Programmable multi-modified long-acting slow-release elastin-like ELP carrier and application thereof

Abstract

The invention discloses a programmable multi-modified long-acting slow-release elastin-like protein (ELP) vector and an application thereof. A programmable biosynthesis method is utilized to construct a series of ELPs with different structures and properties consisting of different amino acids, including a composite characteristic positive charge series ELP (IVK), a composite characteristic negative charge series ELP (IVE), a composite characteristic benzene ring series ELP (IVF), a composite characteristic hydroxyl benzene ring series ELP (IVY) and a structure chimeric characteristic series ELP (IVYIVE). After subcutaneous injection, the ELP carrier is subjected to in-situ phase change under the triggering of body temperature and forms a drug reservoir, and the drug is slowly released from the reservoir to an in-vivo circulatory system, so that the effective action time of single injection of the drug is remarkably prolonged, pharmacokinetic parameters are improved, and the compliance of a patient is improved. The programmable slow-release ELP has wide application potential and is suitable for delivery of various drugs such as proteins, nucleic acids, polypeptides, antibodies and small molecule drugs.

Description

Technical Field

[0001] The present invention belongs to the field of genetic engineering and biomedicine technology, and specifically relates to the synthesis of a novel programmable multi-modified long-acting sustained-release elastin-like polypeptide (ELP) carrier and its application in drug delivery. Background Art

[0002] Peptide, antibody and protein drugs are developing rapidly in the field of biomedicine. Compared with traditional small molecule drugs, they have advantages such as high biological activity, strong specificity, low toxicity, and good affinity with receptors in the body. Therefore, they are considered to be promising biomacromolecule drugs. So far, many peptide, antibody and protein drugs have been marketed and have achieved huge economic benefits. However, most of these drugs have problems such as poor stability, short half-life in the body, and low bioavailability. Especially in the treatment of chronic diseases, protein and peptide drugs often require long-term and frequent administration, which not only reduces patient compliance but also may cause adverse reactions. Therefore, the development of long-acting drug delivery strategies is of great clinical significance. For example, glucagon-like peptide 1 (GLP-1) is a potential drug for the treatment of type 2 diabetes. It loses its biological activity due to its easy degradation by dipeptidyl peptidase-4 (DPP-4). The drug half-life is only about 2 minutes, and frequent administration is required to maintain the therapeutic effect, which seriously affects patient compliance. Similarly, bevacizumab requires frequent intravitreal injections to treat age-related maculopathy, which can easily induce complications such as retinal hemorrhage and cataracts. Therefore, the development of long-acting drugs to improve patient compliance is urgent.

[0003] At present, the strategies for the long-acting of peptides, antibodies and protein drugs include: constructing mutants, Fc fragment fusion, glycosylation modification and polyethylene glycol (PEG) modification. The construction of mutants is to prolong the plasma half-life by reducing unstable amino acids and enhancing protease resistance, but the efficiency of finding key sites through random mutation is low and the results are uncertain. Although Fc fragment fusion can prolong the half-life of proteins, it has poor stability due to its complex structure; glycosylation modification is affected by factors such as sugar type, molecular size, and charge, and the process is complex and the yield is low. PEG modification can reduce renal clearance, but the problems of reduced drug activity, non-biodegradability and immunogenicity after PEG modification limit its clinical application. The above strategies still have limitations in long-acting time, safety, stability and controllability, and the production cost is high. Therefore, it is particularly important to develop safer and more economically feasible long-acting drug carriers.

[0004] Elastin-like polypeptides (ELPs) are polypeptide polymers composed of Val-Pro-Gly-X-Gly repeating sequences, where X represents any amino acid except proline. ELP has a special temperature responsiveness and exhibits lower critical solution temperature (LCST) phase behavior. By adjusting the sequence and length of ELP, its phase transition temperature can be precisely regulated, thereby achieving precise control of drug release. Since ELP is derived from natural elastin, it has good biocompatibility and extremely low immunogenicity. Different amino acids have different physicochemical properties, which greatly enriches the ability of ELP to carry drugs (including chemical conjugation, biofusion, etc.). ELP is biosynthesized by gene encoding, and the required multifunctional biomaterial ELP can be accurately prepared. It can carry almost any type of cargo, including drugs ranging from small molecules to large molecule fusion proteins, and thus becomes a long-acting drug carrier with great potential. For chronic diseases, long-acting sustained-release drugs are one of the best treatments. By constructing an ELP-drug conjugate that is recombinantly fused or chemically conjugated with a drug, regulating its phase transition temperature to below the physiological temperature, an in situ LCST phase transition occurs at the injection site after injection to form an aggregate drug reservoir to achieve slow release of the drug. This drug reservoir can be used for local treatment, and can also regulate the drug to be slowly released with specific kinetics and gradually enter the blood circulation for systemic treatment. The ELP involved in the present invention is a drug delivery platform based on biosynthesis, precise modification and intelligent sustained release technology.

[0005] The present invention constructs a series of ELP polymer carriers with different amino acid characteristics through programmable biosynthesis technology, and screens out preferred ELP carriers that can achieve long-acting sustained release, providing an innovative solution for long-acting drug delivery. Summary of the invention

[0006] The present invention aims to provide a programmable multi-modified long-acting sustained-release elastin (ELP) carrier and its application. Through gene encoding biosynthesis technology, the present invention arranges and combines amino acids of different structures according to a specific ratio to develop an innovative ELP drug delivery system. On the one hand, the present invention is based on isoleucine and valine, combined with various structures such as positive charge, negative charge, benzene ring, hydroxybenzene ring, or these structures are chimeric in pairs, and a series of programmable ELP carriers are biosynthesized. Through the temperature detection of the critical phase behavior in vitro, candidate ELP carriers that can undergo in situ phase change and form an ordered aggregate drug reservoir at body temperature are screened out. On the other hand, the ELP carriers carrying different characteristic amino acids have different sustained release rates and metabolic efficiencies in vivo. These candidate ELP carriers are labeled with Cy7, and long-acting new programmable ELP carriers are screened out by small animal in vivo imaging technology, thereby extending the drug half-life, optimizing pharmacokinetic parameters, and improving patient compliance.

[0007] The preferred programmable sustained-release ELP obtained by screening of the present invention comprises good temperature response characteristics, negative charge modification, suitable size and ultra-long-acting sustained-release characteristics. After subcutaneous injection, the programmable sustained-release ELP undergoes a phase change in situ under the triggering of body temperature and forms a drug reservoir, and the drug is slowly released from the reservoir to the body's circulatory system, significantly prolonging the effective action time of a single injection of the drug, improving pharmacokinetic parameters, and improving patient compliance. The preferred programmable sustained-release ELP has a wide range of application potentials and is suitable for the delivery of a variety of drugs such as proteins, peptides, antibodies, and small molecule drugs, especially showing significant advantages in long-acting sustained release and drug bioavailability.

[0008] The technical solution adopted by the present invention relates to a new type of drug sustained-release long-acting polymer carrier system, the specific contents of which are as follows:

[0009] In a first aspect of the present invention, a long-acting polymer carrier for sustained drug release is provided, which is composed of elastin-like protein (ELP) and contains a structure of positive charge, negative charge, hydroxybenzene ring, positive charge embedded hydroxybenzene ring, or negative charge embedded hydroxybenzene ring.

[0010] Specifically, the present invention utilizes a programmable biosynthesis method to construct a series of ELPs with different structures and properties composed of different amino acids, including a composite characteristic positive charge series ELP (IVK), a composite characteristic negative charge series ELP (IVE), a composite characteristic benzene ring series ELP (IVF), a composite characteristic hydroxybenzene ring series ELP (IVY) and a structural chimeric characteristic series ELP (IVYIVE).

[0011] In some embodiments of the present invention, the elastin-like protein can undergo an in-situ phase transition at 37° C. to form an orderly arranged biological aggregate.

[0012] In some embodiments of the present invention, the elastin-like protein can sensitively respond to external stimuli such as temperature, charge, enzyme, light or chemical substances.

[0013] In some embodiments of the present invention, the elastin-like sequence is (VPGXG)n, wherein n=60-180, preferably n=120-150, X represents any amino acid except proline, and n is an integer.

[0014] In some embodiments of the present invention, X may be at least one of lysine, glutamic acid, tyrosine, phenylalanine, alanine, and isoleucine.

[0015] In some embodiments of the present invention, the drug delivery carrier can be used as an environmental stimulus responsive aggregate, which produces a sensitive response when stimulated by temperature, pH, enzyme, charge, light or chemical substances.

[0016] In some embodiments of the present invention, the response temperature range of the drug carrier ELP polymer is 10°C to 50°C, preferably 16°C to 28°C.

[0017] In some embodiments of the present invention, the amino acid sequence of the ELP polymer is shown in SEQ ID NO.11, or SEQ ID NO.12, or SEQ ID NO.13, or SEQ ID NO.14, or SEQ ID NO.15, or SEQ ID NO.16, or SEQ ID NO.17, or SEQ ID NO.18. Preferred ELP amino acid sequences include:

[0018] [(VPGIG)4(VPGVG)4(VPGEG)1]2[(VPGIG)4(VPGVG)4(VPGYG)1] 14 .

[0019] The second aspect of the present invention provides a nucleic acid molecule encoding all of the above-mentioned elastin-like proteins.

[0020] In some embodiments of the present invention, the nucleic acid molecule is DNA or RNA, which is composed of an arrangement and combination of nucleic acid molecules of basic units, including amino acid sequence units encoding VPGVG, or VPGIG, or VPGYG, or VPGFG, or VPGKG, or VPGEG, or a combination of at least two or more units.

[0021] In some embodiments of the present invention, the amino acids encoded by the nucleic acid molecule have codon degeneracy, the above-mentioned elastin-like nucleic acid molecule sequence is not unique, and any nucleic acid sequence that can encode the above-mentioned ELP is covered within the protection scope of the present invention.

[0022] In some preferred embodiments of the present invention, the amino acid sequence of the elastin-like combination unit encoded by the nucleic acid molecule is shown in SEQ ID NO.18.

[0023] The third aspect of the present invention provides the polymer carrier described in the first aspect of the present invention or the biological material related to the nucleic acid molecule described in the second aspect of the present invention, wherein the biological material is any one of the following (a1) to (d1):

[0024] (a1) The biological material comprises the ELP aggregate of the first invention or the expression cassette of the nucleic acid molecule of the second invention;

[0025] (b1) The expression cassette of (a1) comprises a recombinant plasmid vector, or a recombinant cell, or an expression cell, or an expression cell containing a recombinant plasmid, such as Escherichia coli DH5α, BL21, or yeast, HEK-293T cells;

[0026] (c1) The recombinant plasmid vector of (b1) comprises a promoter, a reading frame, a terminator, an enhancer and other regulatory expression elements;

[0027] (d1) The recombinant cell or expression cell of (b1) is used in a prokaryotic (such as Escherichia coli DH5α and BL21, etc.) or eukaryotic (such as yeast and HEK-293T, etc.) expression system.

[0028] In a fourth aspect of the present invention, a programmable ELP polymer carrier is provided which is coupled to an active molecule by chemical or biological methods, wherein the active molecule comprises a diagnostic agent and / or a therapeutic agent and / or a molecular switch.

[0029] In some embodiments of the invention, the diagnostic agent includes a fluorescent label, a radioactive label, or the like.

[0030] In some preferred embodiments of the present invention, the fluorescent marker includes at least one of Cy7, Cy5, Cy3, GFP, YFP, BFP, CFP, etc.

[0031] In some embodiments of the present invention, the therapeutic agent includes polypeptides, antibodies, proteins, nucleic acid drugs, chemical drugs, traditional Chinese medicine, etc. These include monoclonal antibodies, domain antibodies, nanobodies, bispecific antibodies, multispecific antibodies, chimeric antibodies, antibody mimics, humanized antibodies and fragments thereof, insulin, growth factors, interleukins, interferons, energy factors, erythropoietin, neutrophil growth factor, pDNA, siRNA, miRNA, mRNA, transforming growth factor, etanercept, aflibercept, afacept, liraglutide, pramlintide, exenatide, anterograde peptide, glucagon-like peptide-1, relaxin, octreotide, leptin, asparaginase, uricase, cyclosporin, antidiuretic hormone, oxytocin, pancreatic hormone, superoxide dismutase, vaccines, Her2 receptor, VEGF receptor, etc.

[0032] In the fifth aspect of the present invention, the polymer carrier described in the first aspect of the present invention, the nucleic acid molecule described in the second aspect of the present invention, the biomaterial described in the third aspect of the present invention, or the active molecule polymer carrier conjugate described in the fourth aspect of the present invention can be used to prepare diagnostic agents and / or therapeutic drugs, which are suitable for the treatment of chronic diseases such as cardiovascular diseases, neurodegenerative diseases, autoimmune diseases and metabolic diseases.

[0033] The sixth aspect of the present invention provides a pharmaceutical composition comprising the drug polymer carrier of the first aspect of the present invention or the nucleic acid molecule of the second aspect of the present invention or the biomaterial of the third aspect of the present invention or the active molecule polymer carrier conjugate of the fourth aspect of the present invention.

[0034] In some embodiments of the present invention, the pharmaceutical composition further comprises a pharmaceutically acceptable excipient for improving drug stability and bioavailability.

[0035] In summary, through this technical solution, the present invention provides a new drug delivery platform with multiple stimulus responsiveness and long-acting sustained-release characteristics, which has significant biocompatibility and application potential, can meet the treatment needs of various diseases, and improve drug delivery efficiency and patient compliance.

[0036] The beneficial effects of the present invention are:

[0037] The programmable multi-modified long-acting sustained-release ELP carrier provided by the present invention is a new long-acting drug delivery system. Through gene-encoded biosynthesis technology and reasonable amino acid modification technology, the present invention designs a multi-stimulus responsive protein polymer carrier. Reasonable amino acid permutations and combinations are selected to enable the ELP carrier to have a lower temperature response characteristic, and a phase change occurs in situ after subcutaneous injection to form a drug reservoir. The drug is slowly released from the reservoir, and the drug can be continuously delivered in vivo without relying on traditional sustained-release pumps or microsphere preparations, and the sustained-release time can reach 20 days, which significantly prolongs the half-life of the drug and improves the drug effect. In addition, the present invention combines the low-temperature response structure with the charge modification, which significantly improves the in situ sustained-release effect of the drug, further optimizes the pharmacokinetic parameters, prolongs the medication cycle, and improves the patient's compliance.

[0038] The ELP polymer carrier of the present invention is derived from natural elastin in vivo, and has extremely low immunogenicity, bioprogrammable properties, chemical site-specific coupling modification characteristics, good stability and biodegradability.

[0039] The initial raw materials of the drug polymer carrier ELP of the present invention are common, easily available, low-cost, simple in extraction and purification process, convenient in production and preparation process, easy to carry out genetic engineering modification, and have broad application prospects and huge market potential. BRIEF DESCRIPTION OF THE DRAWINGS

[0040] Figure 1 Construct a schematic for the ELP.

[0041] Figure 2 Figure A is the SDS-PAGE electrophoresis diagram of IVY8, IVY12, and IVY16, Figure B is the SDS-PAGE electrophoresis diagram of IVE8, IVE12, and IVE16, Figure C is the SDS-PAGE electrophoresis diagram of IVK8, IVK12, and IVK16, and Figure D is the SDS-PAGE electrophoresis diagram of IVF8, IVF12, and IVF16.

[0042] Figure 3 This is the SDS-PAGE electrophoresis diagram of IVE8IVY8, IVE6IVY10, IVE4IVY12, and IVE2IVY14.

[0043] Figure 4 Figure A shows the relationship between the composite characteristic ELP and turbidity change at a concentration of 10 μM, and Figure B shows the function graph of the concentration of the composite characteristic ELP and the phase transition temperature.

[0044] Figure 5 Optical images of the composite characteristic ELP at a concentration of 10 μM at 8°C and 37°C.

[0045] Figure 6a The figure shows the relationship between the chimeric characteristic ELP and the turbidity change at a concentration of 10 μM. Figure 6b A graph showing the concentration of the chimeric characteristic ELP as a function of the phase transition temperature.

[0046] Figure 7a 7b is the retention time of Cy7, Cy7-IVK16, Cy7-IVE16, and Cy7-IVY16 in vivo after subcutaneous injection using IVIS small animal in vivo imaging. 7b is a statistical graph of the retention time.

[0047] Figure 8a For IVIS small animal in vivo imaging, Cy7-IVE8IVY8, Cy7-IVE6IVY10, Cy7-IVE4IVY12, and Cy7-IVE2IVY14 were used for in vivo retention time after subcutaneous injection. Figure 8b This is a statistical chart of residence time. DETAILED DESCRIPTION

[0048] The following will be combined with the embodiments to clearly and completely describe the concept of the present invention and the technical effects produced, so as to fully understand the purpose, characteristics and effects of the present invention. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, other embodiments obtained by those skilled in the art without creative work are all within the scope of protection of the present invention.

[0049] Example 1: Construction of universal monomer precursor VPGIG (VPGVG) 2 and characteristic monomer precursor (VPGIG) 2VPGXG [X is Y, E, K, F]

[0050] 1) Design and synthesize an oligonucleotide gene fragment containing a repeating unit and restriction sites Acu I / BseR I, and subsequently construct a target gene with sticky ends.

[0051] IV2-F: CATCGGTGTTCCGGGTGTGGGTGTTCCGGGCGTTGGCGTTCCGGG (SEQ ID NO: 1);

[0052] IV2-R: CGGAACGCCAACGCCCGGAACACCCACACCCGGAACACCGATGCC (SEQ ID NO: 2); I2Y-F: CATCGGTGTTCCGGGTATTGGCGTGCCGGGTTATGGCGTTCCGGG (SEQ ID NO: 3);

[0053] I2Y-R: CGGAACGCCATAACCCGGCACGCCAATACCCGGAACACCGATGCC (SEQ ID NO: 4);

[0054] I2E-F: CATCGGTGTTCCGGGTATTGGCGTGCCGGGTGAAGGCGTTCCGGG (SEQ ID NO: 5);

[0055] I2E-R: CGGAACGCCTTCACCCGGCACGCCAATACCCGGAACACCGATGCC (SEQ ID NO: 6);

[0056] I2K-F: CATCGGTGTTCCGGGTATTGGCGTGCCGGGTAAAGGCGTTCCGGG (SEQ ID NO: 7);

[0057] I2K-R: CGGAACGCCTTTACCCGGCACGCCAATACCCGGAACACCGATGCC (SEQ ID NO: 8);

[0058] I2F-F: CATCGGTGTTCCGGGTATTGGCGTGCCGGGTTTCGGCGTTCCGGG (SEQ ID NO: 9);

[0059] I2F-R: CGGAACGCCGAAACCCGGCACGCCAATACCCGGAACACCGATGCC (SEQ ID NO: 10);

[0060] 2) Preparation of precursor target gene. The forward primer and reverse primer were modified by 5' end phosphorylation to construct the reaction system: 5μL of forward primer gene, 5μL of reverse primer gene, 2μL of T4 DNA ligation reaction buffer, 1μL of T4 PNK, and 7μL of ultrapure water. After incubation at 37℃ for 1h, 1μL of 1M NaCl was added to terminate the reaction, and then the annealing extension reaction was performed. The reaction procedure was as follows: 95℃5min, 55℃5min, 16℃5min, and the double-stranded DNA gene fragment of the monomer precursor was obtained.

[0061] 3) Preparation of linearized plasmid vector. The plasmid vector pET24b was treated with BseR I. The enzyme digestion system included 20 μL of vector plasmid, 3 μL of rCutsmart Buffer, 0.5 μL of BseR I, and 6.5 μL of ultrapure water. After incubation at 37°C for 3 h, 1 μL of CIP was added for 5′ end dephosphorylation reaction, and incubation was continued at 37°C for 20 min. The linearized vector was then recovered and purified by agarose gel electrophoresis.

[0062] 4) Ligation and transformation reaction. Ligation system: T4 DNA ligation reaction buffer 1μL, linearized vector 0.02pM, target gene 5μL, T4 DNA Ligase 0.5μL, ultrapure water to 10μL. After incubation at 25℃ for 2h, place on ice and let stand for 3min. Add the ligation product to DH5α cells, incubate on ice for 20min, then heat shock at 42℃ for 45s, and ice bath again for 3min. Add 500μL of LB liquid culture medium without antibiotics, shake and culture at 37℃ and 200rpm for 1h, then evenly spread it on an LB plate containing kanamycin and culture inverted at 37℃ overnight.

[0063] 5) Single clone and sequencing identification. Select the monoclonal colony suspension for PCR identification. The reaction system is: 2x FlashPCR MasterMix 5μL, universal primer F 0.5μL, universal primer R 0.5μL, bacterial suspension template 1μL, ultrapure water 3μL. Select the positive clone and send it for sequencing. The construction of the target gene is identified by sequence comparison.

[0064] Example 2: Construction of composite characteristic monomer (VPGIG)2VPGXG(VPGIG(VPGVG)2)2[X is Y, E, K, F]

[0065] 1) Preparation of (VPGIG(VPGVG)2)2. A single repeating unit was prepared by a recursive directional method of plasmid reconstruction, and the plasmid pET24b-VPGIG(VPGVG)2 (hereinafter abbreviated as pET24b-IG2) was digested with restriction endonucleases AcuⅠ / BglⅠ and BseRⅠ / BglⅠ to obtain the gene fragment IG2(AB cut / BB cut); IG2(AB cut / BB cut) was then ligated (ligation system: T4 DNA ligation reaction buffer 1μL, IG2(AB cut) 2.5μL, IG2(BB cut) 1.5μL, T4 DNA Ligase 0.5μL, ultrapure water 4.5μL), the target gene was constructed and transformed, and a single clone was selected and sent for sequencing to obtain the repeating unit (VPGIG(VPGVG)2)2.

[0066] 2) Preparation of (VPGIG)2VPGXG(VPGIG(VPGVG)2)2[X is Y, E, K, F]. The combined unit was prepared by a recursive directional method, and the plasmid pET24b-(VPGIG)2VPGXG[X is Y, E, K, F] (hereinafter abbreviated as pET24b-I2X) was digested with restriction endonucleases AcuⅠ / BglⅠ to obtain the gene fragment I2X (AB cut); the plasmid pET24b-(VPGIG(VPGVG)2)2 (hereinafter abbreviated as pET24b-(IG2)2) was digested with BseRⅠ / BglⅠ to obtain the gene fragment (IG2)2 (BB cut); I2X (AB cut) and (IG2)2 (BB cut) were connected to construct a combined target gene, transformed, single clones were selected, and sequencing was performed to obtain target genes with different characteristics. The repeating units pET24b-(VPGIG)2VPGYG(VPGIG(VPGVG)2)2, pET24b-(VPGIG)2VPGEG(VPGIG(VPGVG)2)2, pET24b-(VPGIG)2VPGKG(VPGIG(VPGVG)2)2, and pET24b-(VPGIG)2VPGFG(VPGIG(VPGVG)2)2 were obtained, and their amino acid sequences are as follows:

[0067]

[0068] Example 3: Constructing the composite feature ELP[(VPGIG)2VPGXG(VPGIG(VPGVG)2)2] n [X is Y, E, K, F]

[0069] Tyrosine (Y), glutamic acid (E), lysine (K), and phenylalanine (F) were selected as the X-amino acid of ELP, and composite characteristic ELPs with n being 1, 2, 4, 8, 12, and 16 were constructed.

[0070] The recursive directional method for plasmid reconstruction in Example 2 was used to prepare the repeating unit to prepare the corresponding composite characteristic ELP, which are as follows: pET24b-[(VPGIG)2VPGYG(VPGIG(VPGVG)2)2] n , n is 1, 2, 4, 8, 12, 16, (hereinafter abbreviated as pET24b-IVY1, pET24b-IVY2, pET24b-IVY4, pET24b-IVY8, pET24b-IVY12, pET24b-IVY16); pET24b-[(VPGIG)2VPGEG(VPGIG(VPGVG)2)2] n, n is 1, 2, 4, 8, 12, 16, (hereinafter abbreviated as pET24b-IVE1, pET24b-IVE2, pET24b-IVE4, pET24b-IVE8, pET24b-IVE12, pET24b-IVE16); pET24b-[(VPGIG)2VPGKG(VPGIG(VPGVG)2)2] n , n is 1, 2, 4, 8, 12, 16, (hereinafter abbreviated as pET24b-IVK1, pET24b-IVK2, pET24b-IVK4, pET24b-IVK8, pET24b-IVK12, pET24b-IVK16); pET24b-[(VPGIG)2VPGFG(VPGIG(VPGVG)2)2] n , n is 1, 2, 4, 8, 12, 16, (hereinafter abbreviated as pET24b-IVF1, pET24b-IVF2, pET24b-IVF4, pET24b-IVF8, pET24b-IVF12, pET24b-IVF16).

[0071] Example 4: Construction of chimeric signature ELP IVE8IVY8 / IVE6IVY10 / IVE4IVY12 / IVE2IVY16

[0072] According to the recursive directional method of plasmid reconstruction in Example 2, various types of chimeric ELPs were prepared, and chimeric ELPs with different combination characteristics were successfully constructed, as follows: pET24b-[(VPGIG)2VPGEG(VPGIG(VPGVG)2)2]8

[0073] [(VPGIG)2VPGYG(VPGIG(VPGVG)2)2]8, (hereinafter abbreviated as pET24b-IVE8IVY8);

[0074] pET24b-[(VPGIG)2VPGEG(VPGIG(VPGVG)2)2]6[(VPGIG)2VPGYG(VPGIG(VPGVG)2)2] 10 , (hereinafter abbreviated as pET24b-IVE6IVY10);

[0075] pET24b-[(VPGIG)2VPGEG(VPGIG(VPGVG)2)2]4[(VPGIG)2VPGYG(VPGIG(VPGVG)2)2] 12 , (hereinafter abbreviated as pET24b-IVE4IVY12); pET24b-[(VPGIG)2VPGEG(VPGIG(VPGVG)2)2]2

[0076] [(VPGIG)2VPGYG(VPGIG(VPGVG)2)2] 14 , (hereinafter abbreviated as pET24b-IVE2IVY14).

[0077] Example 5: Preparation of composite characteristic ELP protein carrier

[0078] Select IVY8, IVY12, IVY16, IVE8, IVE12, IVE16, IVK8, IVK12, IVK16, IVF8, IVF12, and IVF16 for induced expression and purification.

[0079] 1) Transform the recombinant plasmid into BL21 (DE3) Escherichia coli for expression. First, pick the positive clone expression bacteria and inoculate them in LB medium (containing kanamycin) for overnight culture. The next day, amplify the culture in LB liquid medium containing kanamycin for 2-3 hours. When the bacterial liquid density OD600 value is 0.6-0.8, place it in a 4℃ refrigerator for 30 minutes, add IPTG with a final concentration of 0.4mM, induce expression at 16℃ for 24 hours, and collect the bacteria by centrifugation.

[0080] 2) Reagent preparation and sample preparation. LE equilibration buffer (50mM Na2HPO4, 300mM NaCl, pH 8.0), washing buffer (50mM Na2HPO4, 300mM NaCl, 10mM imidazole, pH 8.0), elution buffer (50mM Na2HPO4, 300mM NaCl, 300mM imidazole, pH 8.0). Ultrasonic disruption of cell suspension on ice, 2s of disruption, 3s of cooling, 5min of ultrasonic disruption each time, repeating the operation 5 times in total. Collect the supernatant by centrifugation (9000rpm, 4℃, 20min), and filter the supernatant with a 0.22μm filter membrane to obtain the filtrate.

[0081] 3) Column purification. The entire purification operation was carried out in a cold room. LE was added to equilibrate the Ni-NTA resin medium with 10 times the volume of the Ni-NTA resin column. The protein solution was loaded. The protein sample was added to the purification column and allowed to flow out slowly. Washing buffer with 15 times the volume of the Ni-NTA resin column was added to remove impurities. Elution buffer was added to elute the target protein. The protein purity was detected using SDS-PAGE gel. The results were as follows: Figure 2 As shown in Figures A, B, C and D, the purity of the purified target protein is over 90%.

[0082] 4) Protein quantification and storage. The purified ELP was transferred to a dialysis bag (molecular weight cutoff of 14000Da) and dialyzed in PBS buffer. The buffer was changed every 6 hours for 2 times. After dialysis, the solution was centrifuged (9000rpm, 4°C, 15min) and the supernatant was sterilized by filtration using a 0.22μm filter. The protein concentration was detected by the BCA method, and the protein solution was aliquoted and stored at -80°C.

[0083] Example 6: Preparation of chimeric characteristic ELP protein vector

[0084] IVE8IVY8, IVE6IVY10, IVE4IVY12, and IVE2IVY14 were selected for induced expression and purification.

[0085] The chimeric characteristic ELP protein was prepared by the protein expression and purification technology in Example 5, and the protein purity was detected by SDS-PAGE gel. The results were as follows: Figure 3 As shown, the purity of the purified target protein is over 95%. Its amino acid sequence is as follows:

[0086]

[0087]

[0088] Example 7: Physicochemical Characterization Parameters of Composite and Chimeric ELP Protein Carriers

[0089] The phase transition temperature (Tt) of composite feature and chimeric feature ELP was determined by turbidity method. Different ELP samples (including IVY8, IVY12, IVY16, IVE8, IVE12, IVE16, IVK8, IVK12, IVK16, IVF8, IVF12, IVF16) were diluted with PBS to different concentrations (20μM, 10μM, 5μM, 2.5μM, 1.25μM, 0.625μM). A multifunctional microplate reader was used to detect the ultraviolet absorption value (OD350) of the ELP samples at different concentrations from 0℃ to 55℃. Tt is the temperature at which the turbidity of the ELP sample reaches half of the maximum stable value. The test results are as follows. Figure 4 As shown in Figure A, it shows the OD350 change value at different temperatures when the concentration is 10 μM. Figure 4 Figure B is a graph showing the functional relationship between concentration and phase transition temperature, i.e., the phase transition temperature Tt at different reaction temperatures. In addition, the composite characteristic ELP was diluted to 10 μM and incubated at 8°C and 37°C for optical imaging. Figure 5 As shown, Figure 4The data in Figure A correspond to those in Figure 1. IVY16, IVE16, and IVK16 exhibit reversible phase transition behavior below 37°C, indicating that they have the potential to form drug reservoirs through in situ phase transition in vivo.

[0090] Similarly, the same method is used to test the phase transition temperature Tt of IVE8IVY8, IVE6IVY10, IVE4IVY12 and IVE2IVY14. The test results are as follows Figure 6a and 6b shown.

[0091] Example 8: Retention time of composite characteristic ELP protein carrier in vivo

[0092] Composite characteristic ELP coupled with fluorescent group Cy7. The control Cy7 fluorescent group and Cy7-IVY16, Cy7-IVE16, and Cy7-IVK16 were subcutaneously injected into the back of the mouse neck, and the Cy7-labeled composite characteristic ELP underwent in situ phase transition assembly under the mouse skin to form a drug reservoir. The retention time of Cy7-ELP in the mouse body was observed by small animal in vivo imaging (IVIS). The mice used in the experiment were C57BL / 6 male mice.

[0093] The specific steps are as follows:

[0094] 1. Preparation of Cy7-labeled samples

[0095] Take out IVY16, IVE16, and IVK16 stored in a -80°C refrigerator and transfer them to a reaction tube. Add the fluorescent group mother solution to the reaction tube according to the molar ratio of fluorescent group / labeled ELP of 3:1, mix gently, and slowly stir the reaction tube at 4°C for 12h-24h. Transfer the mixed solution to a dialysis bag and dialyze in PBS. Replace PBS every 4 hours, and replace it 2-3 times in a row to obtain fluorescently labeled Cy7-IVY16, Cy7-IVE16, and Cy7-IVK16.

[0096] 2. Subcutaneous injection in the back of the mouse neck

[0097] The labeled sample was subcutaneously injected into the back of the mouse neck at a dose of 0.22 μM / Kg. Negative control group: Cy7 was subcutaneously injected.

[0098] 3. In vivo residence time analysis

[0099] At 2h, 1 day, 3 days, 7 days, 11 days, 15 days, and 17 days after subcutaneous injection, the mice were photographed with a small animal in vivo imaging device, and the fluorescence channels of excitation light 740nm and emission light 790nm were selected for imaging. Figure 7a and Figure 7bAs shown in the figure, the fluorescence of the control group Cy7 disappeared on the 3rd day, the fluorescence of the Cy7-IVK16 group disappeared on the 11th day, and the fluorescence retention time of the Cy7-IVY16 and Cy7-IVE16 groups was the longest, disappearing on the 17th day. This shows that the IVY structure with a lower surface Tt value and the IVE structure carrier with a higher Tt value and negative charge modification have a longer retention time and a good sustained release effect.

[0100] Example 9: Retention time of chimeric characteristic ELP protein carrier in vivo

[0101] In order to explore whether the chimeric characteristic ELP can further prolong the in vivo retention time, the chimeric characteristic ELP was prepared and coupled with the Cy7 fluorescent group. Cy7-IVE2IVY14, Cy7-IVE4IVY12, Cy7-IVE6IVY10, and Cy7-IVE8IVY8 were subcutaneously injected into the back of the mouse neck. The Cy7-labeled chimeric characteristic ELP underwent in situ phase transition assembly under the mouse skin to form a drug reservoir, and the retention time was detected by IVIS imager. The mice used in the experiment were C57BL / 6 male mice.

[0102] The specific steps are as follows:

[0103] 1. Preparation of Cy7-labeled samples

[0104] Take out the IVE2IVY14, IVE4IVY12, IVE6IVY10, and IVE8IVY8 samples stored in a -80°C refrigerator, transfer them to a reaction tube, add the fluorescent group mother solution to the reaction tube according to the molar ratio of fluorescent group / labeled ELP of 3:1, mix gently, and slowly stir the reaction tube at 4°C for 12h-24h; transfer the mixed solution to a dialysis bag, dialyze in PBS, replace PBS every 4 hours, repeat the replacement 2-3 times, and obtain fluorescently labeled Cy7-IVE2IVY14, Cy7-IVE4IVY12, Cy7-IVE6IVY10, and Cy7-IVE8IVY8.

[0105] 2. Subcutaneous injection in the back of the mouse neck

[0106] The mice were injected subcutaneously at a dose of 0.22 μM / Kg.

[0107] 3. In vivo residence time analysis

[0108] At 2h, 1 day, 3 days, 7 days, 11 days, 15 days, 19 days, 24 days, 30 days, 36 days, and 43 days after subcutaneous injection, the mice were photographed using an IVIS imager with the excitation light 740nm / emission light 790nm fluorescence channel. Figure 8a and Figure 8bAs shown, the fluorescence of the Cy7-IVE4IVY12 group was retained in vivo until the 24th day, the fluorescence of the Cy7-IVE6IVY10 and Cy7-IVE8IVY8 groups was retained in vivo until the 30th day, and the fluorescence of the Cy7-IVE2IVY14 group was retained in vivo for the longest time, which was retained until about the 36th day. The results show that compared with the composite characteristic ELP, the in vivo retention time of the chimeric characteristic ELP was significantly prolonged, indicating that the in vivo retention time of ELP is closely related to the phase transition temperature / concentration function relationship and negative charge. According to the phase transition temperature / concentration function relationship in Figure 6.B, the slope of IVE2IVY14 is much lower than that of the latter three, indicating that the slope may be the main factor determining the in vivo retention of the chimeric characteristic ELP, while the charge affects the retention effect when the slope is similar.

[0109] In summary, the present invention innovatively proposes a novel programmable multi-modified long-acting sustained-release elastin ELP carrier synthesis and its application. By injecting a single chimeric characteristic ELP into mice subcutaneously, an ultra-long action time of more than one month was shown. This carrier can not only encapsulate small molecule drugs with poor water solubility, but also can fuse therapeutic proteins (such as antibodies, cytokines, etc.) with ELP at the molecular level through genetic engineering technology, significantly improve the stability of the drug, prolong the retention time of the drug in the body, increase the half-life, and avoid the side effects caused by excessive drug concentration. Different modifications can be made to its amino acids and the functional groups on the amino acids by genetic engineering technology or chemical synthesis methods, so as to obtain drug carriers with different environmental stimulus responsiveness, and then improve the bioavailability of the drug. In short, the programmable multi-modified long-acting sustained-release elastin ELP carrier of the present invention is suitable for delivering proteins, enzymes, antibodies, small molecule drugs and polymers, etc., greatly improving pharmacokinetic characteristics, improving the stability, biological activity and therapeutic effect of the drug, and reducing the toxicity caused by multiple drug administrations, and improving the biosafety of the drug. The present invention provides new ideas for the design of future drug delivery and novel synthetic biomaterials, and is suitable for the delivery and treatment of a variety of drugs.

[0110] The above specific implementations have been described in detail for the present invention, but the present invention is not limited to the above embodiments. Various changes can be made within the knowledge of ordinary technicians in the relevant technical field without departing from the purpose of the present invention. In addition, the embodiments of the present invention and the features in the embodiments can be combined with each other without conflict.

Claims

1. A programmable multi-modified long-acting sustained-release elastin-like ELP carrier, characterized in that: The carrier is an elastin-like protein comprising a composite characteristic hydroxybenzene ring structure, a composite characteristic benzene ring structure, a composite characteristic positive charge modification, a composite characteristic negative charge modification or a combination of two or more of the above structural characteristics.

2. A programmable multi-modified long-acting sustained-release elastin-like protein ELP carrier according to claim 1, characterized in that: The elastin-like sequence includes (VPGXG)n, wherein X is any amino acid except proline P; X is at least one of lysine, glutamic acid, tyrosine, phenylalanine, alanine, and isoleucine; the value range of n is 60 to 180; and the phase transition temperature of the carrier is 15-30°C.

3. A nucleic acid molecule, characterized in that The nucleic acid molecule encodes elastin; the preferred sequence of the elastin-like structure includes: [(VPGIG)4(VPGVG)4(VPGEG)1]2[(VPGIG)4(VPGVG)4(VPGYG)1] 14 .

4. A long-acting sustained-release biopolymer delivery carrier, comprising the multi-modified long-acting sustained-release elastin-like ELP carrier according to claim 1 or 2 and an active molecule; the active molecule comprises a diagnostic agent and / or a therapeutic agent and / or a molecular switch.

5. The long-acting sustained-release biopolymer delivery carrier according to claim 4, characterized in that: The diagnostic agent includes a fluorescent label or a radioactive label; the therapeutic agent includes a polypeptide, an antibody, a protein, a nucleic acid, a chemical drug or a traditional Chinese medicine; the molecular switch includes a pH response of non-covalent cross-linking of imines and phenylboronic acid esters, an enzymatic response of matrix metalloproteinases, esterases, and histones, and a light-responsive functional group incorporated with a photosensitive functional group.

6. The long-acting sustained-release biopolymer delivery carrier according to claim 4, characterized in that: The therapeutic agent comprises at least one of monoclonal antibodies, domain antibodies, nanobodies, multispecific antibodies, chimeric antibodies, antibody mimetics, humanized antibodies and fragments thereof, insulin, growth factors, interleukins, interferons, energy factors, erythropoietin, neutrophil growth factor, pDNA, siRNA, miRNA, mRNA, transforming growth factor, etanercept, aflibercept, liraglutide, exenatide, anterograde peptide, glucagon-like peptide-1, relaxin, octreotide, leptin, asparaginase, uricase, cyclosporin, antidiuretic hormone, oxytocin, pancreatic hormone, superoxide dismutase, vaccine, and VEGF receptor.

7. The long-acting sustained-release biopolymer delivery carrier according to claim 5, characterized in that: The fluorescent marker includes at least one of Cy7, Cy5, Cy3, GFP, YFP, BFP and CFP.

8. A biomaterial, characterized in that The biological material is any one of the following (a1) to (d1): (a1) The biomaterial comprises the expression cassette of the ELP polymer or nucleic acid molecule according to claims 1 to 3; (b1) the expression cassette of (a1) comprises a recombinant plasmid vector, or a recombinant cell, or an expression cell, or an expression cell containing a recombinant plasmid; (c1) The recombinant plasmid vector of (b1) comprises transcriptional regulatory elements such as a promoter, a reading frame, a terminator, and an enhancer; (d1) The recombinant cells or expression cells of (b1) include prokaryotic cells and eukaryotic cells; the prokaryotic cells include Escherichia coli DH5α or BL21; the eukaryotic cells include yeast and HEK-293T.

9. Use of the programmable multi-modified long-acting sustained-release elastin-like ELP carrier according to claim 1 or 2, or the nucleic acid molecule according to claim 3, or the long-acting sustained-release biopolymer delivery carrier according to any one of claims 4 to 7, or the biomaterial according to claim 7 in the preparation of diagnostic agents and / or drugs.

10. A method for preparing a biopolymer delivery carrier for long-acting sustained release in vivo, characterized in that: The carrier according to any one of claims 1 to 2 is combined with the active molecule according to any one of claims 4 to 6 by genetic engineering technology to prepare a biopolymer drug with a controlled long-term release and environmental stimulus response.

Images