SNP (Single Nucleotide Polymorphism) site related to intramuscular fat content of pig, related molecular marker and application of SNP site and molecular marker

Abstract

The invention belongs to the technical field of molecular biotechnology and molecular markers, and particularly relates to an SNP (Single Nucleotide Polymorphism) site related to pig intramuscular fat content, a related molecular marker and application of the SNP site. The SNP site corresponds to the 151330919bp site of a No.6 chromosome of an international pig reference genome version 11.1, the polymorphism of a base of the site affects the intramuscular fat content of the pig, the related index of a TT genotype is greater than that of a pig individual with TG and GG genotypes, and the related index of the TG genotype is greater than that of a pig individual with GG genotype. According to the invention, a molecular breeding means is utilized to solve the problem of improving the character expression of the intramuscular fat content of the pig, and by optimizing the dominant alleles of the SNP, the frequency of the dominant alleles can be increased generation by generation, the intramuscular fat content of the pig can be improved, the pork quality can be improved, the genetic modification breeding of the pig can be accelerated, and the economic benefit of a pig farm can be improved.

Description

Technical Field

[0001] The present invention belongs to the field of molecular biotechnology and molecular marker technology. Specifically, the present invention relates to a SNP site related to pig intramuscular fat content, a related molecular marker and an application thereof. Background Art

[0002] Intramuscular fat refers to the fat between muscle fibers in pork, usually called "pattern" or "marble". It has a significant impact on the flavor, tenderness and juiciness of the meat, and is therefore one of the important indicators for evaluating meat quality. Intramuscular fat content is hereditary in pigs. Through reasonable genetic selection, breeders can retain those individuals with excellent intramuscular fat performance, gradually improve the meat quality of pig breeds, effectively increase the intramuscular fat content of pigs, and ensure economic benefits and market adaptability. Summary of the invention

[0003] In order to overcome the deficiencies of the prior art, the object of the present invention is to provide a SNP site associated with the intramuscular fat content of pigs and a SNP molecular marker associated with the site.

[0004] The present invention also aims to provide a substance for detecting the polymorphism or genotype of SNP sites in the pig genome for use in any of the following: (1) identifying or assisting in identifying the intramuscular fat content of pigs; (2) screening or improving the intramuscular fat content trait of pigs; (3) pig breeding.

[0005] Another object of the present invention is to provide a primer composition and a kit for identifying the above-mentioned SNP molecular markers.

[0006] The purpose of the present invention is also to provide the application of the above primer pair and kit, and to provide a genetic improvement method for improving the intramuscular fat content of pigs by molecular marker-assisted breeding.

[0007] The present invention is achieved in that:

[0008] A reagent for detecting a SNP site associated with intramuscular fat content in pigs is used in identifying intramuscular fat content in pigs, wherein the SNP site corresponds to 151330919bp of chromosome 6 of the international pig reference genome version 11.1 and is located in the NFIA gene; the polymorphism of the bases at the site affects the intramuscular fat content in pigs; the intramuscular fat content of TT genotype pigs at the SNP site is higher than that of TG genotype pigs and GG genotype pigs; the intramuscular fat content of TG genotype pigs at the SNP site is higher than that of GG genotype pigs.

[0009] Application of a reagent for detecting a SNP site associated with pork quality traits in screening pigs with high intramuscular fat content, wherein the SNP site corresponds to the 151330919 bp position of chromosome 6 of the international pig reference genome version 11.1 and is located in the NFIA gene; the polymorphism of the bases at this site affects the intramuscular fat content of pigs;

[0010] The intramuscular fat content of the TT genotype pig at the SNP site is higher than that of the TG genotype pig and the GG genotype pig; the intramuscular fat content of the TG genotype pig at the SNP site is higher than that of the GG genotype pig.

[0011] Application of a reagent for detecting a SNP site associated with a pork quality trait in genetic breeding for improving the intramuscular fat content trait of pigs, wherein the SNP site corresponds to the 151330919 bp position of chromosome 6 of the international pig reference genome version 11.1, and is located in the NFIA gene; the polymorphism of the bases at this site affects the intramuscular fat content of pigs;

[0012] The intramuscular fat content of the TT genotype pigs at the SNP site is higher than that of the TG genotype pigs and the GG genotype pigs; the intramuscular fat content of the TG genotype pigs at the SNP site is higher than that of the GG genotype pigs.

[0013] The invention discloses a reagent for detecting a SNP molecular marker related to pork quality traits in identifying the intramuscular fat content of pigs, characterized in that the nucleotide sequence of the SNP molecular marker is ATCTTTAACCCACCGAGCTAGGCTTTCGATCAAACCTTTATCCTCATAGGGACAACGTTGGGTCCTAAACCTACTGCGCCACGACGGGAACTCCACATGTAACTATTTTTAATGATAAAAGTTCTAAGCAAGCAGCATACCATTTTTCCAGAATTGATAGAATGGTCACATCCTAGAAAATTCAGGATACATAAAACAAAGGTATTTCTTAAGCTCGGAGAAGCTTTTCACTTATG TGAATATCTGGTGGGGCTTTCAAACATTTTTTTT(T\G)GGGAAGCAGGAAGGTTCTTCATAGTGCTGGGCTACCTCTGACACTGAAGCACTCTAGGCGTCTTTGATCTACGCCCACCACCTACCAGCAGGGTCTCCAAACATTGCCCCA TCCCAGAACTTCCCCACCCACCAATATCTGAAATGCCGTCTACAGAACGCTGTCATTCCCACCAAGAACCAGCACAGGATGCTTTCAAATGTTATGGTCAGGGCTGGCTTCCAGGGATGTGTGATCTGCATAGTGGCACAGAGCCCCATT

[0014] This SNP site is named (T\G) site. The nucleotide type of the (T\G) site can be T or G, and the genotype can be TT, TG or GG. The intramuscular fat content of TT genotype pigs is higher than that of TG genotype pigs and GG genotype pigs. The intramuscular fat content of TG genotype pigs is higher than that of GG genotype pigs.

[0015] A reagent for detecting a SNP molecular marker associated with pork quality traits in screening pigs with high intramuscular fat content, wherein the nucleotide sequence of the SNP molecular marker is

[0016] ATCTTAACCCACCGAGCTAGGCTTTCGATCAAACCTTTATCCTCATAGGGACAACGTTGGGTCCTAAACCTACTGCGCCACGACGGGAACTCCACATGTAACTATTTTTAATGATAAAAGTTCTAAGCAAGC AGCATACCATTTTTCCAGAATTGATAGAATGGTCACATCCTAGAAAATTCAGGATACATAAAACAAAGGTATTTCTTAAGCTCGGAGAAGCTTTTCACTTATGTGAATATCTGGTGGGGCTTTCAAACATTTTT TTT(T\G)GGGAAGCAGGAAGGTTCTTCATAGTGCTGGGCTACCTCTGACACTGAAGCACTCTAGCGTCTTTGATCTACGCCCACCACCTACCAGCAGGGTCTCCAAACATTGCCCCATCCCAGAACTTCCCCA CCCACCAATATCTGAAATGCCGTCTACAGAACGCTGTCATTCCCACCAAGAACCAGCACAGGATGCTTTCAAATGTTATGGTCAGGGCTGGCTTCCAGGGATGTGTGATCTGCATAGTGGCACAGAGCCCCATT

[0017] This SNP site is named (T\G) site. The nucleotide type of the (T\G) site can be T or G, and the genotype can be TT, TG or GG. The intramuscular fat content of TT genotype pigs is higher than that of TG genotype pigs and GG genotype pigs. The intramuscular fat content of TG genotype pigs is higher than that of GG genotype pigs.

[0018] Application of a reagent for detecting a SNP molecular marker associated with a pork quality trait in genetic breeding for improving the intramuscular fat content trait of pigs, wherein the nucleotide sequence of the SNP molecular marker is ATCTTTAACCCACCGAGCTAGGCTTTCGATCAAACCTTTATCCTCATAGGGACAACGTTGGGTCCTAAACCTACTGCGCCACGACGGGAACTCCACATGTAACTATTTTTAATGATAAAAGTTCTAAGCAAGCAGCATACCATTTTTCCAGAATTGATAGAATGGTCACATCCTAGAAAATTCAGGATACATAAAACAAAGGTATTTCTTAAGCTCGGAGAAGCTTTTCACTTATG TGAATATCTGGTGGGGCTTTCAAACATTTTTTTT(T\G)GGGAAGCAGGAAGGTTCTTCATAGTGCTGGGCTACCTCTGACACTGAAGCACTCTAGGCGTCTTTGATCTACGCCCACCACCTACCAGCAGGGTCTCCAAACATTGCCCCA TCCCAGAACTTCCCCACCCACCAATATCTGAAATGCCGTCTACAGAACGCTGTCATTCCCACCAAGAACCAGCACAGGATGCTTTCAAATGTTATGGTCAGGGCTGGCTTCCAGGGATGTGTGATCTGCATAGTGGCACAGAGCCCCATT

[0019] This SNP site is named (T\G) site. The nucleotide type of the (T\G) site can be T or G, and the genotype can be TT, TG or GG. The intramuscular fat content of TT genotype pigs is higher than that of TG genotype pigs and GG genotype pigs. The intramuscular fat content of TG genotype pigs is higher than that of GG genotype pigs.

[0020] A method for detecting the intramuscular fat content of pigs comprises the following steps: detecting a SNP site located at 151330919 bp of chromosome 6 of the international pig reference genome version 11.1 and located in the NFIA gene of the pig; identifying whether the single nucleotide at the SNP site is T or G; determining the genotype of the tested pig; analyzing and judging that the intramuscular fat content of the TT genotype pig at the SNP site is higher than that of the TG genotype pig and the GG genotype pig; and the intramuscular fat content of the TG genotype pig is higher than that of the GG genotype pig.

[0021] A primer composition for identifying a SNP site associated with pig intramuscular fat content, comprising an upstream primer and a downstream primer, the nucleotide sequence of which is as follows:

[0022] Upstream primer: 5′-ATCTTTAACCCACCGAGCTAGG-3′;

[0023] Downstream primer: 5′-AATGGGGCTCTGTGCCACT-3′;

[0024] The SNP site corresponds to the 151330919bp position of chromosome 6 of the international pig reference genome version 11.1, and is located in the NFIA gene. The intramuscular fat content of TT genotype pigs at the SNP site is higher than that of TG genotype pigs and GG genotype pigs; the intramuscular fat content of TG genotype pigs is higher than that of GG genotype pigs.

[0025] The use of the aforementioned primer combination in identifying the intramuscular fat content of pigs.

[0026] The use of the primer combination in screening pigs with high intramuscular fat content.

[0027] The use of the primer combination in genetic breeding for improving the intramuscular fat content trait of pigs.

[0028] A kit for identifying SNP sites associated with pig intramuscular fat content, the kit comprising the aforementioned primer combination.

[0029] Preferably, the aforementioned kit further comprises at least one of a PCR reaction buffer, a Taq DNA polymerase and dNTPs.

[0030] Through experiments, we found that the T\G site at position 151330919 of chromosome 6 of pigs has a significant effect on the intramuscular fat content of pigs. The nucleotide sequence of this site is:

[0031] ATCTTAACCCACCGAGCTAGGCTTTCGATCAAACCTTTATCCTCATAGGGACAACGTTGGGTCCTAAACCTACTGCGCCACGACGGGAACTCCACATGTAACTATTTTTAATGATAAAAGTTCTAAGCAAGC AGCATACCATTTTTCCAGAATTGATAGAATGGTCACATCCTAGAAAATTCAGGATACATAAAACAAAGGTATTTCTTAAGCTCGGAGAAGCTTTTCACTTATGTGAATATCTGGTGGGGCTTTCAAACATTTTT TTT(T\G)GGGAAGCAGGAAGGTTCTTCATAGTGCTGGGCTACCTCTGACACTGAAGCACTCTAGCGTCTTTGATCTACGCCCACCACCTACCAGCAGGGTCTCCAAACATTGCCCCATCCCAGAACTTCCCCA CCCACCAATATCTGAAATGCCGTCTACAGAACGCTGTCATTCCCACCAAGAACCAGCACAGGATGCTTTCAAATGTTATGGTCAGGGCTGGCTTCCAGGGATGTGTGATCTGCATAGTGGCACAGAGCCCCATT

[0032] This SNP site is named as (T\G) site. The nucleotide type of the (T\G) site can be T or G, and the genotype can be GG, TT or TG. The GG genotype is a homozygous form in which the nucleotide of the (T\G) site is G. The TT genotype is a homozygous form in which the nucleotide of the (T\G) site is T. The TG genotype is a heterozygous form in which the nucleotide of the (T\G) site is T and G.

[0033] Based on the SNP site, the present invention provides a method for identifying or assisting in identifying the intramuscular fat content of pigs, and the present invention provides a method for screening the intramuscular fat content of pigs.

[0034] The genotype identification or auxiliary identification and screening of intramuscular fat content of pigs include at least one of the following:

[0035] (1) The intramuscular fat content of the pig whose genotype of the SNP site is TT is greater than the intramuscular fat content of the pig to be tested whose genotype of the SNP site is TG or GG.

[0036] (2) The intramuscular fat content of pigs whose genotype at the SNP site is TG is greater than the intramuscular fat content of pigs whose genotype at the SNP site is GG.

[0037] The present invention can be used for breeding pigs with higher intramuscular fat content in pig breeding. Gene fragments are amplified by PCR, and the deoxyribonucleotide type at position 151330919 of chromosome 6 is sequenced to detect the genotype of the SNP site in the pig genome to be tested. Pigs with a genotype of TT at the SNP site of the pig genome are selected as parents for breeding to obtain piglets with higher intramuscular fat content.

[0038] The present invention provides a primer composition for detecting the polymorphism or genotype of the SNP site at position 151330919 of chromosome 6 in the pig genome, and also provides a kit including the primer composition. The primer composition can be used for:

[0039] (1) Products that identify or assist in identifying the intramuscular fat content of pigs;

[0040] (2) Products that improve the intramuscular fat content of pigs;

[0041] (3) Products of pig breeding.

[0042] The present invention solves the problem of increasing the intramuscular fat content of pigs by means of molecular breeding. By optimizing the dominant allele of the above SNP, the dominant allele frequency can be increased from generation to generation, the intramuscular fat content of pigs can be increased, the genetic breeding of pigs can be accelerated, and the economic benefits of pig farms can be improved. DETAILED DESCRIPTION

[0043] The present invention is further described in detail below in conjunction with specific embodiments, and the examples provided are only for illustrating the present invention, rather than for limiting the scope of the present invention. The examples provided below can be used as a guide for further improvements by those of ordinary skill in the art, and do not constitute a limitation of the present invention in any way.

[0044] The experimental methods in the examples are conventional methods unless otherwise specified, and are performed according to the techniques or conditions described in the literature in the field or according to the product instructions. The materials, reagents, etc. used in the examples are all commercially available unless otherwise specified.

[0045] The 661 Beijing black pigs in the embodiment were derived from the Beijing black pig meat trait determination group in the laboratory.

[0046] The intramuscular fat content of pigs in the examples is the intramuscular fat content of pigs at 210 days of age.

[0047] In order to establish a method to assist in identifying the intramuscular fat content of pigs, we conducted the following experiments.

[0048] 1. Screening of SNP loci at position 151330919 T\G on pig chromosome 6

[0049] Muscle tissues were collected from 661 Beijing black pigs, and genomic DNA was extracted.

[0050] Upstream primer: 5'-ATCTTTAACCCACCGAGCTAGG-3'

[0051] Downstream primer: 5'-AATGGGGCTCTGTGCCACT-3':

[0052] As amplification primers, PCR amplification was performed with the pig genomic DNA to be tested as template DNA to obtain PCR products, which were then sequenced. Using Seqman software for comparison, a differential site was obtained, named the (T\G) site, located at nucleotide 151330919 of pig chromosome 6. The nucleotide type of the (T\G) site was T or G, and the genotype was TT, TG or GG. The TT genotype was a homozygous body with the nucleotide of the (T\G) site being T. The GG genotype was a homozygous body with the nucleotide of the (T\G) site being G. The TG genotype was a heterozygous body with the nucleotide of the (T\G) site being T and G.

[0053] II. Correlation analysis between the (T\G) locus at position 151330919 of chromosome 6 and intramuscular fat content of pigs

[0054] In order to determine whether the T\G site at position 151330919 of chromosome 6 is correlated with the intramuscular fat content of pigs, 661 Beijing black pigs were used as experimental materials. According to the above experimental method, the pig genome was amplified using upstream primers and downstream primers and then sequenced to determine whether each individual's (T\G) site was TT genotype, TG genotype or GG genotype, the intramuscular fat content of each individual was measured, and correlation analysis was performed.

[0055] 1. Genotype

[0056] The TT genotype is homozygous for T at nucleotide 151330919 on chromosome 6 of pig;

[0057] The GG genotype is homozygous for the nucleotide 151330919 of chromosome 6 of the pig, which is G;

[0058] The TG genotype is a heterozygous T and G nucleotide at position 151330919 of pig chromosome 6.

[0059] The nucleotide sequence of position 151330919 of porcine chromosome 6 is ATCTTTAACCCACCGAGCTAGGCTTTCGATCAAACCTTTATCCTCATAGGGACAACGTTGGGTCCTAAACCTACTGCGCCACGACGGGAACTCCACATGTAACTATTTTTAATGATAAAAGTTCTAAGCAAGCAGCATACCATTTTTCCAGAATTGATAGAATGGTCACATCCTAGAAAATTCAGGATACATAAAACAAAGGTATTTCTTAAGCTCGGAGAAGCTTTTCACTTATGTGAATATCTGGTGGGGCTT TCAAACATTTTTTTT(T\G)GGGAAGCAGGAAGGTTCTTCATAGTGCTGGGCTACCTCTGACACTGAAGCACTCTAGGCGTCTTTGATCTACGCCCACCACCTACCAGCAGGGTCTCCAAACATTGCCCCATCCCAGAACT TCCCCACCCACCAATATCTGAAATGCCGTCTACAGAACGCTGTCATTCCCACCAAGAACCAGCACAGGATGCTTTCAAATGTTATGGTCAGGGCTGGCTTCCAGGGATGTGTGATCTGCATAGTGGCACAGAGCCCCATT

[0060] The SNP site is named as the (T\G) site. The nucleotide type of the (T\G) site can be T (see sequence 1) or G (see sequence 2), and the genotype can be TT, TG or GG. The TT genotype is a homozygous body in which the nucleotide of the (T\G) site is T. The GG genotype is a homozygous body in which the nucleotide of the (T\G) site is G. The TG genotype is a heterozygous body in which the nucleotide of the (T\G) site is T and G.

[0061] The results of the (T\G) locus genotype detection of 661 Beijing black pigs showed that 5 were TT genotype, 69 were TG genotype, and 452 were GG genotype. The genotype frequency and allele frequency of the pig (T\G) locus in the tested pig population are shown in Table 1:

[0062] Table 1. Genotype frequency and allele frequency of the pig (T\G) locus in the tested pig population

[0063]

[0064] As can be seen from Table 1, the genotype frequency of GG homozygous type is significantly higher than that of TT homozygous type and TG heterozygous type, and the G allele is the dominant gene.

[0065] 2. Analysis of the correlation between pig genotype and intramuscular fat content

[0066] The longissimus dorsi muscle samples were collected and the intramuscular fat content was measured using the Soxhlet extraction method.

[0067] Table 2. Genotypes of (T\G) loci and intramuscular fat content (%) of 661 Beijing black pigs

[0068]

[0069]

[0070]

[0071] SAS software was used for the association analysis between genotype and phenotype, and Duncan's multiple test was used for significance test (P < 0.05). The data were expressed as mean ± standard error, and P < 0.05 was considered significant. The results are shown in Table 3. The SNP (T\G) locus has a significant effect on the intramuscular fat content of pigs. The intramuscular fat content of pigs with TT genotype is significantly greater than that of pigs with TG genotype, and the intramuscular fat content of pigs with TG genotype is greater than that of pigs with GG genotype. Therefore, in actual pig breeding, pigs with TT genotype have higher intramuscular fat content.

[0072] Table 3. Single nucleotide polymorphism at position 151330919 on chromosome 6 and intramuscular fat content in pigs

[0073]

[0074] Note: Different lowercase letters in the table indicate significant differences (P < 0.05), the same letters indicate no significant differences (P > 0.05), and the values ​​are mean ± standard error.

[0075] In summary, we determined the genotype of the (T\G) locus at position 151330919 of chromosome 6 to assist in identifying the intramuscular fat content of pigs: the intramuscular fat content of pigs with TT genotype was greater than that of pigs with TG genotype or GG genotype, and the intramuscular fat content of pigs with TG genotype was greater than that of pigs with GG genotype.

[0076] 3. A method for assisting in identifying the intramuscular fat content of pigs

[0077] Muscle tissue of the pig to be tested was collected to extract genomic DNA, and the genomic DNA of the pig to be tested was used as a template. PCR amplification was performed using the upstream primer of sequence 3: 5'-ATCTTTAACCCACCGAGCTAGG-3' and the downstream primer of sequence 4: 5'-AATGGGGCTCTGTGCCACT-3' to obtain a PCR product, and the PCR product was sequenced to obtain the genotype of the SNP (T\G) site of the pig to be tested.

[0078] The intramuscular fat content of the tested pigs with genotype TT is greater than that of the tested pigs with genotype TG or GG. The intramuscular fat content of the tested pigs with genotype TG is greater than or slightly greater than that of the tested pigs with genotype GG.

[0079] Fourth, the present invention provides a SNP molecular marker that can effectively increase the intramuscular fat content of pigs. Using the SNP molecular marker for marker-assisted selection can accelerate the breeding process of related excellent traits. If all the TG genotype and GG genotype individuals of pigs are bred into TT individuals, the intramuscular fat content of pigs will be improved. Among the SNP molecular marker individuals, the dominant allele TT of the SNP in the pig population can increase the intramuscular fat content of pigs, thereby increasing the profits of the enterprise.

[0080] The above embodiments are preferred implementation modes of the present invention, but the implementation modes of the present invention are not limited to the above embodiments. Any other changes, modifications, substitutions, combinations, and simplifications that do not deviate from the spirit and principles of the present invention should be regarded as equivalent replacement methods and are included in the protection scope of the present invention.

Claims

1. Use of a reagent for detecting SNP sites associated with pork quality traits in identifying intramuscular fat content of pigs, characterized in that: The SNP site corresponds to the 151330919 bp of chromosome 6 of the international pig reference genome version 11.1, and is located in the NFIA gene; the polymorphism of the bases at this site affects the intramuscular fat content of pigs; The intramuscular fat content of the TT genotype pigs at the SNP site is higher than that of the TG genotype pigs and the GG genotype pigs; The intramuscular fat content of TG genotype pigs at the SNP site is higher than that of GG genotype pigs.

2. Use of a reagent for detecting SNP sites associated with pork quality traits in screening pigs with high intramuscular fat content, characterized in that: The SNP site corresponds to the 151330919 bp of chromosome 6 of the international pig reference genome version 11.1, and is located in the NFIA gene; the polymorphism of the bases at this site affects the intramuscular fat content of pigs; The intramuscular fat content of the TT genotype pigs at the SNP site is higher than that of the TG genotype pigs and the GG genotype pigs; The intramuscular fat content of TG genotype pigs at the SNP site is higher than that of GG genotype pigs.

3. Use of a reagent for detecting SNP sites associated with pork quality traits in genetic breeding for improving intramuscular fat content traits in pigs, characterized in that: The SNP site corresponds to the 151330919 bp of chromosome 6 of the international pig reference genome version 11.1, and is located in the NFIA gene; the polymorphism of the bases at this site affects the intramuscular fat content of pigs; The intramuscular fat content of the TT genotype pigs at the SNP site is higher than that of the TG genotype pigs and the GG genotype pigs; The intramuscular fat content of TG genotype pigs at the SNP site is higher than that of GG genotype pigs.

4. Use of a reagent for detecting SNP molecular markers associated with pork quality traits in identifying intramuscular fat content of pigs, characterized in that: The nucleotide sequence of the SNP molecular marker is This SNP site is named (T\G) site. The nucleotide type of the (T\G) site can be T or G, and the genotype can be TT, TG or GG. The intramuscular fat content of TT genotype pigs is higher than that of TG genotype pigs and GG genotype pigs. The intramuscular fat content of TG genotype pigs is higher than that of GG genotype pigs.

5. Use of a reagent for detecting SNP molecular markers associated with pork quality traits in screening pigs with high intramuscular fat content, characterized in that: The nucleotide sequence of the SNP molecular marker is This SNP site is named (T\G) site. The nucleotide type of the (T\G) site can be T or G, and the genotype can be TT, TG or GG. The intramuscular fat content of TT genotype pigs is higher than that of TG genotype pigs and GG genotype pigs. The intramuscular fat content of TG genotype pigs is higher than that of GG genotype pigs.

6. Use of a reagent for detecting SNP molecular markers associated with pork quality traits in genetic breeding for improving the intramuscular fat content trait of pigs, characterized in that: The nucleotide sequence of the SNP molecular marker is This SNP site is named (T\G) site. The nucleotide type of the (T\G) site can be T or G, and the genotype can be TT, TG or GG. The intramuscular fat content of TT genotype pigs is higher than that of TG genotype pigs and GG genotype pigs. The intramuscular fat content of TG genotype pigs is higher than that of GG genotype pigs.

7. A method for detecting the intramuscular fat content of pigs, characterized in that: The method comprises the following steps: detecting a SNP site located at 151330919bp of chromosome 6 of the international pig reference genome version 11.1, which is located in the NFIA gene; identifying whether the single nucleotide at the SNP site is T or G; determining the genotype of the tested pig; and analyzing and judging that the intramuscular fat content of the TT genotype pig at the SNP site is higher than that of the TG genotype pig and the GG genotype pig; and the intramuscular fat content of the TG genotype pig is higher than that of the GG genotype pig.

8. A primer composition for identifying SNP sites associated with pig intramuscular fat content, characterized in that: The primer composition comprises an upstream primer and a downstream primer, and the nucleotide sequence thereof is as follows: Upstream primer: 5′-ATCTTTAACCCACCGAGCTAGG-3′; Downstream primer: 5′-AATGGGGCTCTGTGCCACT-3′; The SNP site corresponds to chromosome 6, 151330919bp of the international pig reference genome version 11.1, and is located within the NFIA gene. The intramuscular fat content of TT genotype pigs at the SNP site is higher than that of TG genotype pigs and GG genotype pigs; the intramuscular fat content of TG genotype pigs is higher than that of GG genotype pigs.

9. Use of the primer combination according to claim 8 in identifying the trait of intramuscular fat content in pigs.

10. Use of the primer combination according to claim 8 in screening pigs with high intramuscular fat content.

11. Use of the primer combination according to claim 8 in genetically assisted breeding for improving the intramuscular fat content trait of pigs.

12. A kit for identifying SNP sites associated with pig intramuscular fat content, characterized in that: The kit comprises the primer combination according to claim 8.

13. The kit for identifying SNP sites associated with pig intramuscular fat content according to claim 12, characterized in that: The kit also includes at least one of a PCR reaction buffer, Taq DNA polymerase and dNTPs.

Images