16) were used as primers to amplify geranylgeranyl pyrophosphate synthase 1 GGPPS1.

[0121] The genomic DNA of Yarrowia lipolytica Polf-Δku70 was used as a template and GGPPS2-F (SEQ ID NO. 17) and GGPPS2-R (SEQ ID NO. 18) were used as primers to amplify geranylgeranyl pyrophosphate synthase 2 GGPPS2.

[0122] Farnesyl pyrophosphate synthase ERG20 was amplified using Yarrowia lipolytica Polf-Δku70 genomic DNA as a template and ERG20-F (SEQ ID NO. 19) and ERG20-R (SEQ ID NO. 20) as primers.

[0123] The genomic DNA of Yarrowia lipolytica Polf-Δku70 was used as a template and tHMG-F (SEQ ID NO.21) and tHMG20-R (SEQ ID NO.22) were used as primers to amplify tHMG, the rate-limiting enzyme of the mevalonate pathway.

[0124] The genomic DNA of Yarrowia lipolytica Polf-Δku70 was used as a template and IPK-F (SEQ ID NO. 23) and IPK-R (SEQ ID NO. 24) were used as primers to amplify the phosphokinase IPK.

[0125] The genomic DNA of Yarrowia lipolytica Polf-Δku70 was used as a template and THiM-F (SEQ ID NO. 25) and THiM-R (SEQ ID NO. 26) were used as primers to amplify hydroxyethylthiazole kinase THiM.

[0126] Isopentenyl pyrophosphate isomerase IDI was amplified using Yarrowia lipolytica Polf-Δku70 genomic DNA as a template and IDI-F (SEQ ID NO. 27) and IDI-R (SEQ ID NO. 28) as primers.

[0127] ATP citrate lyase ACLY was amplified using Yarrowia lipolytica Polf-Δku70 genomic DNA as template and ACLY-F (SEQ ID NO.29) and ACLY-R (SEQ ID NO.30) as primers.

[0128] Promoter P TEFin The nucleotide sequence is shown in SEQ ID NO.31:

[0129] AGAGACCGGGTTGGCGGCGTATTTGTGTCCCAAAAAACAGCCCCAATTGCCCCAATTGACCCCAAATTGACCCAGTAGCGGGCCCAACCCCGGCGAGAGCCCCCTTCACCCCACATATCAAACCTCCCCCGGTTCCCACACTTGCCGTTAAGGGCGTAGGGTACTGCAGTCTGGAATCTACGCTTGTTCAGACTTTGTACTAGTTTCTTTGTCTGGCCATCCGGGTAACCCATGCCGGACGCAAAATAGACTACTGAAAATTTTTTTGCTTTGTGGTTGGGACTTTAGCCAAGGGTATAAAAGACCACCGTCCCCGAATTACCTTTCCTCTTCTTTTCTCTCTCTCCTTGTCAACTCACACCCGAAATCGTTAAGCATTTCCTTCTGAGTATAAGAATCATTCAAAATGGTGAGTTTCAGAGGCAGCAGCAATTGCCACGGGCTTTGAGCACACGGCCGGGTGTGGTCCCATTCCCATCGACACAAGACGCCACGTCATCCGACCAGCACTTTTTGCAGTACTAACCGCAG

[0130] Terminator T xpr2t The nucleic acid sequence is shown in SEQ ID NO. 32:

[0131] GATCCAACTACGGAACTTGTGTTGATGTCTTTGCCCCCGGCTCCGATATCATCTCTGCCTCTTACCAGTCCGACTCTGGTACTTTGGTCTACTCCGGTACCTCCATGGCCTGTCCCCACGTTGCCGGTCTTGCCTCCTACTACCTGTCCATCAATGACGAGGTTCTCACCCCTGCCCAGGTCGAGGCTCTTATTACTGAGTCCAACACCGGTGTTCTTCCCACCACCAACCTCAAGGGCTCTCCCAACGCTGTTGCCTACAACGGTGTTGGCATTTAGGCAATTAACAGATAGTTTGCCGGTGATAATTCTCTTAACCTCCCACACTCCTTTGACATAACGATTTATGTAACGAAACTGAAATTTGACCAGATATTGTTGTAAATAGAAAATCTGGCTTGTAGGTGGCAAAATCCCGTCTTTGTTCATCAATTCCCTCTGTGACTACTCGTCATCCCTTTATGTTCGACTGTCGTATTTTTATTTTCCATACATACGCAAGTGAGATGCCCGTGTC

[0132] Terminator T lip1t The nucleic acid sequence is as shown in SEQ ID NO. 33:

[0133] AACCAATAAACGAACACGTTGTTCCTAGCCCCTTTAAAGAGACAGTGCAAGTACTGTACATACTGTACTTAGAAGCATACTGGTATGTACTGTATGTACTGTACATGCTTCATCTGGCTGGATCAAAGACGATGATCAATACACAGGGACCCA ACGGGGGTGTACAATAGTGAAGGAAACAGAGTTAATAAATATATACAATTAGTGTACGTACATCTGGTAGAACAATGTGTTGGCATAATTAGGGGACGGTATGAACTGAGTCCTGCCAACCTGATGCTAACTAATGTGTGGTTGTAATTGGACTGG GTCGATTTTCGCGGGAATAGAAATCACATAGGTGTACAAGTATTTTATAATAACAAGTAACCAAAGAAGCTGTCTTAGTTGGTCGGTTCTAGTACTCCAGATTGGTATGTCCCCTATGTAATACTTACGTCGATTTTAATAAAGTTCATGCAC ACCACCATCTAACATCTCAGCCAAGTTTACTCCACACCATTATCATTACACACGCAGCACTTCTGGTATGGCATCTCTAGCAACATTTCAGGTGGAGAACGACATTGTGGACGTCGACAGCACGCCCCAACAAGGATTTGATCGAGACGACCTG

[0134] The primer sequences used in this example are shown in Table 1.

[0135] Table 1 Primer sequences

[0136] Primer name Sequence (5'→3) Serial Number SsLPPS-F ATGACTTCTGTAAATTTGAG SEQ ID NO.11 SsLPPS-R TCATACAACCGGTCGAAAGA SEQ ID NO.12 SsSCS-F ATGTCGCTCGCCTTCAACGTC SEQ ID NO.13 SsSCS-R AAAGACAAAGGATTTCATATC SEQ ID NO.14 GGPPS1-F ATGAGTATGGTAAATCTAAG SEQ ID NO.15 GGPPS1-R TCAATTGTCTCTATAAGCAAT SEQ ID NO.16 GGPPS2-F ATGAGCCTGATGAATTCAAG SEQ ID NO.17 GGPPS2-R TCAATTATCCCTGTAAGCAA SEQ ID NO.18 ERG20-F ATGTCAAAAGAAGCAAGTAGA SEQ ID NO.19 ERG20-R TTATTTAGATCTTTTGTACA SEQ ID NO.20 tHMG-F ATGACAAGACAATTCGTACC SEQ ID NO.21 tHMG-R ACTTAGTATGGTCTGTTGGA SEQ ID NO.22 IPK-F ATGATAATTTTAAAGATTGG SEQ ID NO.23 IPK-R CTAATTTCCCCTTGAAATTA SEQ ID NO.24 ThiM-F ATGCAAGTCGACCTGCTGGG SEQ ID NO.25 ThiM-R TCATGCCTGCACCTCCTGCG SEQ ID NO.26 IDI-F ATGTGGCGCGGACGGACACTG SEQ ID NO.27 IDI-R TCACAATCTATGTATTTTCTC SEQ ID NO.28 ACLY-F ATGTCGGCCAAGGCAATTTC SEQ ID NO.29 ACLY-R TTACATGCTCATGTGTTCCG SEQ ID NO.30

[0137] 2. Construction of recombinant plasmid

[0138] 1. Construction of recombinant plasmid pUC57-SsLPPS

[0139] The recombinant plasmid pUC57-SsLPPS is based on pUC-leu as the backbone, and the upstream and downstream homology arms at the A08 site in Yarrowia lipolytica Polf-Δku70 are inserted, and the SsLPPS gene expression cassette is inserted between the upstream and downstream homology arms, and the SsLPPS encoding gene expression cassette is between the upstream and downstream homology arms. Specifically, the upstream 2521bp and downstream 2031b of the A08 site are constructed into the pUC-leu backbone plasmid, and then the SsLPPS expression cassette is constructed on this plasmid, and then the plasmid is linearized and transferred into the competent state of Yarrowia lipolytica. Since the plasmid carries the homology arm of A08, the constructed SsLPPS expression cassette will be site-specifically integrated into the A08 site in the Yarrowia lipolytica genome.

[0140] Using plasmid pUC57-SsLPPS as template and SsLPPS-F2 (SEQ ID NO.34) and ACHS2-R2 (SEQ ID NO.35) as primers, amplify the promoter P at both ends. TEFin-SsLPPS and terminator T xpr2t-SsLPPS Homology arms of the SsLPPS gene.

[0141] The PCR enzyme used in the above PCR reaction is TAKARA's PrimeSTAR MaxDNA polymerase. The above PCR amplification system is as shown in Table 2:

[0142] Table 2

[0143] Reagents Usage Final concentration PrimeSTARMax(2×) 25ul 1× Primer1 10-15 pmol 0.2-0.3uM Primer2 10-15 pmol 0.2-0.3uM Template <200ng Sterile distilled water Upto50ul

[0144] The PCR program was as follows: denaturation at 98°C for 10 s, annealing at 55°C for 10 s, and extension at 72°C (extension time = target fragment length / 1 kb, unit: min), and repeated for 35 cycles.

[0145] Using AxyPrep TM Each fragment was purified and recovered using DNAGel Extraction Kit (purchased from Corning Life Sciences (Wujiang) Co., Ltd.).

[0146] The A08 site integration plasmid was digested with restriction endonuclease SnaB1 from NEB, and then the linearized A08 site integration plasmid was recovered by agarose gel electrophoresis.

[0147] The linearized A08 site was integrated into the plasmid and the constructed SsLPPS gene expression cassette (including the promoter P TEFin-SsLPPS , terminator T xpr2t-SsLPPS , with promoter P TEFin-SsLPPS and terminator T xpr2t-SsLPPSThe SsLPPS gene of the homology arm was cloned in one step using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novozyme Biotechnology Co., Ltd. The reaction system is shown in the table below. After the reaction system was incubated at 50°C for 15-30 minutes, a circular recombinant vector was obtained, and the SsLPPS gene expression cassette and the 3(B)-isopropylmalate dehydrogenase encoding gene expression cassette (selection marker) were successfully inserted between the upper and lower homology arms of the A08 site.

[0148] The one-step cloning system is shown in Table 3:

[0149] Table 3

[0150] Components Recombination reaction Linearized vector Xul N insert fragments <![CDATA[Y 1 +Y 2 +…Y n ul]]> 2 × ClonExpressMix 5ul <![CDATA[ddH 2 The]]> To10ul

[0151] X = (0.02 × number of base pairs of cloning vector) ng (0.03 pmol)

[0152] Y = (0.02 × number of base pairs per fragment) ng (0.03 pmol)

[0153] The circular recombinant vector was transformed into Escherichia coli DH5a competent cells, screened on a 50 mg / L ampicillin resistance plate and verified by colony PCR and sequencing to obtain the positive recombinant plasmid pUC57-SsLPPS, indicating a successful construction.

[0154] 2. Construction of recombinant plasmid pUC57-SsSCS

[0155] The recombinant plasmid pUC57-SsSCS is based on pUC-his-ura-hisG, and the upstream and downstream homology arms at the IntC site in Yarrowialipolytica Polf-Δku70 are inserted, and the SsSCS expression cassette is inserted between the upstream and downstream homology arms, and the orotate nuclear-5'-phosphate degrading enzyme encoding gene expression cassette is also inserted between the upstream and downstream homology arms.

[0156] The Yarrowia lipolytica Polf-Δku70 genomic DNA was used as a template and SsSCS-F2 (SEQ ID NO.36) and SsSCS-R2 (SEQ ID NO.37) were used as primers to amplify the gene with promoter P at both ends. TEFin-SsLPPS and terminator T lip1t-SsLPPS Homology arms of the SsLPPS gene.

[0157] The IntC site integration plasmid was digested with restriction endonuclease Pacl from NEB Company, and the linearized IntC site integration plasmid was recovered by agarose gel electrophoresis.

[0158] The linearized IntC site was integrated into the plasmid and the constructed SsLPPS gene expression cassette (including the promoter P TEFin-SsLPPS , terminator T lip1t-SsLPPS , with promoter P TEFin-SsLPPS and terminator T lip1t-SsLPPS The SsLPPS gene of the homology arm was cloned in one step using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novogene Biotechnology Co., Ltd. to obtain the recombinant plasmid pUC57-SsSCS. The specific steps were the same as those for the construction of the recombinant plasmid pUC57-SsLPPS.

[0159] 3. Construction of recombinant plasmid pUC57-GGPPS1

[0160] The recombinant plasmid pUC57-GGPPS1 is based on pUC-his-ura-hisG, and the upstream and downstream homology arms at the IntC site in Yarrowialipolytica Polf-Δku70 are inserted, and the GGPPS1 expression cassette is inserted between the upstream and downstream homology arms, and the orotate nuclear-5'-phosphate degradase encoding gene expression cassette is also inserted between the upstream and downstream homology arms.

[0161] The Yarrowia lipolytica Polf-Δku70 genomic DNA was used as a template and GGPPS1-F2 (SEQ ID NO.38) and GGPPS1-R2 (SEQ ID NO.39) were used as primers to amplify the gene with promoter P at both ends. TEFin-GGPPS1 and terminator T lip1t-GGPPS1 Homology arms of the GGPPS1 gene.

[0162] The IntC site integration plasmid was digested with restriction endonuclease Pacl from NEB Company, and the linearized IntC site integration plasmid was recovered by agarose gel electrophoresis.

[0163] The linearized IntC site was integrated into the plasmid and the constructed GGPPS1 gene expression cassette (including the promoter P TEFin-GGPPS1 , terminator T lip1t-GGPPS1 , with promoter P TEFin-GGPPS1 and terminator T lip1t-GGPPS1 The GGPPS1 gene of the homology arm was cloned in one step using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novogene Biotechnology Co., Ltd. to obtain the recombinant plasmid pUC57-GGPPS1. The specific steps were the same as those for the construction of the recombinant plasmid pUC57-SsLPPS.

[0164] 4. Construction of recombinant plasmid pUC57-GGPPS2

[0165] The recombinant plasmid pUC57-GGPPS2 is based on pUC-his-ura-hisG, and the upstream and downstream homology arms at the IntC site in Yarrowialipolytica Polf-Δku70 are inserted, the GGPPS2 expression cassette is inserted between the upstream and downstream homology arms, and the orotate nuclear-5'-phosphate degrading enzyme encoding gene expression cassette is also inserted between the upstream and downstream homology arms.

[0166] The Yarrowia lipolytica Polf-Δku70 genomic DNA was used as a template and GGPPS2-F2 (SEQ ID NO.40) and GGPPS1-R2 (SEQ ID NO.41) were used as primers to amplify a gene with promoter P at both ends. TEFin-GGPPS2 and terminator T lip1t-GGPPS2 Homology arms of the GGPPS2 gene.

[0167] The IntC site integration plasmid was digested with restriction endonuclease Pacl from NEB Company, and the linearized IntC site integration plasmid was recovered by agarose gel electrophoresis.

[0168] The linearized IntC site was integrated into the plasmid and the constructed SsLPPS gene expression cassette (including the promoter P TEFin-GGPPS2 , terminator T lip1t-GGPPS2 , with promoter P TEFin-GGPPS2 and terminator T lip1t-GGPPS2 The GGPPS2 gene of the homology arm was cloned in one step using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novogene Biotechnology Co., Ltd. to obtain the recombinant plasmid pUC57-GGPPS2. The specific steps were the same as those for the construction of the recombinant plasmid pUC57-SsLPPS.

[0169] 5. Construction of recombinant plasmid pUC57-ERG20

[0170] The recombinant plasmid pUC57-ERG20 is based on pUC-his-ura-hisG, and the upstream and downstream homology arms at the IntC site in Yarrowialipolytica Polf-Δku70 are inserted, and the ERG20 expression cassette is inserted between the upstream and downstream homology arms, and the orotate nuclear-5'-phosphate degrading enzyme encoding gene expression cassette is also inserted between the upstream and downstream homology arms.

[0171] Using Yarrowia lipolytica Polf-Δku70 genomic DNA as a template, ERG20-F2 (SEQ ID NO.42) and ERG20-R2 (SEQ ID NO.43) were used as primers to amplify a gene with promoter P at both ends.TEFin-ERG20 and terminator T lip1t-ERG20 Homology arms of the ERG20 gene.

[0172] The IntC site integration plasmid was digested with restriction endonuclease Pacl from NEB Company, and the linearized IntC site integration plasmid was recovered by agarose gel electrophoresis.

[0173] The linearized IntC site was integrated into the plasmid and the constructed ERG20 gene expression cassette (including the promoter P TEFin-ERG20 , terminator T lip1t-ERG20 , with promoter P TEFin-ERG20 and terminator T lip1t-ERG20 The ERG20 gene of the homology arm was cloned in one step using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novogene Biotechnology Co., Ltd. to obtain the recombinant plasmid pUC57-ERG20. The specific steps were the same as those for the construction of the recombinant plasmid pUC57-SsLPPS.

[0174] 6. Construction of recombinant plasmid pUC57-tHMG

[0175] The recombinant plasmid pUC57-tHMG is based on pUC-his-ura-hisG, and the upstream and downstream homology arms at the IntC site in Yarrowialipolytica Polf-Δku70 are inserted, the tHMG expression cassette is inserted between the upstream and downstream homology arms, and the orotate nuclear-5'-phosphate degrading enzyme encoding gene expression cassette is also inserted between the upstream and downstream homology arms.

[0176] Using Yarrowia lipolytica Polf-Δku70 genomic DNA as a template, tHMG-F2 (SEQ ID NO.44) and tHMG-R2 (SEQ ID NO.45) were used as primers to amplify a gene with promoter P at both ends. TEFin-tHMG and terminator T lip1t-tHMG Homology arms of the tHMG gene.

[0177] The IntC site integration plasmid was digested with restriction endonuclease Pacl from NEB Company, and the linearized IntC site integration plasmid was recovered by agarose gel electrophoresis.

[0178] The linearized IntC site was integrated into the plasmid and the constructed tHMG gene expression cassette (including the promoter P TEFin-tHMG , terminator T lip1t-tHMG , with promoter P TEFin-tHMG and terminator T lip1t-tHMGThe tHMG gene of the homology arm was cloned in one step using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novozyme Biotechnology Co., Ltd. to obtain the recombinant plasmid pUC57-tHMG. The specific steps were the same as those for the construction of the recombinant plasmid pUC57-SsLPPS.

[0179] 7. Construction of recombinant plasmid pUC57-IPK

[0180] The recombinant plasmid pUC57-IPK is based on pUC-his-ura-hisG, and the upstream and downstream homology arms at the IntC site in Yarrowia lipolyticaPolf-Δku70 are inserted, the IPK expression cassette is inserted between the upstream and downstream homology arms, and the orotate nuclear-5'-phosphate degrading enzyme encoding gene expression cassette is also inserted between the upstream and downstream homology arms.

[0181] The Yarrowia lipolytica Polf-Δku70 genomic DNA was used as a template and IPK-F2 (SEQ ID NO.46) and IPK-R2 (SEQ ID NO.47) were used as primers to amplify the gene with promoter P at both ends. TEFin-IPK and terminator T lip1t-IPK Homology arms of the IPK gene.

[0182] The IntC site integration plasmid was digested with restriction endonuclease Pacl from NEB Company, and the linearized IntC site integration plasmid was recovered by agarose gel electrophoresis.

[0183] The linearized IntC site was integrated into the plasmid and the constructed IPK gene expression cassette (including the promoter P TEFin-IPK , terminator T lip1t-IPK , with promoter P TEFin-IPK and terminator T lip1t-IPK The IPK gene of the homology arm was cloned in one step using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novogene Biotechnology Co., Ltd. to obtain the recombinant plasmid pUC57-IPK. The specific steps were the same as those for the construction of the recombinant plasmid pUC57-SsLPPS.

[0184] 8. Construction of recombinant plasmid pUC57-THiM

[0185] The recombinant plasmid pUC57-IPK is based on pUC-his-ura-hisG, and the upstream and downstream homology arms at the IntC site in Yarrowia lipolyticaPolf-Δku70 are inserted, and the THiM expression cassette is inserted between the upstream and downstream homology arms, and the orotate nuclear-5'-phosphate degrading enzyme encoding gene expression cassette is also inserted between the upstream and downstream homology arms.

[0186] Using Yarrowia lipolytica Polf-Δku70 genomic DNA as template, THiM-F2 (SEQ ID NO.48) and THiM-R2 (SEQ ID NO.49) were used as primers to amplify the gene with promoter P at both ends. TEFin-THiM and terminator T lip1t-THiM Homology arms of the THiM gene.

[0187] The IntC site integration plasmid was digested with restriction endonuclease Pacl from NEB Company, and the linearized IntC site integration plasmid was recovered by agarose gel electrophoresis.

[0188] The linearized IntC site was integrated into the plasmid and the constructed THiM gene expression cassette (including the promoter P TEFin-THiM , terminator T lip1t-THiM , with promoter P TEFin-THiM and terminator T lip1t-THiM The THiM gene of the homology arm was cloned in one step using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novozyme Biotechnology Co., Ltd. to obtain the recombinant plasmid pUC57-THiM. The specific steps were the same as those for the construction of the recombinant plasmid pUC57-SsLPPS.

[0189] 9. Construction of recombinant plasmid pUC57-IDI

[0190] The recombinant plasmid pUC57-IPK is based on pUC-his-ura-hisG, and the upstream and downstream homology arms at the IntC site in Yarrowia lipolyticaPolf-Δku70 are inserted, and the IDI expression cassette is inserted between the upstream and downstream homology arms, and the orotate nuclear-5'-phosphate degrading enzyme encoding gene expression cassette is also inserted between the upstream and downstream homology arms.

[0191] Using Yarrowia lipolytica Polf-Δku70 genomic DNA as template, IDI-F2 (SEQ ID NO.50) and IDI-R2 (SEQ ID NO.51) were used as primers to amplify the gene with promoter P at both ends. TEFin-IDI and terminator T lip1t-IDI Homology arms of the IDI gene.

[0192] The IntC site integration plasmid was digested with restriction endonuclease Pacl from NEB Company, and the linearized IntC site integration plasmid was recovered by agarose gel electrophoresis.

[0193] The linearized IntC site was integrated into the plasmid and the constructed IDI gene expression cassette (including the promoter P TEFin-IDI , terminator T lip1t-IDI , with promoter P TEFin-IDI and terminator T lip1t-IDI The IDI gene of the homology arm was cloned in one step using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novogene Biotechnology Co., Ltd. to obtain the recombinant plasmid pUC57-IDI. The specific steps were the same as those for the construction of the recombinant plasmid pUC57-SsLPPS.

[0194] 10. Construction of recombinant plasmid pUC57-ACLY

[0195] The recombinant plasmid pUC57-IPK is based on pUC-his-ura-hisG, and the upstream and downstream homology arms at the IntC site in Yarrowia lipolyticaPolf-Δku70 are inserted, and the ACLY expression cassette is inserted between the upstream and downstream homology arms, and the orotate nuclear-5'-phosphate degrading enzyme encoding gene expression cassette is also inserted between the upstream and downstream homology arms.

[0196] Using Yarrowia lipolytica Polf-Δku70 genomic DNA as template, ACLY-F2 (SEQ ID NO.52) and ACLY-R2 (SEQ ID NO.53) were used as primers to amplify the gene with promoter P at both ends. TEFin-ACLY and terminator T lip1t-ACLY Homology arms of the ACLY gene.

[0197] The IntC site integration plasmid was digested with restriction endonuclease Pacl from NEB Company, and the linearized IntC site integration plasmid was recovered by agarose gel electrophoresis.

[0198] The linearized IntC site was integrated into the plasmid and the constructed ACLY gene expression cassette (including the promoter P TEFin-ACLY , terminator T lip1t-ACLY , with promoter P TEFin-ACLY and terminator T lip1t-ACLYThe ACLY gene of the homology arm was cloned in one step using the ClonExpress MultiS One Step Cloning Kit of Nanjing Novozyme Biotechnology Co., Ltd. to obtain the recombinant plasmid pUC57-ACLY. The specific steps were the same as those for the construction of the recombinant plasmid pUC57-SsLPPS.

[0199] The primer sequences used in this example are shown in Table 4.

[0200] Table 4 Primer sequences

[0201] Primer name Sequence (5'→3) Serial Number SsLPPS-F2 <h2 style=";text-align:left;direction:ltr">CAACCACCTTCACAGAACTGGATGACTTCTGTAAAATTTGAG <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.34 <h2 style=";text-align:left;direction:ltr"> SsLPPS-R2 <h2 style=";text-align:left;direction:ltr"> ATAAGCTGTCAAACATGAGTCATACAACCGGTCGAAAGA <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.35 <h2 style=";text-align:left;direction:ltr"> SsSCS-F2 <h2 style=";text-align:left;direction:ltr"> CAACCACCTTCACAGAACTGGATGTCGCTCGCCTTCAACGTC <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.36 <h2 style=";text-align:left;direction:ltr"> SsSCS-R2 <h2 style=";text-align:left;direction:ltr"> AATATTTGCATACGGTCAAAAGACAAAGGATTTTCATATC <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.37 <h2 style=";text-align:left;direction:ltr"> GGPPS1-F2 <h2 style=";text-align:left;direction:ltr"> CAACCACCTTCACAAGACTGGATGAGTAGGTAAAATCTAAG <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.38 <h2 style=";text-align:left;direction:ltr"> GGPPS1-R2 <h2 style=";text-align:left;direction:ltr"> AATATTTGCATACGGTCATCAATTGTCTCTAATAAGCAAT <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.39 <h2 style=";text-align:left;direction:ltr"> GGPPS2-F2 <h2 style=";text-align:left;direction:ltr"> CAACCACCTTCACAAGACTGGATGAGCCTGATGAATTCAAG <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.40 <h2 style=";text-align:left;direction:ltr"> GGPPS2-R2 <h2 style=";text-align:left;direction:ltr"> AATATTTGCATACGGTCATCAATTATCCCTGTAAGCAA <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.41 <h2 style=";text-align:left;direction:ltr"> ERG20-F2 <h2 style=";text-align:left;direction:ltr"> CAACCACCTTCACAAGACTGGATGTCAAAAGAAGCAAGTAGA <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.42 <h2 style=";text-align:left;direction:ltr"> ERG20-R2 <h2 style=";text-align:left;direction:ltr"> AATATTTGCATACGGGTCATTATTTAGATCTTTTGTACA <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.43 <h2 style=";text-align:left;direction:ltr"> tHMG-F2 <h2 style=";text-align:left;direction:ltr"> CAACCACCTTCACAGAACTGGATGACAAGACAATTCGTACC <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.44 <h2 style=";text-align:left;direction:ltr"> tHMG-R2 <h2 style=";text-align:left;direction:ltr"> AATATTTGCATACGGTCAACTTAGTATGGTCTGTTGGA <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.45 <h2 style=";text-align:left;direction:ltr"> IPK-F2 <h2 style=";text-align:left;direction:ltr"> CAACCACCTTCACAGAACTGGATGATAATTTTAAAGATTGG <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.46 <h2 style=";text-align:left;direction:ltr"> IPK-R2 <h2 style=";text-align:left;direction:ltr"> AATATTTGCATACGGTCACTAATTTCCCCTTGAAATTA <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.47 <h2 style=";text-align:left;direction:ltr"> ThiM-F2 <h2 style=";text-align:left;direction:ltr"> CAACCACCTTCACAAGACTGGATGCAAGTCGACCTGCTGGG <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.48 <h2 style=";text-align:left;direction:ltr"> ThiM-R2 <h2 style=";text-align:left;direction:ltr"> AATATTTGCATACGGGTCATCATGCCTGCACCTCCTGCG <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.49 <h2 style=";text-align:left;direction:ltr"> IDI-F2 <h2 style=";text-align:left;direction:ltr"> CAACCACCTTCACAGAACTGGATGTGGCGCGGACGGACACTG <h2 style=";text-align:left;direction:ltr"> SEQ ID NO.50 IDI-R2 AATATTTGCATACGGTCATCACAATCTATGTATTTTCTC SEQ ID NO.51 ACLY-F2 CAACCACCTTCACAGACTGGATGTCGGCCAAGGCAATTTC SEQ ID NO.52 ACLY-R2 AATATTTGCATACGGTCATTACATGCTCATGTGTTCCG SEQ ID NO.53

[0202] Example 2 Construction of recombinant bacteria

[0203] 1. Construction of recombinant strain ZHMW-1

[0204] 1. The plasmids pUC57-SsLPPS, pUC57-tHMG, pUC57-ERG20, pUC57-GGPPS1, pUC57-GGPPS2, and pUC57-SsLPPS containing the sclareol-related gene expression cassette were introduced into Yarrowia lipolytica Polf-Δku70, and the sclareol-related gene expression cassette was integrated into the genome to obtain the recombinant bacterium sclareol-related gene expression cassette. The specific method is as follows: (1) Yarrowia lipolytica Polf-Δku70 was cultured overnight in YPD liquid medium (containing 2% peptone, 1% yeast extract and 2% glucose, the above percentages are final mass concentrations, and the solvent is water), and the OD 600When the cell count reaches 0.8-1.0, the competent cells are prepared according to the operation method of the yeast transformation kit Frozen-EZ Yeast Transformation IITM. The specific method is: resuspend with 1mL EZ1, centrifuge at 4℃, 4000rpm for 3min to collect the cells again; discard the supernatant, suspend the cells with 100μL EZ2, divide into 50L portions, and store at -80℃ to obtain yeast competent cells. (2) Use Zymo Research Corporation's Zymogen Frozen EZ Yeast Transformation Kit II to transform pUC57-SsLPPS, pUC57-tHMG, pUC57-ERG20, pUC57-GGPPS1, pUC57-GGPPS2, and pUC57-SsLPPS into Yarrowia lipolytica Polf-Δku70 for homologous recombination. (3) Use the screening medium SD-Leu to screen, and the positive clones identified by PCR are named recombinant bacteria ZHMW-1. The screening medium SD-Leu contains: glucose 20 g / L, Yeast Nitrogen Base (YNB, amino-free yeast nitrogen source) 6.7 g / L, CSM-Leu 0.67 g / L, agar powder 23 g / L, and the solvent is water.

[0205] 2. Construction of recombinant strain ZHMW-2

[0206] The IUP pathway-related recombinant plasmids pUC57-IPK, pUC57-THiM, and pUC57-IDI were introduced into the recombinant bacteria ZHMW-1, and the IUP pathway expression cassette was integrated into the genome to obtain the recombinant bacteria ZHMW-2. The specific method is as follows: the recombinant bacteria ZHMW-1 was cultured overnight in YPD liquid medium (containing 2% protein knee, 1% yeast extract, 2% glucose, the above percentages are the final mass concentrations, and the solvent is water). 600When the cell number grows to between 0.8 and 1.0, the competent cells are prepared according to the operation method of the yeast transformation kit Frozen-EZ Yeast Transformation IITM. The specific method is: resuspend with 1 mL EZ1, centrifuge at 4°C and 4000 rpm for 3 min to collect the bacteria again; discard the supernatant, suspend the bacteria with 100 μL EZ2, divide into 50L portions, and store at -80°C, which are ZHMW-1 competent cells. Use Zymogen Frozen EZYeast Transformation Kit II of Zymo Research Corporation to transform the recombinant plasmids pUC57-IPK, pUC57-THiM, and pUC57-IDI into the recombinant bacteria ZHMW-1, perform homologous recombination, and use the screening medium SD-Leu-Ura for screening. The positive clones identified correctly by PCR are named as recombinant bacteria ZHMW-2. The ingredients of the screening medium SD-Leu-Ura are: glucose 20 g / L, Yeast Nitrogen Base (YNB, amino-free yeast nitrogen source) 6.7 g / L, CSM-Leu-Ura 0.67 g / L, agar powder 23 g / L, and the solvent is water.

[0207] 3. Construction of recombinant strain ZHMW-3

[0208] The recombinant plasmid pUC57-ACLY was introduced into the recombinant bacteria ZHMW-2, and the ACLY expression cassette was integrated into the genome to obtain the recombinant bacteria ZHMW-3. The specific method is as follows: the recombinant bacteria ZHMW-2 was cultured overnight in YPD liquid medium (containing 2% protein knee, 1% yeast extract, 2% glucose, the above percentages are the final mass concentrations, and the solvent is water). 600When the cell number grows to between 0.8 and 1.0, the competent cells are prepared according to the operation method of the yeast transformation kit Frozen-EZ Yeast Transformation IITM. The specific method is as follows: resuspend with 1 mL EZ1, centrifuge at 4°C and 4000 rpm for 3 min to collect the cells again; discard the supernatant, suspend the cells with 100 μL EZ2, divide into 50L portions, and store at -80°C, which are ZHMW-2 competent cells. The recombinant plasmid pUC57-ACLY is transformed into the recombinant bacteria ZHMW-2 using the Zymogen Frozen EZ Yeast Transformation Kit II of ZymoResearch Corporation, homologous recombination is carried out, and screening is carried out using the screening medium SD-Leu-Ura. The positive clones identified correctly by PCR are named as recombinant bacteria ZHMW-3. The ingredients of the screening medium SD-Leu-Ura are: glucose 20 g / L, Yeast Nitrogen Base (YNB, amino-free yeast nitrogen source) 6.7 g / L, CSM-Leu-Ura 0.67 g / L, agar powder 23 g / L, and the solvent is water.

[0209] Example 3

[0210] Application of recombinant bacteria ZHMW-1, ZHMW-2 and ZHMW-3 in the production of sclareol

[0211] 1. Cultivation of engineered bacteria and product extraction

[0212] The recombinant bacteria ZHMW-1, ZHMW-2 and ZHMW-3 in Example 2 were respectively used to produce sclareol. The specific method is as follows: activate the recombinant bacteria, culture in YPD liquid medium at 30°C and 220rpm for 16 hours to obtain seed liquid. Inoculate the seed liquid in 50ml fermentation medium at a volume ratio of 1%, shake culture at 30°C and 220rpm for 1 day, then add 25% of the volume of the fermentation liquid n-dodecane, and continue shaking culture for 3 days. After the fermentation is completed, transfer the fermentation liquid to a 50ml centrifuge tube, centrifuge at 5000rpm for 15min, and collect the upper organic phase for use.

[0213] The fermentation medium contains 60 g / L glucose, 10 g / L yeast powder, 20 g / L trypsin, 2 g / L prenyl alcohol and 2.5 g / L isoprene alcohol, and the solvent is water.

[0214] 2. Qualitative and quantitative analysis of sclareol

[0215] The organic phase in each recombinant bacterial fermentation broth was filtered through an organic nylon filter (0.22um) and detected by GC-MS. Detection conditions: injection port temperature 250℃, injection volume 1ul, split ratio 20:1; chromatographic column: HP-5ms (30m*0.25mM); chromatographic conditions: initial temperature 60℃, rising to 150℃ at a rate of 10℃ / min, then rising to 280℃ at 20℃ / min, and maintaining for 2min. Standard sclareol was used for qualitative and quantitative analysis. Figure 5 This is the GC-MS detection chart of sclareol produced by the recombinant bacteria. Figure 6 This is a comparison of the production of clarysol by the recombinant bacteria ZHMW-1, ZHMW-2, and ZHMW-3.

[0216] After 3 days of fermentation, the recombinant strain ZHMW-3 had the highest sclareol production, reaching 2150 mg / L, that is, 2150 mg of sclareol per liter of fermentation liquid. The recombinant strains ZHMW-1, ZHMW-2, and ZHMW-3 produced 240 mg / L, 1720 mg / L, and 2150 mg / L, respectively.

[0217] Example 4

[0218] Fermentation experiment of recombinant strain ZHMW-3 in a 50L fermenter

[0219] A single colony of the ZHMW-3 strain was selected and inoculated into 25 mL / 250 mL of YPD liquid medium, and cultured at 30 degrees and 220 rpm for 1 day to obtain a seed solution, which was inoculated into a 50 L fermentation tank (containing 25 L fermentation medium, the fermentation medium components were 60 g / L glucose, 10 g / L yeast powder, 20 g / L trypsin Chen, 2 g / L pentadienol and 2.5 g / L isoprenol, and the solvent was water) according to an inoculum of 5%, and fermented at 30 ° C, with a stirring speed of 550 rpm, a ventilation ratio of 1 vvm, dissolved oxygen of 10%-20%, 8 M sodium hydroxide was added to adjust the pH to 6.2, and the glucose content was ensured to be not less than 5 g / L by feeding (the glucose concentration of the feeding glucose mother solution was 800 g / L, 20 g / L pentadienol and 25 g / L isoprenol), and fermented for 120 h. The sclareol content and glucose content were sampled every 24 h.

[0220] The results are as follows Figure 7As shown, ZHMW-3 strains consumed 150g / L of glucose when fermented for 120h, and the content of sclareol reached 10560mg / L. On the whole, the production efficiency of sclareol reached 88mg / L / h, and the substrate conversion rate was as high as 70.4mg sclareol / g sugar. The production efficiency and substrate conversion rate of sclareol of the present invention were respectively 1.98 times and 1.49 times higher than those of Chinese patent CN117264792B (the production efficiency of sclareol reached 44.3mg / L / h, and the substrate conversion rate was 47.3mg sclareol / g sugar), and were respectively 11.43 times and 4.60 times higher than those of Chinese patent CN114989997B (the production efficiency of sclareol reached 7.7mg / L / h, and the substrate conversion rate was 15.3mg sclareol / g sugar).

[0221] The present invention constructs a high-yield sclareol recombinant bacterium ZHMW-1 based on a synthetic biology strategy, and the sclareol yield of the strain is 240 mg / L. On this basis, the present invention obtains a recombinant bacterium ZHMW-2 by overexpressing IUP pathway-related genes (THiM, IDI, IPK) again, and the sclareol yield of the strain is 1720 mg / L. Further, the present invention obtains a recombinant bacterium ZHMW-3 by overexpressing the ACLY gene again, and the sclareol yield of the strain is 2150 mg / L. Finally, the recombinant bacterium reaches 10560 mg / L of sclareol in a 50L fermentation tank, which is significantly higher than the prior art. The recombinant Yarrowia lipolytica ZHMW-3 of the present invention can efficiently ferment and synthesize natural sclareol.

[0222] The relevant sequences of the present invention are as follows:

[0223] 1. The optimized lysyl pyrophosphate synthase encoding gene SsLPPS (SEQ ID No. 1), the specific sequence of SEQ ID No. 1 is:

[0224]

[0225] 2. The optimized sclareol synthase encoding gene SsSCS (SEQ ID No.2), the specific sequence of SEQ ID No.2 is:

[0226]

[0227] 3. The optimized geranylgeranyl pyrophosphate synthase 1 encoding gene GGPPS1 (SEQ ID No. 3), the specific sequence of SEQ ID No. 3 is:

[0228]

[0229] 4. The optimized nucleotide sequence is named as geranylgeranyl pyrophosphate synthase 2 encoding gene GGPPS2 (SEQ ID No. 4), and the specific sequence of SEQ ID No. 4 is:

[0230]

[0231] 5. The optimized nucleotide sequence is named as farnesyl pyrophosphate synthase encoding gene ERG20 (SEQ ID No. 5), and the specific sequence of SEQ ID No. 5 is:

[0232]

[0233] 6. The optimized nucleotide sequence is named as the mevalonate pathway rate-limiting enzyme encoding gene tHMG (SEQ ID No. 6). The specific sequence of SEQ ID No. 6 is:

[0234]

[0235] 7. The optimized nucleotide sequence is named as the phosphorylation kinase encoding gene IPK (SEQ ID No. 7), and the specific sequence of SEQ ID No. 7 is:

[0236] ATGATAATTTTAAAGATTGGTGGAAGCATATTGACTAATAAGGATTCAGCTGAAAGTGAAGTTGATACCGTTAGTCTTAAAAGAATTGCATCCGAGATTAAATCTTCTTTGGATAAATCCTCTAAAGAATTGATTATTGTCCATGGTGCTGGGTCTTTTGGACATCCGCCAGCTAAAAAATATAAGATTGGTGAAGCGTT TGAATTATCAGAATATCCTCAAAAGAGGATAGGATTCTGTGAAACTCAAAATGCTGTTAAAAAATTAAACATGTATATTTGTGAAGCTTTCATTGAGGAAGGATTACCTGTAGTTGCAATTCCGGCTTCTAGTTTTATGACAGCTACTAATAAAAGAATCACTGATGGTAATCTTGATAGCTTTAAAAAATATTTACAAA AAGGTTTTATTCCAGTTATTTATGGGGATGTTGTCTTAGATGATGAATTGGAAATTTGTGTTATTTCCGGAGACCAGCTTATCCAGTATTTGGCAAAAAATTTAAATCCGGATATGGTTGTCTTGGGAACTGATGTTGATGGAGTATATAATAAAAATCCAAAAACTCATGATGATGCAATATTTTTCGATAGATTTTCA TCTTTAGATGATTTGGATACTTTTGAAGGAACAACAAATGTTGATGTAACTGGTGGTATGGTTGGAAAAATTAAAGAACTTTTATATTTAGCAGATTTAGGAATCGAATCTAAAATAATAAAATGCCGAAGTTGAAAATAATATTTTCAAAGTTTTGGAAAATGAAGAAGTAAAAGGAACTATAATTTCAAGGGGAAATTAG

[0237] 8. The optimized nucleotide sequence is named as hydroxyethylthiazole kinase encoding gene THiM (SEQ ID No.8), and the specific sequence of SEQ ID No.8 is:

[0238] ATGCAAGTCGACCTGCTGGGTTCAGCGCAATCTGCGCACGCGTTACACCTTTTTCACCAACATTCCCCTCTTGTGCACTGCATGACCAATGATGTGGTGCAAACCTTTACCGCCAATACCTTGCTGGCGCTCGGTGCATCGCCAGCGATGGTTATCGAAACCGAAGAGGCCAGTCAGTTTGCGGCTATCGCCAGTGCCTTGTTGATTAACGTTGGCACACTGACGCAGCCACGCGCTCAGGCGATGCGTGCTGCCGTTGAGCAAGCAAAAAGCTCTCAAACACCCTGGACGCTTGATCCAGTAGCGGTGGGTGCGCTCGATTATCGCCGCCATTTTTGTCATGAACTTTTATCTTTTAAACCGGCAGCGATACGTGGTAATGCTTCGGAAATCATGGCATTAGCTGGCATTGCTAATGGCGGACGGGGAGTGGATACCACTGACGCCGCAGCTAACGCGATACCCGCTGCACAAACACTGGCACGGGAAACTGGCGCAATCGTCGTGGTCACTGGCGAGATGGATTATGTTACCGATGGACATCGTATCATTGGTATTCACGGTGGTGATCCGTTAATGACCAAAGTGGTAGGAACTGGCTGTGCATTATCGGCGGTTGTCGCTGCCTGCTGTGCGTTACCAGGCGATACGCTGGAAAATGTCGCATCTGCCTGTCACTGGATGAAACAAGCCGGAGAACGCGCAGTCGCCAGAAGCGAGGGGCCAGGCAGTTTTGTTCCACATTTCCTTGATGCGCTCTGGCAATTGACGCAGGAGGTGCAGGCATGA

[0239] 9. The optimized nucleotide sequence, named isopentenyl pyrophosphate isomerase encoding gene IDI (SEQ ID No. 9), and the specific sequence of SEQ ID No. 9 is as follows:

[0240] ATGTGGCGCGGACGGACACTGGCGCGAGCGATTGGATATGCTGTTAGAGGGCGGGGCCTGGAGGCGGAGCATGCTGCGGAGAGGATTGAAGTACAGCTCTCCGCACAGCTTCTCAGCACCTGCAGCCGGAATCTCTGTGTTCTAGGTCAGATCAGACATTCTGTCACAATGCCTGAAATAAATACCAGCCATCTTGATGAAAAACAGGTTCAGCTTCTAGCGGAGATGTGTATTCTTATTGATGAAAATGACAATAAAATTGGGGCTGACACCAAGAAAAACTGTCACCTTAATGAAAACATCGACAAAGGATTATTACATCGAGCTTTTAGTGTCTTCTTGTTTAATACTGAAAATAAGCTCCTGTTACAGCAGAGATCAGATGCTAAAATTACCTTTCCAGGTTGTTTCACCAATAGTTGCTGTAGTCATCCATTAAGTAACCCAGGCGAGCTGGAAGAGAACAACGCCATTGGTGTGAAGCGAGCAGCAAAGCGGCGCTTGAAAGCCGAGTTGGGAATACCCTTGGAAGAGGTTGATCTAAATGAAATGGATTATCTAACAAGAATTTACTACAAGGCCCAATCTGATGGTATCTGGGGTGAACATGAAGTTGATTACATTCTGTTTCTGAGGAAGAATGTAACCTTGAATCCAGATCCCAACGAGATTAAAAGCTATTGCTATGTATCAAAGGAAGAAGTCAGAGAAATTTTGAAGAAGGCAGCCAGTGGTGAAATTAAGTTAACTCCGTGGTTTAAGATAATTGCAGATACTTTCCTCTTCAAATGGTGGGATAACTTAAACCATTTGAGTCCATTTGTTGACCATGAGAAAATACATAGATTGTGA

[0241] 10. The optimized nucleotide sequence, named as the ATP citrate lyase encoding gene ACLY (SEQ ID No. 10), and the specific sequence of SEQ ID No. 10 is as follows:

[0242]

[0243] Although the embodiments of the present invention are disclosed for illustrative purposes, those skilled in the art will appreciate that various substitutions, changes and modifications are possible without departing from the spirit and scope of the present invention and the appended claims. Therefore, the scope of the present invention is not limited to the contents disclosed in the embodiments.

Claims

1. A recombinant Yarrowia lipolytica for efficiently and rapidly producing sclareol, characterized in that: The recombinant Yarrowia lipolytica is obtained by inserting optimized sclareol synthase-related coding genes ScLPPS, ScSCS, GGPPS1, GGPPS2, ERG20, and tHMGR coding genes into the Yarrowia lipolytica genome; then inserting optimized pentadienol utilization pathway coding genes IPK, THiM, and IDI coding genes; and finally inserting optimized ATP:citrate lyase coding gene ACLY; Among them, the gene sequences of the optimized sclareol synthase-related encoding genes ScLPPS, ScSCS, GGPPS1, GGPPS2, ERG20, and tHMGR encoding genes are shown in SEQ ID NO.1 to SEQ ID NO.6, respectively; The gene sequences of the optimized pentadienol utilization pathway encoding genes IPK, THiM, and IDI are shown in SEQ ID NO.7 to SEQ ID NO.9 respectively; The gene sequence of the citrate lyase encoding gene ACLY is shown in SEQ ID NO.

10.

2. The recombinant Yarrowia lipolytica according to claim 1, characterized in that: The recombinant Yarrowia lipolytica is obtained by inserting into the Yarrowia lipolytica genome an expression cassette of sclareol synthase-related encoding genes tHMGR, ERG20, GGPPS1, GGPPS2, ScLPPS, and ScSCS, an expression cassette of IUP pathway encoding genes THiM, IPK, and ID, and an expression cassette of ATP:citrate lyase encoding gene ACLY.

3. The recombinant Yarrowia lipolytica according to claim 2, characterized in that: The sclareol synthase-related gene expression cassette, the IUP pathway encoding gene expression cassette and the ACLY encoding gene expression cassette are introduced into the Yarrowia lipolytica in the form of plasmids and then integrated into the Yarrowia lipolytica genome.

4. The recombinant Yarrowia lipolytica according to claim 3, characterized in that: The Yarrowia lipolytica is Yarrowia lipolytica Po1fΔku70; Alternatively, the promoter of the sclareol synthase encoding gene expression cassette is P TEFin Promoter, P TEF Promoter or P EXP promoter; the terminator of the gene encoding the sclareol synthase is T of Yarrowia lipolytica XPR2T Terminator, T CYC1t Terminator or T lip1t terminator; Alternatively, the promoter of the IUP pathway encoding gene expression cassette is P of Yarrowia lipolytica. TEFin Promoter, P TEF Promoter or P EXP promoter; the IUP pathway encoding gene terminator is T of Yarrowia lipolytica XPR2T Terminator, T CYC1t Terminator or T lip1t terminator; Alternatively, the promoter of the ACLY expression cassette is P TEFin Promoter, P TEF Promoter or P EXP The ACLY terminator is T of Yarrowia lipolytica XPR2T Terminator, T CYC1t Terminator or T lip1t Terminator.

5. The method for constructing a recombinant Yarrowia lipolytica according to any one of claims 1 to 4, characterized in that: The steps include: (1) Construction of recombinant plasmid sclareol synthase encoding gene expression cassette: According to the nucleotide sequence of the lysyl pyrophosphate synthase encoding gene from Clary Sage provided on NCBI, after codon optimization, an optimized lysyl pyrophosphate synthase encoding gene SsLPPS was synthesized, the gene sequence of which is SEQ ID No. 1, and inserted into plasmid pUC57 to obtain plasmid pUC57-SsLPPS; According to the nucleotide sequence of the sclareol synthase encoding gene from Sclareolus sclareae provided on NCBI, its GenBank accession number is JQ478435.1, after codon optimization, the optimized sclareol synthase encoding gene SsSCS was synthesized, and its gene sequence is SEQ ID No. 2, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-SsSCS; According to the nucleotide sequence of the geranylgeranyl pyrophosphate synthase encoding gene from Platycodon grandiflorum provided on NCBI, after codon optimization, the optimized geranylgeranyl pyrophosphate synthase 1 encoding gene GGPPS1 was synthesized, and its gene sequence was SEQ ID No. 3, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-GGPPS1; According to the nucleotide sequence of the geranylgeranyl pyrophosphate synthase 2 encoding gene synthase from Gardenia jasminoides provided on NCBI, after codon optimization, an optimized nucleotide sequence was synthesized, named as the geranylgeranyl pyrophosphate synthase 2 encoding gene GGPPS2, whose gene sequence is SEQ ID No. 4, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-GGPPS2; According to the nucleotide sequence of the farnesyl pyrophosphate synthase encoding gene from Candida provided on NCBI, after codon optimization, an optimized nucleotide sequence was synthesized, named as the farnesyl pyrophosphate synthase encoding gene ERG20, whose gene sequence is SEQ ID No. 5, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-ERG20; According to the nucleotide sequence of the gene encoding the rate-limiting enzyme of the mevalonate pathway from Kluyveromyces lactis provided on NCBI, after codon optimization, an optimized nucleotide sequence was synthesized and named as the gene encoding the rate-limiting enzyme of the mevalonate pathway tHMG, whose gene sequence is SEQ ID No.6, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-tHMG; (2) Construction of recombinant plasmid IUP pathway encoding gene expression cassette: According to the nucleotide sequence of the phosphokinase encoding gene synthase from Methanococcus jannaschii provided by NCBI, after codon optimization, an optimized nucleotide sequence was synthesized, named as the phosphokinase encoding gene IPK, whose gene sequence is SEQ ID No.7, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-IPK; According to the nucleotide sequence of the hydroxyethylthiazole kinase encoding gene from Escherichia coli provided by NCBI, after codon optimization, an optimized nucleotide sequence was synthesized, named as the hydroxyethylthiazole kinase encoding gene THiM, whose gene sequence is SEQ ID No. 8, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-THiM; According to the nucleotide sequence of the isopentenyl pyrophosphate isomerase encoding gene from house mouse provided by NCBI, after codon optimization, an optimized nucleotide sequence was synthesized, named as the isopentenyl pyrophosphate isomerase encoding gene IDI, whose gene sequence is SEQ ID No.9, and inserted into plasmid pUC57 to obtain plasmid pUC57-IDI; (3) Construction of recombinant plasmid ACLY encoding gene expression cassette: According to the nucleotide sequence of the ATP citrate lyase encoding gene from human sources provided by NCBI, after codon optimization, an optimized nucleotide sequence was synthesized, named as the ATP citrate lyase encoding gene ACLY, and its gene sequence is SEQ ID No. 10, and inserted into the plasmid pUC57 to obtain the plasmid pUC57-ACLY; (4) The plasmids pUC57-SsLPPS, pUC57-tHMG, pUC57-ERG20, pUC57-GGPPS1, pUC57-GGPPS2, and pUC57-SsLPPS were introduced into Yarrowia lipolytica Polf-Δku70 to obtain the recombinant bacterium ZHMW-1, which is a recombinant Yarrowia lipolytica producing sclareol; the recombinant plasmids pUC57-IPK, pUC57-THiM, and pUC57-IDI were introduced into the recombinant bacterium ZHMW-1 to obtain the recombinant bacterium ZHMW-2, which is a recombinant Yarrowia lipolytica producing high sclareol; the recombinant plasmid pUC57-ACLY was introduced into the recombinant bacterium ZHMW-2 to obtain the recombinant bacterium ZHMW-3, which is a recombinant Yarrowia lipolytica producing high sclareol.

6. Use of the recombinant Yarrowia lipolytica according to any one of claims 1 to 4 in the fermentation production of sclareol.

7. A method for producing sclareol by fermentation using the recombinant Yarrowia lipolytica according to any one of claims 1 to 4, characterized in that: The steps include: Activate the recombinant bacteria, and culture them in YPD liquid medium at 28-30°C and 200-240rpm for 16 hours to obtain seed solution; The seed liquid was inoculated into the fermentation medium at an inoculum volume ratio of 1%, and the culture was shaken at 30°C and 220 rpm for 1 day, and then an organic solvent of 10-25% of the volume of the fermentation liquid was added, and the culture was shaken for 3 more days; After the fermentation was completed, the fermentation broth was centrifuged at 5000 rpm for 15 min, and the upper organic phase was collected; The fermentation medium contains 40-80 g / L glucose, 10 g / L yeast powder, 20 g / L trypsin, 2 g / L prenol and 2.5 g / L isoprene alcohol, and the solvent is water.

8. The method according to claim 7, characterized in that: Fermentation conditions were 30°C, 220 rpm; Alternatively, the fermentation medium contains 60 g / L glucose; Alternatively, the organic solvent is decane or n-dodecane.

9. A method for producing sclareol by fermentation using the recombinant Yarrowia lipolytica according to any one of claims 1 to 4, characterized in that: The steps include: A single colony of the recombinant Yarrowia lipolytica was picked and inoculated into a YPD liquid culture medium, and cultured at 28-30°C and 200-240rpm for 1 day to obtain a seed solution, and the seed solution was inoculated into a fermentation medium at an inoculation rate of 5%, and fermented at 30°C, with a stirring speed of 550rpm, an aeration ratio of 1vvm, and dissolved oxygen of 10%-20%. 8M sodium hydroxide was added to adjust the pH to 6.2, and the glucose content was ensured to be not less than 5g / L by feeding. The glucose concentration of the feeding glucose mother solution was 800g / L, 20g / L prenol and 25g / L isoprenol, and the fermentation was carried out for 120h.

10. The method according to claim 9, characterized in that: Fermentation conditions were 30°C, 220 rpm; Alternatively, the fermentation medium components are: 60 g / L glucose, 10 g / L yeast powder, 20 g / L trypsin, 2 g / L prenyl alcohol and 2.5 g / L isoprene alcohol, and the solvent is water.

Images