Application of plant extracts in the preparation of drugs against canine coronavirus

Abstract

This invention discloses the application of plant extracts in the preparation of drugs against canine coronavirus, belonging to the field of biomedical technology. The invention found that plant extracts—shikimic acid, phlorizin, caffeic acid, tribulus terrestris saponins, berberine hydrochloride, and apple polyphenols—possess anti-canine coronavirus activity, with phlorizin showing the most significant effect. Phlorizin exhibits antiviral activity in three aspects: direct killing, inhibition of viral adsorption, and inhibition of viral growth, with the inhibition of viral growth being the most significant. Phlorizin acts on the EC50 cells of cCoV. 50 The concentration was 0.616 mg / L. The plant extract of this invention is derived from natural plants and, compared to chemical drugs, has the advantages of low toxicity and good biocompatibility. This invention provides technical support for the development of novel, effective, safe, and side-effect-free pharmaceutical formulations for the prevention and treatment of canine coronavirus.

Description

Technical Field

[0001] This invention relates to the field of biomedical technology, and in particular to the application of plant extracts in the preparation of drugs against canine coronavirus. Background Technology

[0002] Due to the booming development of China's pet market and the rapid increase in the number of pet dogs, canine coronavirus infections in various types of dogs, including pet dogs, working dogs, and experimental dogs, are gradually increasing. While canine coronavirus infection is mostly not fatal, the symptoms such as dehydration, vomiting, and diarrhea that occur at the onset of the disease can still cause losses for affected dogs, their families, and the dog breeding industry. In clinical treatment, prevention and control of canine coronavirus primarily relies on vaccination, along with biological agents such as triple serum, pentavalent serum, immunoglobulins, and monoclonal antibodies. However, due to the wide variety of brands and types on the market with varying degrees of effectiveness, the efficacy of biological agents such as serums and monoclonal antibodies is gradually weakening, and vaccines and antibodies have certain limitations. Furthermore, various agents used as adjunctive therapies have developed drug resistance to varying degrees. Therefore, developing novel, effective, safe, and side-effect-free drugs for the prevention and control of canine coronavirus has become the latest development goal.

[0003] Generally speaking, compared to chemical drugs, natural plant secondary metabolites have lower toxicity, stronger affinity for biological macromolecules, and often possess multi-target and multi-pharmacological characteristics. Due to the increasingly serious drug resistance to antiviral drugs, coupled with the prohibition of antiviral drugs in veterinary clinical practice, the search for antiviral active substances from natural products has gradually become a hot topic in antiviral research.

[0004] Plant extracts have been widely used in various fields, exhibiting significant pharmacological effects in antibacterial, anti-inflammatory, antioxidant, antitumor, and immunomodulatory aspects. However, there is a lack of systematic research reports on the antiviral effects of plant extracts, and their application in companion animals and small animal diseases remains incomplete, with their efficacy and specific mechanisms of action still unclear.

[0005] Accordingly, this invention aims to investigate the specific mechanisms of antiviral effects of plant extracts on canine coronavirus, identify key signaling pathways affected by plant extracts, and provide a new approach to the prevention and treatment of small animal diseases using plant extracts. Summary of the Invention

[0006] The purpose of this invention is to provide the application of plant extracts in the preparation of drugs against canine coronavirus, thereby addressing the problems existing in the prior art. This invention has discovered that plant extracts—shikimic acid, phlorizin, caffeic acid, tribulus terrestris saponins, berberine hydrochloride, and apple polyphenols—possess anti-canine coronavirus activity and can therefore be used in the preparation of drugs against canine coronavirus.

[0007] To achieve the above objectives, the present invention provides the following solution:

[0008] This invention provides the use of plant extracts in the preparation of drugs against canine coronavirus, wherein the plant extracts are at least one of shikimic acid, phlorizin, caffeic acid, tribulus terrestris saponins, berberine hydrochloride, and apple polyphenols.

[0009] Furthermore, the drug includes pharmaceutically acceptable excipients.

[0010] Furthermore, the excipients include solubilizers, binders, disintegrants, fillers, stabilizers, preservatives, coating materials, and / or fragrances.

[0011] Furthermore, the dosage form of the drug is granules, tablets, capsules, powders, pills, injections, or oral liquids.

[0012] The present invention discloses the following technical effects:

[0013] This invention has discovered that plant extracts—shikimic acid, phlorizin, caffeic acid, tribulus terrestris saponins, berberine hydrochloride, and apple polyphenols—possess antiviral activity against canine coronavirus, with phlorizin showing the most significant effect. Phlorizin exhibits antiviral activity in three aspects: direct killing, inhibition of viral adsorption, and inhibition of viral growth, with the inhibition of viral growth being the most significant. Phlorizin acts on the EC50 cells of cCoV. 50 It is 0.616 mg / L.

[0014] The plant extracts of this invention are derived from natural plants and, compared to chemical drugs, have the advantages of low toxicity and good biocompatibility. This invention provides technical support for the development of novel, effective, safe, and side-effect-free pharmaceutical formulations for the prevention and treatment of canine coronavirus. Attached Figure Description

[0015] To more clearly illustrate the technical solutions in the embodiments of the present invention or the prior art, the drawings used in the embodiments will be briefly introduced below. Obviously, the drawings described below are only some embodiments of the present invention. For those skilled in the art, other drawings can be obtained based on these drawings without creative effort.

[0016] Figure 1 The figure shows the results of CCK-8 assay for the cytotoxicity of chlorogenic acid to CRFK.

[0017] Figure 2 The image shows the results of CCK-8 assay for the cytotoxicity of betaine against CRFK cells.

[0018] Figure 3 The figure shows the results of CCK-8 assay for the cytotoxicity of shikimic acid against CRFK cells.

[0019] Figure 4 The image shows the results of the CCK-8 assay for detecting the cytotoxicity of phlorizin to CRFK.

[0020] Figure 5 The figure shows the results of CCK-8 assay for the cytotoxicity of caffeic acid on CRFK cells.

[0021] Figure 6 The figure shows the results of CCK-8 assay for detecting the cytotoxicity of apple polyphenols to CRFK.

[0022] Figure 7 The figure shows the results of CCK-8 assay for the cytotoxicity of Tribulus terrestris saponins against CRFK cells.

[0023] Figure 8 The figure shows the results of CCK-8 assay for the cytotoxicity of neomethylhesperidin-dihydrochalcone against CRFK cells.

[0024] Figure 9 The figure shows the results of the CCK-8 assay for detecting the cytotoxicity of marigold flavonoids against CRFK cells.

[0025] Figure 10 The figure shows the results of the CCK-8 assay for the cytotoxicity of berberine hydrochloride against CRFK cells.

[0026] Figure 11 This is a standard curve for quantitative real-time PCR.

[0027] Figure 12 Viral load statistics from a preliminary screening experiment to assess the inhibitory effect of plant extracts on CCoV;

[0028] Figure 13 A statistical graph showing the inhibition rate of phlorizin at different concentrations on CCoV-induced CRFK cell cytopathic effects, as determined by the CCK-8 assay.

[0029] Figure 14 Growth curves of CCoV in CRFK at different phloretin concentrations;

[0030] Figure 15 A statistical graph showing the viral load of CCoV in CRFK at 4 hours under different phloretin concentrations;

[0031] Figure 16 A statistical graph showing the viral load of CCoV in CRFK at 8 h under different phloretin concentrations;

[0032] Figure 17 A statistical graph showing the viral load of CCoV in CRFK at 12 h under different phloretin concentrations;

[0033] Figure 18A statistical graph showing the viral load of CCoV in CRFK at 18 h under different phloretin concentrations;

[0034] Figure 19 A statistical graph showing the viral load of CCoV in CRFK at 24 h under different phloretin concentrations;

[0035] Figure 20 A statistical graph showing the viral load of CCoV in CRFK at 36 h under different phloretin concentrations;

[0036] Figure 21 A statistical graph showing the viral load of CCoV in CRFK at 48 h under different phloretin concentrations;

[0037] Figure 22 This is a diagram showing the results of an experiment that directly kills the virus.

[0038] Figure 23 The results of the experiment on inhibiting virus adsorption are shown in the figure;

[0039] Figure 24 The image shows the results of an experiment to inhibit virus growth. Detailed Implementation

[0040] Various exemplary embodiments of the present invention will now be described in detail. This detailed description should not be considered as a limitation of the present invention, but rather as a more detailed description of certain aspects, features, and embodiments of the present invention.

[0041] It should be understood that the terminology used in this invention is merely for describing particular embodiments and is not intended to limit the invention. Furthermore, with respect to numerical ranges in this invention, it should be understood that each intermediate value between the upper and lower limits of the range is also specifically disclosed. Any stated value or intermediate value within a stated range, as well as each smaller range between any other stated value or intermediate value within said range, is also included in this invention. The upper and lower limits of these smaller ranges may be independently included or excluded from the range.

[0042] Unless otherwise stated, all technical and scientific terms used herein have the same meaning as commonly understood by one of ordinary skill in the art. While only preferred methods and materials have been described herein, any methods and materials similar or equivalent to those described herein may be used in the implementation or testing of this invention. All references to this specification are incorporated by way of citation to disclose and describe methods and / or materials associated with those references. In the event of any conflict with any incorporated reference, the content of this specification shall prevail.

[0043] Various modifications and variations can be made to the specific embodiments described in this specification without departing from the scope or spirit of the invention, as will be apparent to those skilled in the art. Other embodiments derived from this specification will also be apparent to those skilled in the art. This specification and embodiments are merely exemplary.

[0044] The terms “include,” “including,” “have,” “contain,” etc., used in this article are all open-ended terms, meaning that they include but are not limited to.

[0045] Terminology Explanation:

[0046] Phloretin, also known as trihydroxyphenol acetone 2,4,6-trihydroxy-3-(4-hydroxyphenyl)phenylacetone, belongs to the flavonoid class of compounds and is mainly distributed in the pericarp and root bark of juicy fruits such as apples and pears. Its molecular formula is C2. 15 H 14 O5, CAS number 60-82-2, has the following structure:

[0048] Shikimic acid, with the molecular formula C7H 10 O5, CAS number 138-59-0, has the following structure:

[0050] Caffeic acid, with the molecular formula C9H8O4 and CAS number 331-39-5, has the following structural formula:

[0052] The molecular formula of tribulus terrestris saponins is C 30 H 26 O 13 The CAS number is 22153-44-2, and the structural formula is as follows:

[0054] Berberine hydrochloride has the molecular formula C 20 H 18 NO4Cl, CAS number 633-65-8, has the following structural formula:

[0056] Apple polyphenols are polyphenolic substances extracted from apples, with CAS number 85251-63-4.

[0057] Example 1

[0058] 1. Experimental Materials

[0059] 1.1 Cells and Viruses

[0060] Primary feline kidney cells (CRFK); canine coronavirus (CCoV).

[0061] 1.2 Main reagents (see Table 1)

[0062] Table 1 Main Reagents

[0064] 1.3 Main instruments and equipment (see Table 2)

[0065] Table 2 Main Instruments and Equipment

[0068] 1.4 Primer Sequence

[0069] The primer sequences involved in this invention are shown in Table 3.

[0070] Table 3 Primer sequences

[0071] Primer name Nucleotide sequence (5'-3') cCoV24-F CCCATTGTTTTGGCTCT cCoV24-R CCATCCTGTTGCACTACTT CCoVII-F CCTGAGACTAATGCAATTC CCoVII-R CCCTGAAAGCAATGTTAA Probe ACACCAGTTGGCACACCTTCTA

[0072] 2. Test Methods

[0073] 2.1 Cell Culture

[0074] 2.1.1. Cell resuscitation

[0075] Remove the CRFK cell cryovials quickly from liquid nitrogen and immediately place them in a 37°C water bath, shaking them constantly to thaw the cell suspension as quickly as possible. Wipe the cryovials with 75% alcohol swabs, open the caps in a biosafety cabinet, aspirate the cell suspension, centrifuge at 1000 rpm for 5 minutes, and discard the cryopreservation solution. Prepare for cell culture.

[0076] 2.1.2 Cell Culture

[0077] The centrifuged cells were resuspended in DMEM medium containing 10% fetal bovine serum (FBS) and inoculated into T25cm cells. 2 Place the cell culture flask in a cell culture incubator (37℃, 5% CO2), observe the cell growth status on the second day, and passage the cells when they have basically formed a monolayer.

[0078] During passage, discard the old cell culture medium and wash once with PBS. Then, add 1 mL of trypsin to submerge the cell monolayer and incubate in a cell culture incubator for 1 min. When the cell layer appears to detach like quicksand, collect all trypsin and cells using a pipette, centrifuge at 1000 rpm for 5 min, discard the trypsin, add 10% FBS in DMEM medium to stop digestion, and repeatedly pipette the cells until they are completely dispersed and resuspended. Pass the cells into new cell culture flasks in a one-to-two manner and incubate in an incubator (37℃, 5% CO2).

[0079] 2.2 Virus culture:

[0080] When the monolayer cells reached 80% confluence, the culture medium was discarded and the cells were washed once with PBS. The stored CCoV strain was taken out from the -80℃ freezer, thawed on ice, and 100 μL was inoculated into the cell culture bottle. The cell culture bottle was then placed in a cell culture incubator for 1 hour to allow for virus adsorption. After 1 hour, DMEM medium with 10% FBS was added, and the cell culture bottle was placed in the cell culture incubator again for 72 hours to observe the cytopathic effect.

[0081] 2.3 Median viral load (TCID) in tissue culture 50 Determination of )

[0082] CRFK cells were seeded into 96-well plates. When the cells reached 80% confluence, the cell culture medium was discarded, and the cells were washed once with PBS. The CCoV stock solution was serially diluted 10-fold with serum-free DMEM medium to achieve a viral dilution of 10. -1 -10 -9 Add 100 μL of virus solution of each dilution to each well, with 8 replicates per dilution. After completion, incubate the 96-well plate at 37°C and 5% CO2 for 72 hours. Observe cytopathic effects and calculate the median tissue culture infectious dose (TCID) of the virus according to the Reed-Muench formula. 50 ).

[0083] 2.4 CCK-8 assay for the cytotoxicity of plant extracts to CRFK cells

[0084] Plant extracts were dissolved in DMSO and filtered through a 0.22 μm filter to prepare a 200 mg / L stock solution. The plant extract solutions were serially diluted twofold using 2% FBS in DMEM cell culture medium to obtain final concentrations of 200, 100, 50, 25, 12.5, 6.25, 3.13, and 1.56 mg / L. 10 6 / mL CRFK cell suspension was seeded into 96-well plates. After the cells grew to a confluent monolayer, the culture medium was discarded, and 100μL of plant extract solution at different concentrations was added to each well, with three replicates for each concentration. The 96-well plates with the added solution were incubated at 37℃ and 5% CO2 for 48h. After that, the culture medium was discarded, the plates were washed once with PBS, and then 10μL of CCK-8 reagent was added to each well. The plates were then returned to the incubator for 1h. After that, the OD was measured using a microplate reader. 450nm The absorbance of each well at the specified wavelength was used to calculate the cytotoxicity of different concentrations of plant extracts to CRFK cells.

[0085] 2.5 Effect of real-time quantitative PCR on the expression of plant extracts on the coCoV M gene

[0086] 2.5.1 Establishment of an absolute fluorescence quantitative method for CCoV

[0087] (1) Primer design

[0088] Based on the canine coronavirus M gene sequence published in NCBI GenBank, a pair of primers CCoV24-F / R (see Table 3) was designed using Premier 6.0 software and synthesized by Beijing Ruibo Kexing Gene Technology Co., Ltd. The expected PCR amplification product length is 420bp.

[0089] (2) Extraction of CCoV virus genes and synthesis of cDNA

[0090] Following the previous steps for culturing the virus, diseased cells were harvested, and after repeated freeze-thaw cycles, viral RNA was extracted according to the kit instructions. The concentration was detected using a nucleic acid protein analyzer, and the RNA was immediately stored at -80°C for later use. At the same time, a portion of the RNA was taken and reverse transcribed immediately according to the kit instructions, and the resulting cDNA was stored at -20°C for later use.

[0091] The reverse transcription reaction system and conditions are as follows:

[0092] Reverse transcription reaction system: 4 μL of 5×FastKing-RT SuperMix, 50 ng - 2 μg of RNA, and RNase-free water (H2O) to make up to 20 μL.

[0093] The reverse transcription reaction conditions were set as follows: 42℃ for 15 min, followed by enzyme inactivation at 98℃ for 3 min.

[0094] (3) Establishment of standard positive templates for gene plasmids:

[0095] Using cDNA obtained from reverse transcription as a template, amplification was performed according to the standard PCR reaction system and conditions. The PCR amplification reaction system and conditions are as follows:

[0096] PCR amplification reaction system: 10 μL Prime Star Mix (10×), 1 μL upstream primer, 1 μL downstream primer, 1 μL cDNA, and 7 μL RNase-free water (RNase-free H2O).

[0097] The PCR amplification reaction conditions were set as follows: 98℃ pre-denaturation for 3 min; 98℃ denaturation for 15 s, 55℃ annealing for 30 s, 72℃ extension for 30 s, 30 cycles; 72℃ extension for 5 min.

[0098] After amplification, 5 μL of the reaction solution was subjected to 1% agarose gel electrophoresis for detection, and the target DNA fragment was recovered using a gel extraction kit. The recovered target DNA fragment was ligated into the pTOPO vector (purchased from Beijing Adley Biotechnology Co., Ltd.), transformed into DH5α competent cells, and cultured overnight in LB agar containing ampicillin. Single colonies were picked, identified by PCR, and sent to Beijing Qingke Biotechnology Co., Ltd. for sequencing. Positive plasmids with correct sequencing results can be used for subsequent experiments.

[0099] (4) Design of qRT-PCR primers and probes

[0100] The sequences obtained from the sequencing results were imported into NCBI for BLAST alignment. Then, based on the CCoV sequences published in NCBI GenBank, primer pairs CCoV II-F / R and probes were designed using Beacon Designer 8.14 software (see Table 3). The reaction system was confirmed and the results were synthesized by Beijing Ruibo Kexing Gene Technology Co., Ltd. The expected length of the PCR amplification product is 102 bp.

[0101] The qRT-PCR reaction system and reaction conditions are as follows:

[0102] qRT-PCR reaction system: Premix EX Taq (Probe qRT-PCR) (2×) 10μL, upstream primer 0.4μL, downstream primer 0.4μL, probe 0.8μL, ROX Reference Dye II (50×) 0.2μL, cDNA 2μL and RNase free H2O 6.2μL.

[0103] The experiment was conducted using an Applied Biosystems 7500 Real-Time PCR System. The reaction conditions were a two-step amplification standard program, set as follows: 98℃ pre-denaturation for 30 seconds; 95℃ for 5 seconds; 60℃ for 34 seconds; 40 cycles.

[0104] (5) Preparation of standard curve

[0105] Perform 10-fold serial dilutions on the obtained positive plasmids, and take 10... -5 10 -6 10 -7 10 -8 10 -9 10 -10 10 -11Seven consecutive serial dilutions were used as templates for qRT-PCR, with ddH2O as a negative control. A standard curve was constructed by plotting the logarithm of the template standard copy number on the x-axis and the Ct value of the amplification curve on the y-axis. The equation of the standard curve and the correlation coefficient R were calculated. 2 Amplification efficiency E.

[0106] 2.6 Evaluation of the inhibitory effect of plant extracts on cCoV

[0107] A concentration of 12.5 mg / L was selected as the initial screening concentration. CRFK cells were seeded into 6-well cell culture plates. When the cell abundance reached 80%, the culture medium was discarded, the cells were washed three times, and then 100 μL of 100 TCID45 solution was added. 50 The CCoV virus solution was placed in an incubator for 1 hour to adsorb, and then 12.5 mg / L of plant extract solution was added. Each group was repeated three times.

[0108] The cell culture plates of each group were placed in a 5% CO2, 37°C cell culture incubator and cultured for 48 hours. After that, the supernatant was discarded, and RNA was extracted from the cells for reverse transcription. qRT-PCR was performed on each group of samples to detect the cCoV M gene, and the cCoV copy number in each sample was calculated using the standard curve formula.

[0109] 2.7 Phloretin's effect on cCoV EC 50 Detection

[0110] Add 50 μL of 100 TCID to a 96-well plate containing a monolayer of CRFK cells. 50 CCoV virus solution was prepared by adding different concentrations of phlorizin to each culture well, resulting in final concentrations of phlorizin of 12.5 mg / L, 6.25 mg / L, 3.125 mg / L, 1.563 mg / L, 0.781 mg / L, 0.391 mg / L, 0.195 mg / L, and 0.098 mg / L, respectively. The treated cell culture plates were then incubated at 37°C in a 5% CO2 incubator for 48 hours. Cytopathic effect (CPE) was observed and recorded, and the half-maximal effective concentration (IC50) of the drug was calculated using the Reed-Muench formula. The calculation formula is as follows:

[0111] EC 50 =C×2 -S ;

[0112] S = N-1 + (HR) / (HL);

[0113] In the formula, N represents the drug concentration number with an inhibition rate higher than 50%; H represents an inhibition rate higher than 50%; L represents an inhibition rate lower than 50%; R is 50%; and C represents the concentration of the drug experimental group with the number 1.

[0114] 2.8 Effect of phlorizin on the growth curve of cCoV in CRFK

[0115] CRFK cells were seeded in 6-well cell culture plates. When the cell abundance reached 80%, the culture medium was discarded, and the cells were washed three times before being inoculated with 100 μL of 100 TCID45 solution. 50 The CCoV virus solution was placed in an incubator for 1 hour to adsorb. Then, different concentrations of phloretin solution were added simultaneously to achieve final concentrations of 12.5 mg / L, 6.25 mg / L, and 3.125 mg / L, respectively. A virus control group without the drug was also set up, and each group was performed in triplicate.

[0116] The cell culture plates of the above groups were placed in a 5% CO2, 37℃ cell culture incubator, and the supernatant was discarded and cells were collected at 4h, 8h, 12h, 18h, 24h, 36h, and 48h, respectively, to extract RNA for reverse transcription. The obtained cDNA samples were subjected to qRT-PCR to detect the cCoV M gene in each sample, and the cCoV copy number in each sample was calculated according to the standard curve formula to plot the virus growth curve under the influence of phloretin.

[0117] 2.9 Determination of the mechanism of action of phloretin in inhibiting cCoV

[0118] (1) Direct inactivation effect on viruses

[0119] 100 μL 100 TCID 50 The cCoV virus solution was mixed with a 12.5 mg / L drug solution, and a 100 TCID solution without the drug was prepared simultaneously. 50 The virus solution was used as a control. After incubating both in a 37°C incubator for 1 hour, they were inoculated into 6-well cell culture plates containing a monolayer of CRFK cells. After incubation at 37°C and 5% CO2 for 1 hour, the supernatant was discarded, the cell culture plates were washed 3 times, and 2% cell maintenance medium was added for 48 hours of culture. RNA from each sample was collected, and the viral copy number was detected by qRT-PCR.

[0120] (2) Inhibit the virus adsorption process:

[0121] 100 μL 100 TCID 50 CCoV virus solution was inoculated into a 6-well cell culture plate containing a monolayer of CRFK cells, and 12.5 mg / L of drug solution was added simultaneously. A control group without drug was set up. After incubation at 37°C and 5% CO2 for 1 h, the supernatant was discarded, the cell culture plate was washed 3 times, and 2% cell maintenance medium was added for 48 h of culture. RNA from each sample was collected, and the viral copy number was detected by qRT-PCR.

[0122] (3) Inhibits viral growth and reproduction:

[0123] 100 μL 100 TCID 50 CCoV virus solution was inoculated into a 6-well cell culture plate containing a monolayer of CRFK cells and incubated at 37°C and 5% CO2 for 1 h. The supernatant was discarded, and the cell culture plate was washed 3 times. 12.5 mg / L of each drug solution was added to each plate, and a drug-free culture medium was added as a control group. The plates were cultured at 37°C and 5% CO2 for 48 h. RNA from each sample was collected, and the viral copy number was detected by qRT-PCR.

[0124] 3. Experimental Results

[0125] 3.1 Median Infectious Value (TCID) of Virus in Tissue Culture 50 The results of the measurement

[0126] CCoV virus solutions at different dilutions were added to cell culture plates containing a monolayer of CRFK and incubated at 37°C in a 5% CO2 incubator for 72 hours. Cytopathic effect (CPE) was observed and recorded, and the results are shown in Table 4. TCID was calculated using the Reed-Muench formula. 50 The value is 10 5.903 / 100μL.

[0127] Table 4 Virus TCID 50 Measurement results

[0129] 3.2 Results of CCK-8 assay for drug cytotoxicity against CRFK cells

[0130] The effects of different concentrations of plant extracts on CRFK cell viability were detected using the CCK-8 assay. The results are as follows: Figures 1-10 As shown in the figure. The results indicated that at concentrations of 12.5 mg / L and below, the plant extracts exhibited mild cytotoxicity to cells.

[0131] 3.3 Real-time quantitative PCR detection of the effect of plant extracts on virus expression

[0132] (1) Construction of CCoV recombinant positive plasmid:

[0133] The amplified CCoV gene fragment was approximately 420 bp in size using a standard PCR reaction system, consistent with the expected product size, indicating that the target gene fragment was correctly amplified. After gel recovery of the amplified product, it was ligated into the pTOPO-TA vector. The correctly sequenced positive plasmid was named pTOPO-CCoV. The extracted plasmid was analyzed using a nucleic acid and protein detector, and its concentration was 199.5 ng / μL, OD... 260 / OD 280The value is 1.98, which meets the purity requirements. Converted to a copy number using the formula, it is 4.3 × 10⁻⁶. 11 copies / μL.

[0134] (2) Preparation of the absolute fluorescence quantitative standard curve for CCoV:

[0135] Select 10 positive standards -5 10 -6 10 -7 10 -8 10 -9 10 -10 10 -11 Seven dilutions were used as reaction templates, with ddH2O as a negative control. A standard curve was constructed by plotting the logarithm of the template standard copy number on the x-axis and the Ct value of the amplification curve on the y-axis. The results are shown in [Figure number missing]. Figure 11 .

[0136] The results showed that in 10 -5 -10 -9 Within the dilution range, a good linear relationship is observed.

[0137] The standard curve and regression equation are Y = -3.4794X + 0.2896, and the correlation coefficient R0 is... 2 =0.998, amplification efficiency E=93.8%, which meets the requirements and can be used for quantitative detection of CCoV.

[0138] 3.4 Evaluation of the inhibitory effect of plant extracts on cCoV

[0139] Based on the results of cytotoxicity tests, this invention provides a preliminary screening of the antiviral effects of various plant extracts. The viral load detection results for each treatment group are shown below. Figure 12 The results showed that shikimic acid, phlorizin, caffeic acid, tribulus saponins, berberine hydrochloride, and apple polyphenols had anti-canine coronavirus effects (P < 0.0001), among which phlorizin had the most significant effect. Therefore, phlorizin was selected for the next step of the experiment.

[0140] 3.5 Phloretin acts on cCoV EC 50

[0141] To verify the antiviral effect of phlorizin, this invention selected cCoV as the test virus. cCoV and phlorizin solution were inoculated onto CRFK cells, and ECMO was performed. 50 The calculations and test results are shown in Tables 5 and 6. Figure 13 By observing the cytotoxic effects of phlorizin at different concentrations on CCoV-induced CRFK cell cytopathic effects, and combining this with the CCK-8 assay to detect the inhibitory effect of phlorizin on CCoV-induced EC50, the EC50 of phlorizin on CCoV was finally calculated. 50It is 0.616 mg / L.

[0142] Table 5. Inhibitory effects of different concentrations of phlorizin on cCoV

[0144] Table 6. Mean absorbance of CCK-8 at different phloretin concentrations

[0146] 3.6 Effect of phlorizin on the growth curve of cCoV in CRFK

[0147] Cells from different concentrations of phlorizin-treated groups and virus-infected groups were collected at 4h, 8h, 12h, 18h, 24h, 36h, and 48h, respectively. RNA was extracted using an RN27 viral RNA rapid extraction kit, and immediately reverse transcribed into cDNA. Purity was assessed using a nucleic acid protein detector, and the cCoV copy number in each sample was detected using the previously established absolute fluorescence quantitative PCR method. Growth curves were plotted, and the overall trend and comparisons at various time points are shown below. Figures 14-21 As shown.

[0148] In the virus control group, the copy number of CCoV gradually increased from 4 to 24 hours after viral infection of CRFK cells, reached a peak between 24 and 36 hours, and gradually decreased from 36 to 48 hours. This may be because the massive proliferation of viral particles during this stage caused a large number of cell deaths, which affected the further proliferation of the virus. However, after treatment with phloretin, the proliferation of CCoV in CRFK cells was significantly inhibited after viral infection.

[0149] 3.7 Results of determination of the mechanism of action of phlorizin in inhibiting cCoV

[0150] Phlorizin was dissolved in culture medium to prepare a 12.5 mg / L solution, which was then co-cultured with CRFK cells inoculated with cCoV at different time points, with a pure virus control included. Cells were then harvested, and nucleic acid was extracted. The viral load of canine coronavirus under phlorizin treatment was detected using the previously defined quantitative real-time PCR method. The results are shown in [Figure number missing]. Figures 22-24 .

[0151] according to Figures 22-24 It can be seen that phloretin has antiviral activity in three aspects: direct killing, inhibition of virus adsorption, and inhibition of virus growth, among which the effect of inhibiting virus growth is the most significant.

[0152] The embodiments described above are merely preferred embodiments of the present invention and are not intended to limit the scope of the present invention. Various modifications and improvements made by those skilled in the art to the technical solutions of the present invention without departing from the spirit of the present invention should fall within the protection scope defined by the claims of the present invention.

Claims

1. The application of plant extracts in the preparation of drugs against canine coronavirus, characterized in that, The plant extract is phloretin.

2. The application according to claim 1, characterized in that, The drug includes pharmaceutically acceptable excipients.

3. The application according to claim 2, characterized in that, The excipients include solubilizers, binders, disintegrants, fillers, stabilizers, preservatives, coating materials, and / or fragrances.

4. The application according to claim 2, characterized in that, The dosage form of the drug is granules, tablets, capsules, powders, pills, injections, or oral liquids.

Images