SNP (Single Nucleotide Polymorphism) molecular marker combination and primer group for identifying authenticity of hybrid of mango 'Evin' and 'Jianghuang' and application of SNP molecular marker combination and primer group

Abstract

The invention discloses an SNP (Single Nucleotide Polymorphism) molecular marker combination and a primer group for identifying the authenticity of a mango 'Evin' and 'Jianghuang' hybrid and application of the SNP molecular marker combination and the primer group, and belongs to the technical field of mango crossbreeding. Comprising Mgchr < 111781329 > and Mgchr < 2081237 >; the Mgchr111781329 is located at the 1781329th site of a chromosome of chromosome11, the genotype of 'Evin' is TT, the genotype of 'Jinhuang' is AA, and the genotype of the hybrid is T / A; the Mgchr2081237 is located at the 81237th site of chromosome of chromosome20, the genotype of 'Evin' is AA, the genotype of 'Jinhuang' is TT, and the genotype of the hybridized F1 is A / T. A primer group designed on the basis of the SNP marker can quickly and effectively identify the authenticity of the hybrid of the mango 'Evin' and 'Jianghuang', the identification result is accurate and reliable, and genetic breeding of the mango is facilitated.

Description

Technical Field

[0001] The invention relates to the technical field of mango hybrid breeding, and in particular to a SNP molecular marker combination, a primer set and an application thereof for identifying the authenticity of a hybrid of mangoes 'Aiwen' and 'Jinhuang'. Background Art

[0002] Mango is an important tropical fruit. It is known as the "King of Tropical Fruits" for its beautiful appearance, sweet fruit and rich aroma. Mangoes are mainly grown between 30° north and south latitude, including more than 100 countries and regions. At present, there are more than 1,000 mango varieties in the world, of which more than 100 are in my country, but many varieties are introduced from abroad. After decades of cultivation, these varieties are facing the problems of variety degradation such as reduced yield, reduced resistance and poor consistency, and the problem of lack of excellent varieties has gradually become prominent. The selection and promotion of new varieties is an effective means to adjust the variety structure and improve the quality and efficiency of the industry. At present, hybrid breeding is the main method for the selection and breeding of new mango varieties. However, its breeding cycle is long, and due to open pollination, false hybrids are easy to produce. The identification of the authenticity of hybrids based on the field phenotypic traits of hybrid offspring is time-consuming and laborious, and is easily affected by environmental and human factors. With the concentrated use of parents, the morphological differences of hybrid offspring are getting smaller and smaller, and the difficulty of using morphological characteristics to identify true and false hybrids has also increased. Due to the long cycle required for the identification of true and false hybrids, the identification work has become increasingly difficult in actual operations.

[0003] DNA molecular markers are used to identify the identity of varieties, which has the advantages of accuracy, reliability, simplicity, speed, ease of operation, and good timeliness. It is widely used in the authenticity identification of varieties of various fruit trees such as citrus, apples, grapes, cherries, peaches, kiwis, etc. In the BMT molecular testing guidelines, the International Union for the Protection of New Varieties of Plants (UPOV) has recommended SSR marker technology and single nucleotide polymorphism technology (SNP) as two technologies for variety identification or seed purity identification. However, SSR technology has defects such as fewer detection sites, low throughput, poor representativeness of results, and difficulty in data sharing. SNP markers are distributed in the genome at a high and uniform density, which can achieve high-throughput detection and are more suitable for database integration and sharing. Therefore, it is considered to be the molecular marker technology with the most application prospects.

[0004] At present, the identification of mango hybrid offspring is mainly based on multi-year and multi-point observation of morphological characteristics of varieties. There is no molecular marker for F hybrids with 'Aiwen' and 'Jinhuang' as parents. 1 Report on the authenticity identification of hybrids in the next generation of hybrid populations. Summary of the invention

[0005] The purpose of the present invention is to provide a SNP molecular marker combination, primer set and application thereof for identifying the authenticity of the hybrid of mango 'Aiwen' and 'Jinhuang', so as to solve the problems existing in the above-mentioned prior art. The present invention provides a SNP marker that can be used for authenticity identification of hybrid offspring of 'Aiwen' and 'Jinhuang', and the F 1 The authenticity of hybrids was identified in the population, laying the foundation for improving the efficiency of mango hybrid breeding and further genetic research.

[0006] To achieve the above object, the present invention provides the following solutions:

[0007] One of the technical solutions of the present invention is a SNP molecular marker combination for identifying the authenticity of the hybrid of mango 'Aiwen' and 'Jinhuang', including Mgchr11_1781329 and Mgchr20_81237;

[0008] The Mgchr11_1781329 is located at position 1781329 of chromosome 11, the genotype of 'Aiwen' is TT, the genotype of 'Jinhuang' is AA, and the genotype of the hybrid is T / A;

[0009] Mgchr20_81237 is located at position 81237 of chromosome 20. The genotype of 'Aiwen' is AA, the genotype of 'Jinhuang' is TT, and the hybrid F 1 The genotype is A / T.

[0010] The second technical solution of the present invention is that the primers for specifically amplifying the SNP molecular marker combination include primers for specifically amplifying Mgchr11_1781329 and primers for specifically amplifying Mgchr20_81237.

[0011] The third technical solution of the present invention is the application of the SNP molecular marker combination and the primers in identifying the authenticity of the hybrid of mango 'Aiwen' and 'Jinhuang'.

[0012] The fourth technical solution of the present invention is a method for identifying the authenticity of the hybrid of mango 'Aiwen' and 'Jinhuang', comprising the following steps: using the primers to detect the genotype of the SNP molecular marker combination, and judging the authenticity of the hybrid according to the genotype.

[0013] The sixth technical solution of the present invention is the application of the SNP molecular marker combination and the primers in mango breeding.

[0014] Based on the above technical solution, the present invention has the following technical effects:

[0015] The primer set designed based on the SNP marker for identifying the authenticity of the hybrid of mango 'Aiwen' and 'Jinhuang' provided by the present invention can quickly and effectively identify the authenticity of the hybrid of mango 'Aiwen' and 'Jinhuang', and the identification result is accurate and reliable, which is beneficial to the genetic breeding of mango. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] In order to more clearly illustrate the embodiments of the present invention or the technical solutions in the prior art, the drawings required for use in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For ordinary technicians in this field, other drawings can be obtained based on these drawings without paying creative work.

[0017] Figure 1 The typing results of Mgchr3_9859221 primer screening;

[0018] Figure 2 The typing results of Mgchr4_9776523 primer screening;

[0019] Figure 3 The typing results of Mgchr10_989472 primer screening;

[0020] Figure 4 The typing results of Mgchr11_1781329 primer screening;

[0021] Figure 5 The typing results of Mgchr17_4602769 primer screening;

[0022] Figure 6 The typing results of the screening of Mgchr20_81237 primers;

[0023] Figure 7 These are the typing results of 117 individual strains of Mgchr11_1781329.

[0024] Figure 8 The typing results of 117 individual strains of Mgchr20_81237 are shown.

[0025] in, Figures 1 to 8 The blue circle represents the genotype of 'Jinhuang', the red circle represents the genotype of 'Aiwen', and the green circle represents the hybrid F 1 The genotype of the generation. DETAILED DESCRIPTION

[0026] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as limiting the present invention, but should be understood as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0027] It should be understood that the terms described in the present invention are only for describing special embodiments and are not intended to limit the present invention. In addition, for the numerical range in the present invention, it should be understood that each intermediate value between the upper and lower limits of the scope is also specifically disclosed. Each smaller range between the intermediate value in any stated value or stated range and any other stated value or intermediate value in the described range is also included in the present invention. The upper and lower limits of these smaller ranges can be independently included or excluded in the scope.

[0028] Unless otherwise indicated, all technical and scientific terms used herein have the same meanings as those generally understood by those skilled in the art. Although the present invention describes only preferred methods and materials, any methods and materials similar or equivalent to those described herein may also be used in the implementation or testing of the present invention. All documents mentioned in this specification are incorporated by reference to disclose and describe the methods and / or materials associated with the documents. In the event of a conflict with any incorporated document, the content of this specification shall prevail.

[0029] It will be apparent to those skilled in the art that various modifications and variations may be made to the specific embodiments of the present invention description without departing from the scope or spirit of the present invention. Other embodiments derived from the present invention description will be apparent to those skilled in the art. The present application description and examples are exemplary only.

[0030] The words “include,” “including,” “have,” “contain,” etc. used in this document are open-ended terms, meaning including but not limited to.

[0031] The technical solutions described in the present invention, unless otherwise specified, are all conventional solutions in the art, and the reagents or raw materials used, unless otherwise specified, are purchased from commercial channels or have been disclosed.

[0032] The embodiment of the present invention provides a SNP molecular marker combination for identifying the authenticity of a hybrid of mango 'Aiwen' and 'Jinhuang', including Mgchr11_1781329 and Mgchr20_81237;

[0033] The Mgchr11_1781329 is located at position 1781329 of chromosome 11, the genotype of 'Aiwen' is TT, the genotype of 'Jinhuang' is AA, and the genotype of the hybrid is T / A;

[0034] Mgchr20_81237 is located at position 81237 of chromosome 20. The genotype of 'Aiwen' is AA, the genotype of 'Jinhuang' is TT, and the hybrid F 1 The genotype is A / T.

[0035] It should be noted that mango 'Aiwen' and 'Jinhuang' are two mango varieties known in the art and have no specific meaning; in addition, the hybrid in the present invention is the F of mango 'Aiwen' and 'Jinhuang'. 1 In addition, the mango reference genome GCF_011075055.1 / (https: / / www.ncbi.nlm.nih.gov / ) is used as the reference genome in the present invention.

[0036] The embodiment of the present invention also provides primers for specifically amplifying the SNP molecular marker combination, including primers for specifically amplifying Mgchr11_1781329 and primers for specifically amplifying Mgchr20_81237.

[0037] In some specific embodiments, the primers for specifically amplifying Mgchr11_1781329 consist of the sequences shown in SEQ ID NOs. 1 to 3.

[0038] In some specific embodiments, the primers for specifically amplifying Mgchr20_81237 consist of the sequences shown in SEQ ID NOs. 4 to 6.

[0039] It should be noted that the above primer set can be added with commonly used detection auxiliary reagents to prepare a detection reagent. Commonly used detection auxiliary reagents are known in the art, such as buffer solution and the like.

[0040] In some specific embodiments, the above detection reagents may also include fluorescent reagents. It should be noted that fluorescent reagents may be added to the above detection reagents. Specifically, the difference in the last base at the 3' end of the primer and the fluorescent signal value can be used to distinguish and amplify DNA fragments of specific alleles, and the fluorescent signal value of the site to be tested can be detected to perform genotyping.

[0041] The embodiment of the present invention also provides the application of the SNP molecular marker combination and the primers in identifying the authenticity of the hybrid of mango 'Aiwen' and 'Jinhuang'.

[0042] The embodiment of the present invention also provides a method for identifying the authenticity of a hybrid of mangoes 'Aiwen' and 'Jinhuang', comprising the following steps: using the primers to detect the genotype of the SNP molecular marker combination, and judging the authenticity of the hybrid according to the genotype.

[0043] In some specific embodiments, the method for judging the authenticity of the hybrid according to the genotype is:

[0044] If the genotype of Mgchr11_1781329 is TT, it is the 'Aiwen' mango; if the genotype is AA, it is the 'Jinhuang' mango; if the genotype is T / A, it is a hybrid;

[0045] If the genotype of the Mgchr20_81237 is AA, it is the 'Aiwen' mango; if the genotype is TT, it is the 'Jinhuang' mango; if the genotype is A / T, it is a hybrid.

[0046] The embodiment of the present invention also provides the application of the SNP molecular marker combination and the primer in mango breeding.

[0047] Example 1

[0048] With 'Aiwen' as the male parent and 'Jinhuang' as the female parent, hybridization was carried out by artificial pollination, and 115 hybrid offspring of 'Aiwen' and 'Jinhuang' were obtained and planted in the South Subtropical Crops Research Institute of the Chinese Academy of Tropical Agricultural Sciences.

[0049] 1. SNP Primer Screening

[0050] The DNA of the leaf base of mango parents and offspring was extracted by alkaline boiling. Based on the resequencing data of 'Aiwen' and 'Jinhuang', the homozygous SNP sites with differences between the parents were screened, and 6 sets of primers were designed (see Table 1) (3 specific primers were designed using Primer5, named primer X, primer Y and primer R, respectively, and the primers were sent to Shanghai Bio-Tech Synthesis).

[0051] Table 1 SNP marker information of homozygous sites with differences between 'Jinhuang' and 'Aiwen'

[0052]

[0053]

[0054] Note: The linker sequence matching FAM fluorescence is GAAGGTGACCAAGTTCATGCT, and the linker sequence matching HEX fluorescence is GAAGGTCGGAGTCAACGGATT.

[0055] According to the difference of the last base at the 3' end of the primer and the fluorescence signal value, the DNA fragment of the specific allele is distinguished and amplified, and the fluorescence signal value of the tested site is detected to perform genotyping; 3 'Aiwen' and 3 'Jinhuang' and 16 hybrid F 1 A total of 22 individuals were used as materials, and the PARMS-SNP labeling method was used to screen primers. The SNP typing reagent PARMS was purchased from Wuhan Jingtai Biological; the PCR amplification reaction system is shown in Table 2 below.

[0056] Table 2 PCR reaction system

[0057] Element volume 2×PARMS 2.5μL Primer X 0.075μL Primer Y 0.075μL Primer R 0.2μL DNA template 1μL Double distilled water 2.5μL

[0058] The PCR reaction was performed on an ABIQuantStudio6 QS6 instrument, and genotyping was performed on the instrument. The reaction program is shown in Table 3.

[0059] Table 3 PCR reaction program

[0060] step temperature Duration 1 94℃ 15min 2 94℃ 20s 3 65℃(0.7℃ lower for each cycle) 1min 4 Return to step 2, 10 cycles 5 94℃ 20s 6 57℃ 1min

[0061] The results showed that the six primers were distributed on six chromosomes, namely chr3, chr4, chr10, chr11, chr17 and chr20. After PCR amplification, among the six primers, Mgchr11_1781329 and Mgchr20_81237 could effectively distinguish the 22 materials, and the 22 materials could be divided into three types. The blue color indicated the homozygous genotype of 'Jinhuang', the red color indicated the homozygous genotype of 'Aiwen', and the green color indicated the homozygous genotype of hybrid F 1 The results showed that Mgchr11_1781329 and Mgchr20_81237 can be used to identify the authenticity of the hybrid offspring of 'Jinhuang' and 'Aiwen' (Table 4).

[0062] Table 4 SNP markers used for authenticity identification of hybrids between ‘Aiwen’ and ‘Jinhuang’

[0063]

[0064] 2. Identification of the authenticity of hybrids

[0065] The selected primer sets were used to detect 1 'Aiwen', 1 'Jinhuang' and 115 hybrid F 1 A total of 117 individuals were amplified by PCR to perform genotyping on the genomic DNA; the genotype of each sample was counted, and when the genotype of the sample was a homozygous genotype, it was a pseudohybrid; when the genotype of the sample was a heterozygous genotype, it was a true hybrid.

[0066] The results showed that both markers could classify 117 plants into three genotypes. Both markers identified 115 true hybrids, with a true hybrid rate of 100% (Table 5).

[0067] Table 5 Statistical results of authenticity identification of hybrids of 'Aiwen' and 'Jinhuang'

[0068] Hybrid combination (♀×♂) Primers <![CDATA[F 1 Total (stock)]]> True hybrid True hybrid rate (%) 'Aiwen'×'Jinhuang' Mgchr11_1781329 115 115 100％ 'Aiwen'×'Jinhuang' Mgchr20_81237 115 115 100％

[0069] Obviously, the above embodiments of the present invention are merely examples for clearly illustrating the present invention, and are not intended to limit the implementation methods of the present invention. For ordinary technical users in the relevant field, other different forms of changes or modifications can be made on the basis of the above description. It is not necessary and impossible to list all the implementation methods here. Any modifications, equivalent substitutions and improvements made within the spirit and principles of the present invention should be included in the protection scope of the claims of the present invention.

Claims

1. A SNP molecular marker combination for identifying the authenticity of a hybrid of mango 'Aiwen' and 'Jinhuang', characterized in that: Includes Mgchr11_1781329 and Mgchr20_81237; The Mgchr11_1781329 is located at position 1781329 of chromosome 11, the genotype of 'Aiwen' is TT, the genotype of 'Jinhuang' is AA, and the genotype of the hybrid is T / A; The Mgchr20_81237 is located at position 81237 of chromosome 20, the genotype of 'Aiwen' is AA, the genotype of 'Jinhuang' is TT, and the genotype of the hybrid F1 is A / T.

2. Primers for specifically amplifying the SNP molecular marker combination according to claim 1, characterized in that: Included are primers that specifically amplify Mgchr11_1781329 and primers that specifically amplify Mgchr20_81237.

3. The primer according to claim 2, characterized in that The primers for specifically amplifying Mgchr11_1781329 consist of sequences shown in SEQ ID NOs. 1 to 3.

4. The primer according to claim 2, characterized in that The primers for specifically amplifying Mgchr20_81237 consist of sequences shown in SEQ ID NOs. 4 to 6.

5. Use of the SNP molecular marker combination according to claim 1 and the primers according to claim 2 in identifying the authenticity of the hybrid of mango 'Aiwen' and 'Jinhuang'.

6. A method for identifying the authenticity of a hybrid of mangoes 'Aiwen' and 'Jinhuang', characterized in that: The following steps are involved: The primers described in claim 2 are used to detect the genotype of the SNP molecular marker combination described in claim 1, and the authenticity of the hybrid is determined based on the genotype.

7. The method according to claim 6, characterized in that The method for judging the authenticity of the hybrid according to the genotype is: If the genotype of Mgchr11_1781329 is TT, it is the 'Aiwen' mango; if the genotype is AA, it is the 'Jinhuang' mango; if the genotype is T / A, it is a hybrid; If the genotype of the Mgchr20_81237 is AA, it is the 'Aiwen' mango; if the genotype is TT, it is the 'Jinhuang' mango; if the genotype is A / T, it is a hybrid.

8. Use of the SNP molecular marker combination according to claim 1 and the primers according to claim 2 in mango breeding.

Images