Application of rice zos2-02 gene in regulating salt tolerance
By knocking out the ZOS2-02 gene in rice using CRISPR-Cas9 technology, the problems of long breeding cycles and limited utilization value of existing genes in traditional breeding methods have been solved, resulting in a significant improvement in rice salt tolerance and enhancing rice's ability to adapt to salt stress.
Patent Information
- Application Number
- CN202411795216.1
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-12-09
- Publication Date
- 2026-05-01
- Estimated Expiration
- 2044-12-09
AI Technical Summary
Existing technologies are insufficient for effectively breeding new rice varieties with strong salt tolerance. Traditional breeding methods are time-consuming and difficult, and the utilization value of cloned rice salt tolerance genes is limited.
By using CRISPR-Cas9 technology to knock out or reduce the expression of the rice ZOS2-02 gene, and by designing specific CRISPR-Cas9 vectors and primers to edit the rice gene, a ZOS2-02 gene mutant was constructed to improve the salt tolerance of rice.
It significantly improved the salt tolerance of rice, reduced the damage symptoms under salt stress, and enhanced the growth status of rice and the survival rate of seedlings.
Smart Images

Figure CN119410660B_ABST
Abstract
Description
Application of the rice ZOS2-02 gene in regulating salt tolerance Technical Field
[0001] This invention belongs to the field of genetic engineering, specifically relating to a rice salt tolerance-related gene ZOS2-02, its encoded protein, and its applications. Background Technology
[0002] Rice is one of the world's three major food crops, and more than half of the world's population relies on it as a staple food. Salt damage is one of the most significant abiotic stresses affecting rice production. Rice is a moderately salt-sensitive crop; when the concentration of soluble salts in the soil reaches 0.3%, it exhibits symptoms of damage, ultimately leading to a decrease in yield. Given the increasingly strained arable land resources, cultivating and promoting superior salt-tolerant rice varieties, and making full use of the large areas of inland saline-alkali land and coastal saline-alkali tidal flats for rice production, is of great significance for ensuring food security.
[0003] Salt stress causes damage to rice, including osmotic stress, ion toxicity, and oxidative stress. Rice responds to salt stress through various mechanisms, including osmotic regulation, ion balance regulation, and antioxidant system regulation. Under high-salt conditions, the water potential around the rice roots is lower than the water potential inside the root cells, making water absorption difficult and causing osmotic stress. The rice plant synthesizes large amounts of osmotic regulators such as proline, betaine, and soluble sugars to lower the cell water potential and promote root water absorption. When there is excessive sodium in the environment... + It enters the rice plant and disrupts the root system's response to potassium. + Ca 2+ The absorption of certain ions, such as potassium ions, disrupts cellular ion homeostasis and causes ion toxicity. Rice utilizes high-affinity potassium... + Transport proteins, non-selective cation channels, Na + / K + Antitransporter proteins and other types of proteins regulate the Na+ content in plants. + The absorption, transport, compartmentalization, and efflux of Na+ in cells control Na+. + Concentration, reducing ion toxicity. When excessive Na+ accumulates in rice plants... + This can also lead to an excessive accumulation of reactive oxygen species, causing oxidative stress. Rice plants scavenge excess reactive oxygen molecules and maintain normal cell growth by regulating the biosynthesis and activity of antioxidant enzymes such as peroxidase, superoxide dismutase, and catalase.
[0004] Rice salt tolerance is regulated by a complex molecular network. Developing salt-tolerant varieties using traditional breeding methods is time-consuming and difficult. Molecular design breeding techniques can accelerate the development of new salt-tolerant varieties, which relies on the discovery of salt-tolerant genes with significant application value. Currently, a large number of rice salt-tolerant genes have been cloned, but only a few have significant practical value. Therefore, it is necessary to further investigate key new salt-tolerant genes in rice to lay the foundation for breeding superior salt-tolerant rice varieties. Summary of the Invention
[0005] To overcome the aforementioned technical problems in the prior art, this invention provides the genetic engineering application of the rice ZOS2-02 gene in regulating rice salt tolerance.
[0006] The technical solution of this patent is as follows:
[0007] The genetic engineering application of the salt tolerance-related gene ZOS2-02, or the protein encoded by the gene ZOS2-02, or the knockout vector of the gene ZOS2-02, or the primers for amplifying the gene ZOS2-02 in regulating rice salt tolerance.
[0008] The gene ZOS2-02 is the DNA molecule described in either 1) or 2) below:
[0009] 1) A DNA molecule with a genome sequence as shown in SEQ ID NO.1;
[0010] 2) DNA molecules with CDS sequences as shown in SEQ ID NO.2.
[0011] Furthermore, knocking out the aforementioned gene ZOS2-02, reducing the expression level of the protein encoded by the gene ZOS2-02, or introducing a knockout vector of the gene ZOS2-02 into rice can improve the salt tolerance of rice.
[0012] Furthermore, the amino acid sequence of the protein encoded by the gene ZOS2-02 is shown in SEQ ID NO.3.
[0013] Furthermore, the gene ZOS2-02 knockout vector is obtained by using CRISPR-Cas9 technology to edit the gene in rice, knocking out the aforementioned gene ZOS2-02 in the rice plant, thus rendering the gene non-functional.
[0014] Furthermore, the knockout vector for the gene ZOS2-02 is a CRISPR-Cas9 vector that targets one or more of the target sites shown in SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8.
[0015] Furthermore, the primers for the amplified gene ZOS2-02 are selected from Primer1 shown in SEQ ID NO.4 and Primer2 shown in SEQ ID NO.5, or Primer5 shown in SEQ ID NO.11 and Primer6 shown in SEQ ID NO.12.
[0016] Beneficial effects:
[0017] This invention marks the first discovery of a novel plant salt tolerance-related protein gene, ZOS2-02. This salt tolerance-related protein influences plant salt tolerance. Inhibiting the expression of the gene encoding this protein leads to increased plant salt tolerance, thereby enabling the breeding of salt-tolerant transgenic plants. The protein and its encoding gene can be applied to plant genetic improvement. Attached Figure Description
[0018] Figure 1 shows the mutation sites of the ZOS2-02 gene in wild-type Nipponbare and ZOS2-02 gene mutants (ZOS2-02-1, ZOS2-02-2 and ZOS2-02-3).
[0019] Figure 2 shows the phenotypes of wild-type Nipponbare and mutants ZOS2-02-1, ZOS2-02-2 and ZOS2-02-3 under salt stress.
[0020] Figure 3 shows the survival rate of wild-type Nipponbare seedlings and mutants ZOS2-02-1, ZOS2-02-2 and ZOS2-02-3 under salt stress. Detailed Implementation
[0021] The following examples are provided to better understand the present invention, but are not intended to limit the invention. Unless otherwise specified, the experimental methods used in the following examples are conventional methods. Unless otherwise specified, the reagents and kits used in the following examples were purchased from conventional biological reagent companies.
[0022] Example 1: Cloning of the coding region sequence (CDS) of the rice ZOS2-02 gene
[0023] Using cDNA from seedling leaves of the rice variety Nipponbare as a template, the CDS fragment of the ZOS2-02 gene was amplified by PCR using a primer pair consisting of Primer1 and Primer2.
[0024] Primer1:5'-ATGTGCTCTGGAGATGATATT-3' (SEQ ID NO.4);
[0025] Primer2: 5'-CTAATGAGTTTGGCTCGAATC-3' (SEQ ID NO. 5).
[0026] The PCR reaction system (50 μl) consisted of: 2 μl template cDNA (50 ng / μl), 1.5 μl Primer 1 (10 μM), 1.5 μl Primer 2 (10 μM), 1 μl dNTP Mix (10 mM), 25 μl 2×Phanta Max Buffer, 1 μl Phanta Max Super-Fidelity DNA Polymerase, and 18 μl ddH2O.
[0027] PCR amplification was performed in a Bio-Rad T100 PCR instrument. The reaction program was as follows: 95℃ pre-denaturation for 3 min; 95℃ denaturation for 15 s, 60℃ annealing for 15 s, 72℃ extension for 90 s, for 35 cycles; 72℃ extension for 5 min; and storage at 4℃.
[0028] The PCR products were recovered and purified using a DNA purification kit (Nanjing Novizan Biotechnology Co., Ltd.), ligated into the pEASY-Blunt expression vector (Beijing TransGen Biotech Co., Ltd.), transformed into E. coli DH5α competent cells (Beijing Tiangen Biotech Co., Ltd.), and positive clones were selected and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing.
[0029] Sequencing results showed that the CDS fragment of the ZOS2-02 gene obtained by PCR amplification had the nucleotide sequence shown in SEQ ID NO.2, encoding a protein consisting of 379 amino acid residues (SEQ ID NO.3).
[0030] Example 2: Construction of transgenic rice plants with ZOS2-02 gene mutant
[0031] The genome sequence (SEQ ID NO.1) and CDS sequence (SEQ ID NO.2) of ZOS2-02 were provided to Wuhan Boyuan Biotechnology Co., Ltd., which designed the target. Specifically, the genome sequence (SEQ ID NO.1) of ZOS2-02 was input into the CRISPR-P V2.0 website (http: / / crispr.hzau.edu.cn / CRISPR2 / ), where the CRISPR-Cas9sgRNA target was designed. One or more of target 1, target 2, and target 3 were selected for gene editing vector construction.
[0032] The sequence of target 1 is: ACCACAACCATCCATAGAGCAGG (SEQ ID NO.6).
[0033] The sequence of target 2 is: CAAGGAGGAGGGCTGTAACAAGG (SEQ ID NO.7)
[0034] The sequence of target 3 is: CCGGCAGTTTGTTTGCAAGGAGG (SEQ ID NO. 8).
[0035] The three sgRNA units were synthesized into the intermediate vector PUC57 via whole-genome synthesis. Then, Primer3 and Primer4 primers were synthesized, and PCR amplification was performed using the PUC57 plasmid containing the three sgRNAs as a template to obtain double-stranded DNA molecules with sticky ends.
[0036] Primer3:5'-CAGTGGTCTCATGCAACCACAACCATCCATAGAGCGTTTTAGAG-3' (SEQ IDNO.9);
[0037] Primer4:5'-CAGTGGTCTCAAAACCCTTGCAAACAAACTGCCGGTGC-3'(SEQ ID NO.10)
[0038] Double-stranded DNA molecules were ligated into a BsaI-cleaved pHK1-Cas9-U3 linearized vector (containing this vector in the "Monocot Gene Editing Vector Kit (Hyg)" product of Wuhan Boyuan Biotechnology Co., Ltd.) using T4 DNA ligase. The ligation product was transformed into *E. coli* DH5α, and positive clones were identified by colony PCR. Plasmids were extracted and sequenced. Sequencing results showed that recombinant vectors containing the sequences shown in SEQ ID NO. 6, SEQ ID NO. 7, and SEQ ID NO. 8 were obtained. Then, *Agrobacterium*-mediated genetic transformation was used to transform *Nipponbare* callus tissue to obtain T0 generation transgenic plants.
[0039] Example 3: Molecular identification of transgenic plants of the ZOS2-02 gene mutant in rice
[0040] The aboveground parts of the seedlings of the T0 generation transgenic plants of the ZOS2-02 gene obtained in Example 2 were sampled, and genomic DNA was extracted as a template. The DNA fragments on both sides of the editing target sites shown in SEQ ID NO.6, SEQ ID NO.7 and SEQ ID NO.8 were amplified by PCR using primer pair composed of Primer5 and Primer6.
[0041] Primer5:5'-GTGAGAGGATCCAACATCAA-3' (SEQ ID NO.11);
[0042] Primer6: 5'-AACACCTTTTTCACACCCGT-3' (SEQ ID NO. 12).
[0043] PCR products were detected by 1% agarose gel electrophoresis and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. Based on the sequencing results, three monoclonal strains with specific mutations in the ZOS2-02 gene were identified: ZOS2-02-1, ZOS2-02-2, and ZOS2-02-3. The DNA sequences of the editing target site and its flanking sites in these three monoclonal strains are shown in Figure 1.
[0044] In the ZOS2-02-1 monoculture, there are 3 deletions of a total of 9 nucleotides in the 3rd exon of the ZOS2-02 gene;
[0045] In the ZOS2-02-2 monoculture, there are two deletions of a total of 9 nucleotides and one insertion of nucleotides in the third exon of the ZOS2-02 gene;
[0046] In the ZOS2-02-3 monoculture, there are two deletions totaling 7 nucleotides, two insertions totaling 3 nucleotides, and one mutation in the third exon of the ZOS2-02 gene.
[0047] In these three mutant monocultures, the mutation of the CDS sequence of the ZOS2-02 gene led to a frameshift mutation in its encoded protein.
[0048] Example 4: Salt tolerance identification of ZOS2-02 gene mutant lines
[0049] Two generations of self-crossing were performed on the three ZOS2-02 gene mutant T0 generation transgenic plants identified in Example 3 to obtain homozygous mutant lines ZOS2-02-1, ZOS2-02-2, and ZOS2-02-3. These three homozygous mutant lines were then subjected to the following seedling salt tolerance assessment experiment together with Nipponbare wild-type (WT) plants:
[0050] (1) Select plump rice seeds and soak them in tap water in a 33℃ incubator for about 3 days until the seeds show signs of germination. Select seeds with uniform germination and sow them onto a 96-well PCR plate with the bottom removed. Place the plate in a black acrylic glass culture box and culture it in an artificial climate chamber. The culture conditions are: 14h light (28℃) / 10h dark (24℃), light intensity 1000 μmol·m -2 ·s -1 The relative humidity is 70%.
[0051] (2) After rice seedlings were cultured in pure water for one week, they were cultured in Kimura B nutrient solution. When the seedlings grew to the two-leaf-one-heart stage, the nutrient solution was replaced with Kimura B nutrient solution containing 120mM NaCl for salt stress treatment.
[0052] (3) After treatment with 120mM NaCl for 15 days, the seedlings were rehydrated using Kimura B nutrient solution without NaCl. The survival rate of the seedlings was calculated after 5 days. Survival rate = number of surviving seedlings / total number of seedlings treated × 100%.
[0053] The salt tolerance identification results of the ZOS2-02 gene mutant lines are shown in Figures 2 and 3. The results showed that compared with the wild type (WT) Nipponbare, the three ZOS2-02 gene mutant lines had milder salt damage symptoms such as leaf wilting and drying, and their growth status, such as plant height, was also better than that of the wild type (Figure 2). In addition, the seedling survival rate of the three ZOS2-02 gene mutant lines after rehydration was significantly higher.
[0054] The above experimental results indicate that the ZOS2-02 gene has the function of negatively regulating the salt tolerance of rice seedlings, and knocking out this gene can significantly improve the salt tolerance of rice.
[0055] The above description is only a preferred embodiment of the present invention. It should be noted that for those skilled in the art, several improvements and modifications can be made without departing from the principle of the present invention, and these improvements and modifications should also be considered within the scope of protection of the present invention.
Claims
1. The genetic engineering application of the salt tolerance-related gene ZOS2-02, or the protein encoded by the gene ZOS2-02, in regulating salt tolerance in rice; wherein the gene ZOS2-02 is a DNA molecule as described in 1) or 2) below: 1) a DNA molecule with a genomic sequence as shown in SEQ ID NO. 1; 2) a DNA molecule with a CDS sequence as shown in SEQ ID NO. 2; knocking out the gene ZOS2-02, or reducing the expression level of the protein encoded by the gene ZOS2-02, to improve the salt tolerance of rice.
2. The application according to claim 1, characterized in that, The ZOS2-02 knockout vector was introduced into rice to improve the rice's salt tolerance.
3. The application according to claim 2, characterized in that, The knockout vector for the gene ZOS2-02 is a CRISPR-Cas9 vector that targets one or more of the following targets: target 1 shown in SEQ ID NO.6, target 2 shown in SEQ ID NO.7, and target 3 shown in SEQ ID NO.8.
Citation Information
Patent Citations
Rice salt tolerance related gene OsBLH4 as well as encoding protein and application thereof
CN118745431A