KASP molecular marker for identifying wheat grain weight and application

Abstract

The invention relates to the technical field of gene engineering, and discloses a KASP molecular marker for identifying wheat grain weight and application. The SNP locus provided by the invention is located at the 153452675bp site of the wheat 2A chromosome, and the polymorphism is G / A. An SNP site related to the thousand seed weight of a plant is obtained through phenotypic difference analysis and exon capture analysis of the thousand seed weight, and a corresponding KASP primer combination is designed for the SNP site. The KASP primer combination provided by the invention can accurately and quickly identify the thousand seed weight of wheat, and has important significance in high-yield breeding of plants.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, in particular to a KASP molecular marker for identifying wheat grain weight and its application. Background Art

[0002] wheat( Triticum aestivum L.) is one of the most important food crops with a wide planting area and high yield. Thousand-grain weight determines the plant type and lodging resistance of wheat, and is an important trait affecting yield.

[0003] Exome capture sequencing is a method for extracting and sequencing exons (a collection of all exons) in a genome and obtaining exon variation in a single organism sample. This method enables research to quickly focus on the part of the genome that is most likely to affect phenotypic variation. KASP (Kompetitive Allele Specific PCR) is a molecular marker developed based on SNP loci. It has the characteristics of high stability, accuracy and low cost. It has been widely used in high-throughput SNP typing, especially when the sample size is large and the SNP loci are few, the application of KASP is more significant.

[0004] wheat( Triticum aestivum L.) is one of the most important food crops in the world and the second largest staple food crop in my country after rice. Improving wheat yield has increasingly become the focus of frontier research in the field of wheat. Summary of the invention

[0005] The purpose of the present invention is to provide a KASP molecular marker for identifying wheat grain weight and its application.

[0006] To achieve the purpose of the present invention, in a first aspect, the present invention provides a KASP molecular marker for identifying wheat grain weight, which is a SNP molecular marker associated with plant thousand-grain weight, and the molecular marker contains a nucleotide sequence with a polymorphism of G / A at 153452675 bp of wheat chromosome 2A.

[0007] Furthermore, the plants whose genotype of the polymorphic site contained in the molecular marker is AA have a higher thousand-grain weight than the plants whose genotype is GG.

[0008] In a second aspect, the present invention provides a KASP primer combination for amplifying the molecular marker, comprising forward primer 1 (AGGAGCGCAAGCTGGAGACCGG) as shown in SEQ ID NO: 1, forward primer 2 (AGGAGCGCAAGCTGGAGACCGA) as shown in SEQ ID NO: 2, and reverse primer (CTTGCTCTTGTGTCGCGCCCGT) as shown in SEQ ID NO: 3.

[0009] Furthermore, the 5′ ends of the forward primer 1 and the forward primer 2 in the KASP primer combination may also be connected to a fluorescent marker sequence, such as FAM (GAAGGTGACCAAGTTCATGCT) or HEX (GAAGGTCGGAGTCAACGGATT).

[0010] In a specific embodiment of the present invention, the KASP primer combination is as follows: 153452675-F1: 5'-GAAGGTGACCAAGTTCATGCTAGGAGCGCAAGCTGGAGACCGG-3'; (SEQ ID NO: 4) 153452675-F2: 5'-GAAGGTCGGAGTCAACGGATTAGGAGCGCAAGCTGGAGACCGA-3'; (SEQ ID NO: 5) 153452675-R: 5'-CTTGCTCTTGTGTCGCGCCCGT-3' (SEQ ID NO: 3).

[0011] In a third aspect, the present invention also provides a detection reagent or a kit containing the primer combination.

[0012] In a fourth aspect, the present invention provides a method for identifying the thousand-grain weight (height, size) of a plant, comprising: using the DNA of a plant sample to be tested as a template, using the KASP primer combination or the detection reagent or kit to perform PCR amplification, and judging the thousand-grain weight of the plant sample to be tested according to the amplification result.

[0013] Preferably, based on a total system of 10 μL, the system used for PCR amplification includes: 4-6 μL of 2×KASP Mix, 0.12-0.16 μL of primer mixture, 25-35 ng of DNA template, and the remainder is water.

[0014] The primer mixture, calculated as 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 28-32 μL, and the remainder is water.

[0015] Preferably, the reaction program used for PCR amplification is: 95°C 8-12 min; 95°C 15-25 s, 61°C 60 s, 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C 15-25 s, 55°C 35-45 s, 32-36 cycles; 25°C 10-20 min.

[0016] Furthermore, judging the thousand-grain weight of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site contained in the molecular marker in the amplification product, and the plant with genotype AA has a higher thousand-grain weight than the plant with genotype GG.

[0017] Furthermore, the plant is wheat.

[0018] In a fifth aspect, the present invention provides any of the following applications of the molecular marker, the molecular marker combination, or the detection reagent or kit: (1) Used for identification, breeding and improvement of wheat thousand-grain weight; (2) Used for early prediction of wheat thousand-grain weight; (3) Used in wheat molecular marker-assisted breeding; (4) Used for screening or cultivating high-yield plants.

[0019] By means of the above technical solution, the present invention has at least the following advantages and beneficial effects: (I) The present invention obtains a SNP site of a gene through phenotypic difference analysis of thousand-grain weight and exon capture sequencing technology analysis. The SNP site is closely related to the phenotype of the plant's thousand-grain weight. By detecting the polymorphism of the SNP site, it is possible to accurately and quickly identify whether the plant has a high thousand-grain weight. The marker for this site has the advantages of good genetic stability, high resolution, and suitability for high-throughput detection applications.

[0020] (ii) The SNP loci and corresponding KASP primer combinations provided by the present invention can not only be used to identify the thousand-grain weight of plants, but also can be used to improve the selection efficiency of plant varieties, shorten the breeding cycle, and accelerate the field of high-yield plants, which has important application value. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 The exon capture sequencing technology provided in Example 1 of the present invention is obtained by analysis TraesCS2A02G188500 Gene exon SNP site map.

[0022] Figure 2 This is a statistical chart of thousand-grain weight of different genotypes at locus 153452675 of chromosome 2A provided in Example 2 of the present invention.

[0023] Figure 3 The typing result of the wheat genotype at the 153452675 site of chromosome 2A provided in Example 2 of the present invention; wherein GG represents 153452675-G, AA represents 153452675-A, and CK represents a no-template control, that is, ultrapure water is used instead of sample DNA.

[0024] Figure 4This is the sequencing peak diagram of different genotypes of the 2A chromosome 153452675 site provided in Example 2 of the present invention. DETAILED DESCRIPTION

[0025] The following examples are used to illustrate the present invention, but are not intended to limit the scope of the present invention. Unless otherwise specified, the technical means used in the examples are conventional means well known to those skilled in the art, and the raw materials used are all commercially available products.

[0026] The wheat varieties (lines) involved in the following examples were all provided by Zhang Xueyong, a researcher at the Institute of Crop Sciences, Chinese Academy of Agricultural Sciences. The wheat was sown in Xinxiang, Henan Province, harvested after physiological maturity, naturally dried and used for subsequent analysis.

[0027] It should be noted that, as a professional agricultural research institution, the applicant has long preserved relevant germplasm materials, and the relevant wheat varieties are publicly available on the market or in existing germplasm banks.

[0028] Example 1 Acquisition of SNP molecular markers related to plant thousand-grain weight and design of KASP primers 1. 149 exon capture sequencing The whole exome sequencing process mainly includes the following steps: 1) Sample testing: First, the DNA samples are tested to ensure that their quality and quantity meet the sequencing requirements. The testing methods include agarose gel electrophoresis and nanodrop detection, and the DNA concentration is required to be greater than or equal to 20ng / ul and the total amount is greater than 800ng.

[0029] 2) Library construction: The genomic DNA was randomly broken into 180-280 fragments using a Covaris fragmentor, and the Agilent SureSelect Human All Exon V5 / V6 kit was used for end repair, phosphorylation, and poly A addition. Subsequently, liquid hybridization and PCR linear amplification were performed, and the library with a specific index was hybridized with a biotin-labeled probe, and the library quality was checked after PCR linear amplification.

[0030] 3) Library inspection: After the library is constructed, Qubit 2.0 is used for preliminary quantification, and then the inserted fragments of the library are detected using Agilent2100. After the test is qualified, the effective concentration of the library (3nmol / L) is accurately quantified using the Q-PCR method to ensure the quality of the library.

[0031] 4) Sequencing: After the library is qualified, IlluminaHiSeq PE150 sequencing is performed according to the effective concentration of the library and the data output requirements. PE150 (Pair End 150 bp) refers to high-throughput double-end sequencing, with 150 bp measured at each end. Double-end sequencing inserts fragments (Insert DNA) into the constructed small fragment library for high-throughput sequencing, which facilitates subsequent comparison and analysis.

[0032] 2. Obtaining thousand-grain weight of different wheat and developing SNP molecular markers In order to obtain the regulatory gene for high thousand-grain weight of wheat, combined with the existing technology, the thousand-grain weight of wheat was first measured, and the thousand-grain weight phenotype of the 149 wheat varieties planted above was measured, in order to preliminarily determine the phenotypic differences of the thousand-grain weight of wheat. The specific measurement results are shown in Table 1.

[0033] Based on the 149 thousand-grain weight phenotype data obtained in step 2, combined with the exon capture sequencing analysis results, the contribution of SNP sites of important genes to thousand-grain weight was explored, and a single nucleotide polymorphism (SNP) was screened on chromosome 2A of the wheat genome. TraesCS2A02G188500 There is a SNP site in the gene exon, and the SNP variation of this site significantly increases the thousand-grain weight. The significant site affecting the thousand-grain weight of wheat was identified (2A: 153452675 bp) (part of the results are shown in Figure 1 ), and named the site: 153452675.

[0034] Based on the above sequence differences and the KASP principle, a primer set for PCR amplification to obtain the wheat molecular marker was further developed and designed. The specific design is as follows: 153452675-F1: 5'-GAAGGTGACCAAGTTCATGCTAGGAGCGCAAGCTGGAGACCGG-3', (the 5' end "GAAGGTGACCAAGTTCATGCT" part of the sequence is the FAM tag sequence) 153452675-F2: 5'-GAAGGTCGGAGTCAACGGATTAGGAGCGCAAGCTGGAGACCGA-3', (the 5' end "GAAGGTCGGAGTCAACGGATT" part of the sequence is the HEX tag sequence) 153452675-R: 5'-CTTGCTCTTGTGTCGCGCCCGT-3'; When 153452675-F1 and 153452675-R are used as a primer pair combination, it is used to amplify the sequence of the 153452675 base of chromosome 2A in the wheat molecular marker; When 153452675-F2 and 153452675-R are used as a primer pair combination, they are used to amplify the sequence with base A at position 153452675 of chromosome 2A in the wheat molecular marker.

[0035] Example 2 Application of SNP molecular markers in identifying wheat thousand-grain weight 1. Based on the primer pair design of Example 1, the present invention detected the genotypes of 160 wheat materials (40 GG / 40 AA), and identified the correlation between the genotype and the 1000-grain weight phenotype. The specific process is as follows: First, genomic DNA of each wheat variety was extracted; Then, according to the primers designed in Example 1, the above extracted DNA was used as a template to perform PCR (using Quant Studio 1 fluorescent quantitative PCR instrument) detection and analysis on different wheat samples.

[0036] During specific PCR amplification, the 10 μL amplification system was designed as follows: KASP Mix (2×), 5 μL (i.e., HiGeno 2× Probe Mix (provided at 2× concentration), containing Taq DNA polymerase, universal fluorescent reporter probe, dNTP, buffer, MgCl2, and reference dye ROX); Primer Mix, 0.14 μL; DNA, 30 ng; Add ddH2O to 10 μL.

[0037] Wherein, the Primer Mix, per 100 μL: 505806275-F1, 100 μM, 12 μL; 505806275-F2, 100 μM, 12 μL; 505806275-R, 100 μM, 30 μL; ddHO, 46 μL.

[0038] The PCR reaction program (which can be adjusted appropriately according to the amplification results) is: 95℃ for 10 min; 95℃ for 20 s, 61℃ for 60 s (10 cycles, decreasing by 0.6℃ each cycle); 95℃ for 20 s, 55℃ for 40 s, 34 cycles; 25℃ for 15 min.

[0039] 2. Use the genomic DNA of each wheat variety extracted in step 1 to perform conventional PCR and sequencing to verify the accuracy of KASP genotyping.

[0040] First, specific primers were designed for amplification at 153452675 bp of wheat 2A chromosome (the reference sequence was Chinese spring wheat). The primer sequences were: GAF: 5'-TTGGTTCCTCTACGTGGACAT-3' GAR: 5'- TCATCGTCCGGCCCCAGCTGGC-3' Eight wheat varieties with GG / AA genotypes according to KASP genotyping results were randomly selected, amplified using a common PCR instrument, and sequenced after electrophoresis detection to verify the reliability of the genotyping results.

[0041] During specific PCR amplification, the 25 μL amplification system was designed as follows: 2×EasyTaq® PCR SuperMix for PAGE (+dye), 10 μL; 10 μM primers CTF / CTR, 1 μL each; DNA, 60 ng; Add ddH2O to 25 μL.

[0042] The PCR reaction program (which can be adjusted appropriately according to the amplification results) is: 94℃ for 5 min; 94℃ for 30 s, 58℃ for 30 s, 72℃ for 40 s (35 cycles); 72℃ for 10 min; end at 16℃.

[0043] The specific genotypes and wheat thousand-grain weight statistics are shown in Tables 1-3 and Figure 1-Figure 4 shown.

[0044] Table 1 Correspondence between different wheat genotypes and their thousand-grain weight

[0045] Table 2 Correspondence between different wheat genotypes and their thousand-grain weight

[0046] Table 3 Correspondence between different wheat genotypes and their thousand-grain weight

[0047] From the above experimental results, it can be seen that the average thousand-grain weight of GG genotype wheat is 33.147 g, and the average thousand-grain weight of AA genotype wheat is 39.933 g. The thousand-grain weight of AA genotype wheat is significantly higher than that of GG genotype wheat, increasing by 20.47%, with a significant difference at the p<0.01 level. In other words, the thousand-grain weight of GG genotype wheat is significantly lower than that of AA genotype wheat.

[0048] By designing primers and detecting specific loci, the high and low traits of wheat thousand-grain weight can be accurately determined, thus laying the foundation for the application of molecular breeding technology. At the same time, based on this SNP locus, technical and theoretical support can be provided for the breeding of new wheat varieties with different thousand-grain weights, which is of great significance for the breeding of high-yield wheat.

[0049] Although the present invention has been described in detail above with general descriptions and specific embodiments, it is obvious to those skilled in the art that some modifications or improvements can be made based on the present invention. Therefore, these modifications or improvements made without departing from the spirit of the present invention all fall within the scope of protection claimed by the present invention.

Claims

1. A KASP molecular marker for identifying wheat grain weight, characterized in that: The invention is a SNP molecular marker related to plant thousand-grain weight, and the molecular marker contains a nucleotide sequence of G / A polymorphism at the 153452675 bp position of wheat 2A chromosome.

2. The molecular marker according to claim 1, characterized in that The genotype of the polymorphic site contained in the molecular marker is AA, and the plant has a higher thousand-grain weight than the plant with the genotype of GG.

3. A KASP primer combination for amplifying the molecular marker according to claim 1 or 2, characterized in that: It includes a forward primer 1 as shown in SEQ ID NO: 1, a forward primer 2 as shown in SEQ ID NO: 2, and a reverse primer as shown in SEQ ID NO:

3.

4. A detection reagent or kit containing the primer combination according to claim 3.

5. A method for identifying plant thousand-grain weight, characterized in that: include: Using the DNA of the plant sample to be tested as a template, PCR amplification is performed using the KASP primer combination described in claim 3 or the detection reagent or kit described in claim 4, and the thousand-grain weight of the plant sample to be tested is determined according to the amplification result.

6. The method according to claim 5, characterized in that Based on a total system of 10 μL, the system used for PCR amplification includes: 2×KASP Mix 4-6 μL, primer mixture 0.12-0.16 μL, DNA template 25-35 ng, and the remainder is water; The primer mixture, calculated as 100 μL, includes: 100 μM forward primer 1 10-14 μL, 100 μM forward primer 2 10-14 μL, 100 μM reverse primer 28-32 μL, and the remainder is water.

7. The method according to claim 6, characterized in that The reaction program used for PCR amplification was as follows: 95°C for 8-12 min; 95°C for 15-25 s, 61°C for 60 s, for 8-12 cycles, with the annealing temperature decreasing by 0.5°C-0.7°C in each cycle; 95°C for 15-25 s, 55°C for 35-45 s, for 32-36 cycles; 25°C for 10-20 min.

8. The method according to claim 6 or 7, characterized in that: Determining the thousand-grain weight of the plant sample to be tested according to the amplification result includes: analyzing the genotype of the polymorphic site contained in the molecular marker in the amplification product, and the plant with the genotype of AA has a higher thousand-grain weight than the plant with the genotype of GG.

9. The method according to any one of claims 5 to 8, characterized in that: The plant is wheat.

10. Any of the following uses of the molecular marker according to claim 1 or 2, the KASP primer combination according to claim 3, or the detection reagent or kit according to claim 4: (1) Used for identification, breeding and improvement of wheat thousand-grain weight; (2) Used for early prediction of wheat thousand-grain weight; (3) Used in molecular marker-assisted breeding of wheat.

Images