Molecular marker primer pair for identifying sex determination system of autotetraploid crucian carp, kit and application

Abstract

The invention belongs to the field of fish sex determination system identification, and discloses a molecular marker primer pair for identifying an autotetraploid crucian carp sex determination system, a kit and application. The molecular marker primer pair disclosed by the invention is not limited by the growth stage of the autotetraploid crucian carp, so that the time cost is saved, the limitation of low evolution degree of the sex chromosome of the autotetraploid crucian carp is overcome, and meanwhile, a new technical means is provided for determining a fish sex determination system. The molecular marker primer pair, the kit and the application method are low in cost and simple, rapid and accurate to operate, can be applied to identification of the autotetraploid crucian carp sex determination system, and provide a more convenient method for research on determination of the autotetraploid crucian carp sex determination system; meanwhile, the molecular marker primer pair can also be used for identifying the sex of the autotetraploid carassius auratus gibelio male nucleus development offspring.

Description

Technical Field

[0001] The invention belongs to the technical field of fish sex determination system identification, and particularly relates to a molecular marker primer pair, a kit and a method for identifying the sex determination system of autotetraploid crucian carp. Background Art

[0002] Fish, as lower vertebrates, possess sex determination systems encompassing nearly all vertebrate sex chromosome types. Currently, six main sex chromosome types are generally considered, including XY, ZW, XO, ZO, and plethysmosome types. These sex chromosome types reflect the genetic basis of sex determination in fish, where sex chromosomes, sex-determining genes, and endocrine hormones work together to determine sex. Sex determination is a crucial characteristic for aquatic organisms, particularly fish. Currently, karyotyping and fluorescence in situ hybridization (FISH) are commonly used methods for determining sex determination systems. However, as lower vertebrates, fish have a low degree of sex chromosome differentiation, making it difficult to distinguish sex determination systems using karyotyping and fluorescence in situ hybridization. Therefore, the development of specific molecular markers that can identify sex determination types is crucial for understanding the sex determination mechanisms of fish and optimizing aquaculture strategies. This will provide a better understanding of the biological characteristics and ecological adaptations of fish, thereby providing a scientific basis for aquaculture, conservation, and management.

[0003] Autotetraploid Carassius auratus , 4n=200) from the parent red crucian carp ( Carassius auratus red var., 2n=100) and the parent, Megalobrama amblycephala ( Megalobrama amblycephala , 2n=48) of the subfamily, and possesses four sets of red crucian carp chromosomes. Due to the complexity of the entire genome of autotetraploid crucian carp, it is difficult to determine its sex determination system. Existing technologies have not been able to directly or indirectly prove the sex determination mechanism of autotetraploid crucian carp, and the presence of heteromorphic sex chromosomes has not been determined, making it impossible to identify its sex determination system from a cytological perspective. The existence of these problems has brought great difficulties to breeding, aquaculture and related basic genetic research, especially the study of sex chromosome evolution and the molecular mechanism of sex determination. Therefore, the development of specific molecular markers for identifying the sex determination system of autotetraploid crucian carp is an important means to identify sex chromosomes, study sex determination and the mechanism of sex chromosome evolution, and reveal the sex determination mechanism of autotetraploid crucian carp, which will help understand its genetic background and provide a reference for studying sex determination in other fish. Summary of the Invention

[0004] The technical problem to be solved by the present invention is to overcome the deficiencies and defects mentioned in the above background technology and provide a specific molecular marker primer pair, a kit and a method for quickly, simply and accurately identifying the sex determination system of autotetraploid crucian carp.

[0005] In order to solve the above technical problems, the technical solution proposed by the present invention is: In a first aspect, the present invention provides a molecular marker primer pair for identifying the sex determination system of autotetraploid crucian carp, wherein the molecular marker primer pair comprises an upstream forward primer Primer-F and a downstream reverse primer Primer-R, and the nucleotide sequence thereof is: Primer-F: 5'-AACTGGGCTCCATTGACGAG-3' (SEQ ID NO. 2), Primer-R: 5'-GCACGTACTCCCTAAGCTCT-3' (SEQ ID NO. 3).

[0006] In a second aspect, the present invention provides a kit for identifying the sex determination system of autotetraploid crucian carp, comprising the molecular marker primer pair.

[0007] The above-mentioned kit, preferably, further comprises one or more of Tag DNA Polymerase, an extension-promoting factor, dNTP, a buffer system, and ddH2O.

[0008] In a third aspect, the present invention provides an application of a molecular marker primer pair or a kit in identifying the sex determination system of autotetraploid crucian carp.

[0009] In a fourth aspect, the present invention provides a method for identifying the sex determination system of autotetraploid crucian carp, comprising the following steps: (1) using DNA samples of the autotetraploid crucian carp to be tested, the gynogenetic individuals of the autotetraploid crucian carp, and / or the androgenetic individuals of the autotetraploid crucian carp as templates, performing PCR amplification using the molecular marker primer pairs, and reading the agarose gel electrophoresis results; (2) In the autotetraploid crucian carp to be tested, two bands of 244 bp and 218 bp appeared in the electrophoresis results of male individuals, and a specific band of 218 bp appeared in the electrophoresis results of female individuals; In the gynogenetic offspring of the autotetraploid crucian carp to be tested, if a specific band of 218 bp in length appears in the electrophoresis result of the female offspring, it means that the sex determination genotype of the gynogenetic offspring of the autotetraploid crucian carp to be tested is X type; In the androgenic offspring of the male autotetraploid crucian carp to be tested, if a specific band of 244 bp in length appears in the electrophoresis result, it indicates that the sex-determining genotype of the androgenic offspring of the male autotetraploid crucian carp to be tested is Y-type; in the androgenic offspring of the female autotetraploid crucian carp to be tested, if a specific band of 218 bp in length appears in the electrophoresis result, it indicates that the sex-determining genotype of the androgenic offspring of the female autotetraploid crucian carp to be tested is X-type; If the electrophoresis results of the male and female individuals of the autotetraploid crucian carp to be tested and the gynogenetic offspring of the autotetraploid crucian carp are all consistent, it is determined that the sex determination system of the autotetraploid crucian carp to be tested is XY type.

[0010] In the above method, preferably, the PCR system for PCR amplification is 25 μL; specifically, 1.5 μL of DNA template, 12.5 μL of Rapid Taq Master Mix, 1.0 μL of forward and reverse primers, and finally 9.0 μL of ddH2O; the Rapid Taq Master Mix contains Tag DNA Polymerase, extension promoter, dNTP and buffer system.

[0011] More preferably, the PCR amplification conditions are: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 53°C annealing for 15 s, 72°C extension for 15 s, 35 cycles, then final extension at 72°C for 5 min, and finally storage at 4°C.

[0012] More preferably, the concentration of the agarose gel is 3.0% by mass, the voltage is 220 V, the current is 120 mA, and the running time is 15 to 20 min.

[0013] The present invention has at least the following beneficial effects: 1. The molecular marker primer pair for identifying the sex determination system of autotetraploid crucian carp provided by the present invention is not restricted by the growth stage of autotetraploid crucian carp, saving time and cost, overcoming the limitation of the low degree of evolution of the sex chromosomes of autotetraploid crucian carp, and also providing a new technical means for determining the sex determination system of fish.

[0014] 2. The molecular marker primer pair, kit and method provided by the present invention are low-cost, simple to operate, fast and accurate, and can be applied to identify the sex determination system of autotetraploid crucian carp, providing a more convenient method for determining the sex determination system of autotetraploid crucian carp. At the same time, the molecular marker primer pair can also be used to identify the sex of the male nucleus-developed offspring of autotetraploid crucian carp. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the following briefly introduces the drawings required for use in the embodiments or the description of the prior art. Obviously, the drawings described below are some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying any creative work.

[0016] Figure 1 Sequence diagram of primer pairs designed to verify the sex determination system of autotetraploid crucian carp and the differential gene sequences between male and female autotetraploids.

[0017] Figure 2 This is a PCR agarose gel electrophoresis diagram of the specific amplified fragments of autotetraploid crucian carp and gynogenetic offspring using specific molecular markers for sex determination in autotetraploid crucian carp.

[0018] Figure 3 This is a PCR agarose gel electrophoresis diagram of the specific amplified fragments using the sex determination specific molecular markers of autotetraploid crucian carp to detect the gynogenetic offspring of autotetraploid crucian carp.

[0019] Figure 4 The electrophoresis diagram obtained by using the designed primer pair to verify the sex determination system of autotetraploid crucian carp in androgenic individuals of the present invention. DETAILED DESCRIPTION

[0020] To facilitate understanding of the present invention, the present invention will be described in more comprehensive and detailed form below in conjunction with the accompanying drawings and preferred embodiments. However, the protection scope of the present invention is not limited to the following specific embodiments.

[0021] Unless otherwise defined, all technical terms used hereinafter have the same meanings as those generally understood by those skilled in the art. The technical terms used herein are only for the purpose of describing specific embodiments and are not intended to limit the scope of protection of the present invention.

[0022] Unless otherwise specified, various raw materials, reagents, instruments and equipment used in the present invention can be purchased from the market or prepared by existing methods.

[0023] The method for identifying the sex determination system of autotetraploid crucian carp in the following examples comprises the following steps: (1) Design and synthesis of specific molecular markers for the sex determination system of autotetraploid crucian carp; (2) Design and synthesize the above primer pairs (synthesized by Qingke Biotechnology Co., Ltd.); (3) Preparation of DNA from male and female autotetraploid crucian carp, autotetraploid gynogenetic offspring, and androgenetic offspring; (4) Using the DNA extracted in step (3) as a template, PCR amplification was performed using the primer pair provided by the present invention, and then the PCR product was detected by 3.0% agarose gel electrophoresis; (6) In the autotetraploid crucian carp, if the result of the agarose gel electrophoresis shows two bands of different lengths in the male individual and a shorter specific band in the female individual; in the female nuclear development offspring of the autotetraploid crucian carp, the result of the agarose gel electrophoresis shows a shorter specific band; in the male nuclear development offspring of the autotetraploid crucian carp, if the result of the agarose gel electrophoresis shows a single shorter specific band, it means that the sex determination genotype of the male nuclear development offspring of the autotetraploid crucian carp to be tested is X type; in the male autotetraploid crucian carp and the male nuclear development offspring, if the result of the agarose gel electrophoresis shows a single longer specific band, it means that the sex determination genotype of the male nuclear development offspring of the autotetraploid crucian carp to be tested is Y type; through the above results, it is determined that the sex determination system of the autotetraploid crucian carp is XY type.

[0024] Example 1: A molecular marker primer pair for identifying the sex determination system of autotetraploid crucian carp is developed by the following method: 1. Design of molecular marker primer pairs for the sex determination system of autotetraploid crucian carp Based on the presence of a 26 bp insertion (GGTTCAATAATGACTGATCACAGGTT, see SEQ ID NO. 1) between bases 22647031 and 22647032 on chromosome Chr46B in male autotetraploid individuals, primer pairs were designed upstream and downstream of this position. First, the nucleotide sequence of this region was extracted using samtools software (version number: 1.20), and then primers were designed using the NCBI online tool (Primer-BLAST: https: / / www.ncbi.nlm.nih.gov / tools / primer-blast / ); the reference gene sequences for the designed primers in the male and female genomes are as follows: Figure 1 As shown; 2. Primer synthesis The forward and reverse primers designed were: the upstream forward primer numbered: Primer-F: 5'-AACTGGGCTCCATTGACGAG-3', whose nucleotide sequence is shown in SEQ ID NO. 2; the downstream reverse primer numbered: Primer-R: 5'-GCACGTACTCCCTAAGCTCT-3', whose nucleotide sequence is shown in SEQ ID NO. 3. The primers were synthesized by Qingke Biotechnology Co., Ltd.

[0025] 3. Phenotypic sex determination During the breeding season, sexually mature autotetraploid crucian carp of both sexes, as well as their gynogenetic offspring, were collected for sex determination. Autotetraploid males were able to exude semen, while females and gynogenetic individuals were able to exude eggs. After sex determination, the tail fins were clipped and fixed in anhydrous ethanol for preservation. Ten autotetraploid males, females, and gynogenetic offspring were collected for verification.

[0026] 4. Genomic DNA Extraction The tail fins cut above were used to number the male and female individuals respectively; the male individuals were numbered M1-M10, the female individuals were numbered F1-F10, and the gynogenetic offspring individuals were numbered CF1-CF10; DNA was then extracted using a genomic DNA extraction kit produced by Qingke Biotechnology Co., Ltd., and the steps were performed according to the manufacturer's instructions to prepare DNA samples; after extraction, the DNA concentration and quality were tested using a Qubit fluorescence photometer and 1% agarose gel electrophoresis.

[0027] 5. Verification of specific molecular markers for the autotetraploid sex determination system. The specific steps are as follows: (1) Using the extracted DNA to verify the molecular marker; (2) PCR reaction system: the total reaction system is 25 μL, specifically: 1.5 μL of DNA template, 12.5 μL of Rapid TaqMaster Mix (containing Tag DNA Polymerase, extension promoter, dNTP and optimized buffer system), 1.0 μL of forward and reverse primers, and finally 9.0 μL of ddH2O. After addition, centrifuge and mix; (3) PCR reaction program: 35 cycles of pre-denaturation at 95 °C for 3 min, denaturation at 95 °C for 15 s, annealing at 53 °C for 15 s, and extension at 72 °C for 15 s, followed by a final extension at 72 °C for 5 min, and storage at 4 °C. (4) Agarose gel electrophoresis detection and result analysis: The PCR products were subjected to 3.0% agarose gel electrophoresis at a voltage of 220 V, a current of 120 mA, and a running time of 18 min. The results are as follows: Figure 2 and Figure 3 As shown, two bright bands (one with a length of 244 bp and the other with a length of 218 bp) could be amplified in all male autotetraploid crucian carp individuals, while only a single bright shorter band (218 bp in length) could be amplified in female autotetraploid crucian carp individuals, and only a single bright shorter band (218 bp in length) could be amplified in gynogenetic individuals of autotetraploid crucian carp.

[0028] 6. Identification of molecular markers or primer pairs for the sex determination system of autotetraploid crucian carp and verification of the androgenic progeny of autotetraploid crucian carp. The specific steps are as follows: (1) Sex determination of autotetraploid androgenic offspring Also during the breeding season, sexually mature autotetraploid androgenic offspring were selected for sex determination based on the ability of males to produce semen and females to produce eggs. After sex determination, the tail fins were clipped and fixed in anhydrous ethanol for preservation. Ten of each sex were collected for verification.

[0029] (2) Extraction of genomic DNA from individual offspring of autotetraploid androgenic development First, 10 males and 10 females were numbered separately, with males numbered XM1-XM10 and females numbered XF1-XF10; then, genomic DNA was extracted from each individual according to the method in point 5.

[0030] (3) Identification of the sex determination system of autotetraploid crucian carp was carried out. The specific steps were as follows: the molecular marker was verified using the extracted DNA; the PCR reaction system and PCR reaction procedure were the same as those in point 5; agarose gel electrophoresis detection and result analysis: the PCR product was subjected to 3.0% agarose gel electrophoresis at a voltage of 220 V, a current of 120 mA, and a running time of 18 min.

[0031] The results are as follows Figure 4 As shown, if the result of agarose gel electrophoresis shows a single long specific band (length of 244 bp), it means that the sex determination genotype of the male individual in the androgenic offspring to be tested is Y type; if the result of agarose gel electrophoresis shows a single short specific band (length of 218 bp), it means that the sex determination genotype of the female individual in the androgenic offspring to be tested is X type; combined with the RCR amplification results of the molecular marker primer pair in male and female individuals of autotetraploid crucian carp and the gynogenic offspring of autotetraploid crucian carp, it was determined that the sex determination system of autotetraploid crucian carp is XY type.

[0032] In summary, the present invention is based on an insertion sequence in male individuals of autotetraploid crucian carp, and designs primers based on the upstream and downstream sequences of the insertion sequence; the design is verified by conducting PCR experiments in male and female individuals of autotetraploid crucian carp, and in gynogenetic and androgenetic offspring; then an agarose gel electrophoresis experiment is performed, and finally it is determined that the sex determination system of the autotetraploid crucian carp is XY type. The specific molecular marker primer pair for identifying the sex determination system of autotetraploid crucian carp provided by the present invention can determine the sex determination system of autotetraploid crucian carp, providing a stable, accurate and efficient method for solving this problem. In addition, the molecular marker primer pair developed by the invention can also identify the genetic sex of androgenetic offspring; the sexual maturity of androgenetic offspring of autotetraploid crucian carp is two years old, and the use of the molecular marker primer pair also saves time for the selection and breeding of androgenetic offspring.

Claims

1. A molecular marker primer pair for identifying the sex determination system of autotetraploid crucian carp, characterized in that: The molecular marker primer pair includes an upstream forward primer Primer-F and a downstream reverse primer Primer-R, and the nucleotide sequence thereof is: Primer-F: 5'-AACTGGGCTCCATTGACGAG-3', Primer-R: 5'-GCACGTACTCCCTAAGCTCT-3'.

2. A kit for identifying the sex determination system of autotetraploid crucian carp, characterized in that: Comprising the molecular marker primer pair described in claim 1.

3. The kit according to claim 2, characterized in that The kit further comprises one or more of Tag DNA Polymerase, an extension promoting factor, dNTP, a buffer system and ddH2O.

4. Use of the molecular marker primer pair according to claim 1 or the kit according to any one of claims 2 to 3 in identifying the sex determination system of autotetraploid crucian carp.

5. A method for identifying the sex determination system of autotetraploid crucian carp, characterized in that: The steps include: (1) using the DNA samples of the autotetraploid crucian carp to be tested, the gynogenetic individuals of the autotetraploid crucian carp, and / or the androgenetic individuals of the autotetraploid crucian carp as templates, performing PCR amplification using the molecular marker primer pairs, and reading the agarose gel electrophoresis results; (2) In the autotetraploid crucian carp to be tested, the electrophoresis results of male individuals showed two bands of 244 bp and 218 bp in length, respectively, and the electrophoresis results of female individuals showed a specific band of 218 bp in length; In the gynogenetic offspring of the autotetraploid crucian carp to be tested, if a specific band of 218 bp in length appears in the electrophoresis result of the female offspring, it means that the sex determination genotype of the gynogenetic offspring of the autotetraploid crucian carp to be tested is X-type; In the male homologous tetraploid crucian carp androgenic offspring to be tested, if a specific band with a length of 244 bp appears in the electrophoresis result, it means that the sex-determining genotype of the male homologous tetraploid crucian carp androgenic offspring to be tested is Y-type; in the female homologous tetraploid crucian carp androgenic offspring to be tested, if a specific band with a length of 218 bp appears in the electrophoresis result, it means that the sex-determining genotype of the female homologous tetraploid crucian carp androgenic offspring to be tested is X-type; If the electrophoresis results of the male and female individuals of the autotetraploid crucian carp to be tested and the gynogenetic offspring of the autotetraploid crucian carp to be tested are all consistent, it is determined that the sex determination system of the autotetraploid crucian carp to be tested is XY type.

6. The method according to claim 5, characterized in that The PCR system for the PCR amplification is 25 μL; specifically: 1.5 μL of DNA template, 12.5 μL of Rapid Taq Master Mix, 1.0 μL of forward and reverse primers, and finally 9.0 μL of ddH2O; the Rapid Taq Master Mix contains Tag DNA Polymerase, extension promoting factor, dNTP and buffer system.

7. The method according to claim 5, characterized in that The conditions for the PCR amplification were as follows: 95°C pre-denaturation for 3 min, 95°C denaturation for 15 s, 53°C annealing for 15 s, 72°C extension for 15 s, 35 cycles, and then 72°C final extension for 5 min, and finally storage at 4°C.

8. The method according to claim 5, characterized in that The mass percentage of the agarose gel concentration is 3.0-3.5%.

Images