FolRtt109 gene targeting agent and application thereof in inhibiting phytopathogen

Abstract

The invention discloses a FolRtt109 gene targeting agent and an application of the FolRtt109 gene targeting agent in inhibition of phytopathogen. In the fusarium oxysporum, the pathogenicity of the fusarium oxysporum can be obviously inhibited by knocking out the gene FolRtt109, and the gene has a crucial relationship with the pathogenicity of the fusarium oxysporum. The gene is knocked out by using a homologous recombination method to obtain a gene knockout mutant, and the pathogenicity of the mutant to tomatoes is remarkably reduced. Experiments prove that by applying the FolRtt109 gene targeted medicament CID-4785700, infection of various phytopathogens such as fusarium oxysporum, botryis cinerea, fusarium graminearum and magnaporthe oryzae can be remarkably inhibited, the purpose of preventing and treating the various phytopathogens can be achieved, and the FolRtt109 gene targeted medicament CID-4785700 is simple in use method, free of influence on plant growth, safe, reliable and suitable for popularization and application. Wide application prospects are realized.

Description

Technical Field

[0001] The present invention belongs to the technical field of plant genetic engineering and specifically relates to a FolRtt109 Gene targeting agents and their applications in inhibiting plant pathogens. Background Art

[0002] Tomato wilt is caused by Fusarium oxysporum tomato-specific type ( Fusarium oxysporum f. sp. Lycopersici, Fol ) seriously threatens tomato production and causes huge economic losses. Fusarium oxysporum is a facultative parasite that can survive in the soil and infect plants. It can infect cotton ( Gossypium hirsutum )、Soybeans( Glycine max ),watermelon( Citrullus lanatus ),banana( Musa nana ),tomato( Lycopersicon esculentum ) and alfalfa ( Medicago sativa ) and more than 100 other crops of important economic value. The fungus causes wilt and root rot and is listed as one of the top ten plant pathogenic fungi in the world.

[0003] Fusarium oxysporum lurks in the soil, infecting tomatoes by entering the roots and entering various organs through the wood. Excessive growth of hyphae causes blockage and browning. Symptoms appear at the base of the stem in the early stages of infection and slowly develop upward, causing young leaves to wilt. After infecting mature leaves, the edges of the leaves turn yellow or completely turn green, and later the tomatoes will wilt or die. The spores of Fusarium oxysporum will form a pink fungus layer on dead tomatoes, and then disperse in the soil to lurk.

[0004] Since Fusarium oxysporum can survive in the soil for a long time and has a strong adaptability to the environment, it is crucial to prevent and control Fusarium oxysporum. There are many ways to prevent and control Fusarium oxysporum, including biological control, pesticide control, physical control, etc. However, the most effective is chemical control. The agents with good control effects on Fusarium wilt mainly include azoles, methyl esters, amides, etc., and the methods of use include seed disinfection, soil treatment, and root irrigation of agents. Metalaxyl, chloranil, and thiophanate-methyl, which are composed of metalaxyl and chloranil, are very effective in inhibiting Fusarium oxysporum. However, it has been reported that the effect of using only a single agent for the prevention and control of Fusarium wilt may not be obvious, and a mixed agent must be used to achieve a significant effect. However, Fusarium oxysporum has an increasingly high resistance to these common fungicides, which poses great difficulties in the prevention and control of Fusarium wilt. Therefore, it is urgent to find new plant fungicides, which is of great significance to the future development of agriculture. Summary of the invention

[0005] In view of the above problems existing in the prior art, the purpose of the present invention is to provide a FolRtt109A gene targeting agent and its application in inhibiting plant pathogens. The gene targeting agent provided by the present invention can inhibit the pathogenicity of Fusarium oxysporum and has an antibacterial effect on a variety of plant pathogens, and has important practical application significance.

[0006] To achieve the above invention objectives, the present invention is implemented through the following solutions: The present invention provides a FolRtt109 Gene targeting agent, the FolRtt109 The gene targeting agent is compound CID-4785700, and the chemical structural formula of the compound CID-4785700 is: .

[0007] Furthermore, the FolRtt109 Gene targeting agents FolRtt109 The nucleotide sequence of the gene is shown in SEQ ID NO.1.

[0008] Furthermore, the FolRtt109 The amino acid sequence of the FolRtt109 protein encoded by the gene is shown in SEQ ID NO.3.

[0009] The present invention also provides the FolRtt109 Application of gene targeting agents in inhibiting plant pathogens.

[0010] Furthermore, the FolRtt109 The method of using gene targeting agents is: FolRtt109 The gene targeting agent is formulated to a use concentration and applied to the plants by root irrigation or spraying.

[0011] Furthermore, the FolRtt109 The concentration of gene targeting agent for root irrigation is 10 µM~50 µM.

[0012] Furthermore, the FolRtt109 The concentration of gene targeting agent spraying is 10 µM~50 µM.

[0013] Furthermore, the plant pathogens include Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum and Magnaporthe oryzae.

[0014] Furthermore, the plants include tomatoes, mung beans, wheat and rice.

[0015] Compared with the prior art, the advantages and beneficial effects of the present invention are as follows: the present invention has been verified by experiments that by knocking out the gene in Fusarium oxysporum FolRtt109The gene can significantly inhibit the pathogenicity of Fusarium oxysporum, and the gene is crucial to the pathogenicity of Fusarium oxysporum. The gene knockout mutant was obtained by homologous recombination, and the mutant's pathogenicity to tomatoes was significantly reduced. The invention has been proved by experiments that the application of FolRtt109 The gene-targeted drug CID-4785700 can significantly inhibit the infection of various plant pathogens such as Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum and rice blast fungus, and can achieve the purpose of preventing and controlling various plant pathogens. It is simple to use, has no effect on plant growth, and is safe and reliable. Therefore, the small molecule compound CID-4785700 has a good control effect on various plant pathogens and has broad application prospects. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 The present invention FolRtt109 Electrophoresis detection of gene knockout; Figure 2 yes FolRtt109 Gene knockout leads to decreased pathogenicity of Fusarium oxysporum. NT is the negative control without any treatment. After the wild type WT and the knockout mutant ΔFolRtt109 were infected with tomato roots for 14 days, the pathogenicity was counted and photographed. The disease index is counted on the right; Figure 3 CID-4785700 at a concentration of 10 µM can significantly inhibit the pathogenicity of Fusarium oxysporum. NT is a negative control without any treatment. After infection with Fusarium oxysporum WT, CID-4785700 at a concentration of 10 µM CID-4785700 was irrigated, and 14 days later, pathogenicity was counted and photographed. On the right, the disease index was counted; Figure 4 CID-4785700 can significantly inhibit the pathogenicity of Botrytis cinerea, Magnaporthe oryzae and Fusarium graminearum at a concentration of 10 µM. NT is the negative control without any treatment. The right side is the measurement and statistics of the lesion diameter. Figure 5 CID-4785700 has no significant effect on the growth of host plants at a concentration of 50 µM. Tomato, rice, mung bean and wheat were sprayed with 50 µM of the corresponding agent after seedling emergence, and DMSO of the same concentration was used as a control. The host plants continued to grow for two weeks and then took photos. The right side shows the measurement and statistics of plant height. DETAILED DESCRIPTION

[0017] The technical solution of the present invention is further described in detail below in conjunction with the accompanying drawings and specific embodiments.

[0018] The experimental methods in the following examples are all conventional methods unless otherwise specified. The experimental materials, drugs, instruments, etc. used in the following examples are all commercially available products unless otherwise specified. The quantitative statistics in the following examples are all repeated experiments three times and the average value is taken.

[0019] The embodiments of the present invention mainly include the following experimental contents: 1. Gene knockout FolRtt109 :Design primers to amplify the upstream and downstream fragments of the gene and the hygromycin fragment, and fuse them using PCR technology. Preparation Fol After protoplasting, the fusion fragment was transferred into protoplasts, and knockout mutants were identified by PCR using hygromycin resistance as a selection marker.

[0020] 2. Validation of the pathogenicity of knockout mutants: FolRtt109 Knockout mutants and Fol The wild-type strain was shake-cultured in PDB medium for 24 h, conidia were collected and used to infect tomato roots. Tomatoes were cultured normally for 14 days, and the disease incidence of tomatoes was counted.

[0021] 3. After Fol infected the tomato roots, 10 μM CID-4785700 was irrigated into the roots, and the same concentration of DMSO was used as a control. CID-4785700 can inhibit the pathogenicity of Fusarium oxysporum.

[0022] 4. After Botrytis cinerea, Magnaporthe oryzae and Fusarium graminearum infected mung bean, rice and wheat respectively, they were sprayed with 10 μM CID-4785700, and the same concentration of DMSO was used as a control. CID-4785700 can inhibit the pathogenicity of Botrytis cinerea, Rice blast fungus and Fusarium graminearum.

[0023] Embodiment 1: FolRtt109 Gene sequence acquisition and gene knockout The present invention obtains Fusarium oxysporum from Genebank FolRtt109 The sequence of the gene is 1796 bp in total (the sequence is shown in SEQ ID NO.1), the CDS sequence is 951 bp in length (the sequence is shown in SEQ ID NO.2), and encodes 316 amino acids (the sequence is shown in SEQ ID NO.3).

[0024] The gene knockout vector was designed according to the sequence of the gene, and the designed primers are shown in Table 1: Table 1 Primers used for vector construction DNA from Fusarium oxysporum was extracted using the CTAB method and used as a template to amplify the up and down fragments of FolRtt109, and the hygromycin gene was amplified from the pSilent-1 plasmid using HPH-F / R primers. The three fragments were connected into a large fragment up-HPH-down by fusion PCR to prepare for protoplast transformation.

[0025] Example 2: Gene knockout of Fusarium oxysporum FolRtt109 and identification Knockout mutants were obtained by protoplast transformation. 6-8 bacterial cakes of Fusarium oxysporum were added to 20 mL PDB medium at 25°C and 180 rpm for 24 hours. The filtered spore liquid was added to 100 mL YEPD medium at 25°C and 180 rpm for 16-18 hours, and then the mycelium was collected. The protoplasm of Fusarium oxysporum was obtained after treatment with lytic enzyme at 30°C and 120 rpm for 3 hours, and the fusion fragments amplified by PCR and reagents such as STC and SPTC were added to complete the protoplasm transformation.

[0026] The genome of the isolated transformants was extracted, and the In-F / R primers (F: GCTGGCTGAGAAGAACAAGG; R: GTCCTCGAGAAGCCAGTTTG) for identifying transformants were used to amplify FolRtt109-in; and the Out-F / R primers (F: CGGCCGGTCTGTGTATAAGT; R: CATGGCTCAAGT GTTGCCTA) were used to amplify FolRtt109-out. The gene no longer exists in the knockout mutant, and the FolRtt109-in and out fragments cannot be amplified. The PCR identification is shown in the figure below. Figure 1 shown.

[0027] Example 3: Detection of virulence of Fusarium oxysporum FolRtt109 knockout mutant The bacterial cakes of wild-type WT and knockout mutant ΔFolRtt109 were added to PDB medium and cultured at 25°C, 180 rpm for 24 h to obtain conidia. The spore concentration was unified to 10 6 / ml. Select tomato seedlings with uniform growth, treat the roots to 1 cm, create wounds, soak in spore solution, and then plant in vermiculite. After culturing at 25 degrees Celsius for 14 days, calculate the disease index and take photos. The experimental results are shown in Figure 2 As shown, compared with the wild type, the pathogenicity of ΔFolRtt109 was significantly reduced, indicating that FolRtt109 is closely related to the pathogenicity of Fusarium oxysporum and can affect pathogenicity.

[0028] Example 4: Inhibition test of CID-4785700 on Fusarium oxysporum Wild-type FolThe bacterial cake was added to PDB medium and cultured at 25°C, 180 rpm for 24 h to obtain conidia. The spore concentration was unified to 10 6 / ml. Tomato seedlings with consistent growth were selected, and the roots were treated to 1 cm to create wounds. They were then soaked in spore solution and then planted in vermiculite. They were irrigated with a solution with a final concentration of 10 µM of the drug, and compared with a solution with the same concentration of DMSO. After culturing at 25 degrees Celsius for 14 days, the disease index was calculated and photographed. For specific results, see Figure 3 As shown, the application of CID-4785700 was able to significantly inhibit the pathogenicity of Fusarium oxysporum compared to the control.

[0029] The chemical structure of CID-4785700 is shown below: .

[0030] Example 5: Inhibition test of CID-4785700 against Botrytis cinerea, Fusarium graminearum and Magnaporthe oryzae 1. Collect the conidia of wild-type Botrytis cinerea B05.10 cultured on PDA medium for about 8 days and adjust the conidia concentration to 10 5 / ml. The agent was dissolved in DMSO and added to the spore solution to adjust the final concentration to 10 µM. The spore solution was dropped on the center of the plant leaves, and after 3 days of moisturizing and culturing, photos were taken and the diameter of the lesions was measured.

[0031] 2. Collect the conidia of rice blast fungus on the oat medium and adjust the concentration to 10 6 / ml. 10 µM of the drug was added to the spore solution. Leaves of 2-week-old rice plants were cut and dripped with spore solution. Photos were taken 3 days later and the diameter of the lesions was measured.

[0032] 3. After Fusarium graminearum was grown on PDA medium for 3 days, it was added to mung bean medium and cultured under light for 3 days. Conidia were collected and the concentration was adjusted to 10 5 / ml. The agent was dissolved in DMSO and added to the spore solution to adjust the final concentration to 10 µM. After 48 hours of wheat germ growth, 2 µl of spore solution was dropped on it. Three days later, photos were taken and the diameter of the lesions was measured.

[0033] Specific results such as Figure 4 As shown: Compared with the control, the application of CID-4785700 can significantly reduce the size of lesions caused by Botrytis cinerea, Rice blast fungus and Fusarium graminearum infecting different host plants.

[0034] Example 6: CID-4785700 has no significant effect on the growth of host plants Tomato, mung bean, rice and wheat were sprayed with 50 µM CID-4785700 after seeding, and the same concentration of DMSO was used as a control. After 2 weeks, photos were taken and the height of the plants was measured. Figure 5 Shown: Application of CID-4785700 had no significant effect on the host plants compared to the control.

[0035] The above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit the same. Although the present invention has been described in detail with reference to the aforementioned embodiments, it is still possible for a person skilled in the art to modify the technical solutions described in the aforementioned embodiments, or to replace some of the technical features therein by equivalents. However, these modifications or replacements do not deviate the essence of the corresponding technical solutions from the spirit and scope of the technical solutions claimed to be protected by the present invention.

Claims

1. A FolRtt109 A gene targeting agent, characterized in that Said FolRtt109 The gene targeting agent is compound CID-4785700, and the chemical structural formula of the compound CID-4785700 is: 。 2. according to claim 1 FolRtt109 A gene targeting agent, characterized in that Said FolRtt109 Gene targeting agents FolRtt109 The nucleotide sequence of the gene is shown in SEQ ID NO.

1.

3. According to claim 2 FolRtt109 A gene targeting agent, characterized in that Said FolRtt109 The amino acid sequence of the FolRtt109 protein encoded by the gene is shown in SEQ ID NO.

3.

4. The method according to any one of claims 1 to 3 FolRtt109 Application of gene targeting agents in inhibiting plant pathogens.

5. The use according to claim 4, characterized in that: Said FolRtt109 The method of using gene targeting agents is: Rtt109 The gene targeting agent is formulated to a use concentration and applied to the plants by root irrigation or spraying.

6. The use according to claim 5, characterized in that: Said FolRtt109 The concentration of gene targeting agent for root irrigation is 10 µM~50 µM.

7. The use according to claim 5, characterized in that: Said FolRtt109 The concentration of gene targeting agent spraying is 10 µM~50 µM.

8. The use according to claim 4, characterized in that: The plant pathogens include Fusarium oxysporum, Botrytis cinerea, Fusarium graminearum and Magnaporthe oryzae.

9. The use according to claim 4, characterized in that: The plants include tomato, mung bean, wheat and rice.

Images