Use of CDH1 in promoting cell production and / or release of exosomes
By stably expressing the CDH1 gene in tumor cells and using lentiviral vectors to increase the production of exosomes, the problem of insufficient number of exosomes in tumor cells was solved, and the immunotherapy and immunoregulatory effects of tumors were enhanced.
Patent Information
- Application Number
- CN202411684789.7
- Authority / Receiving Office
- CN · China
- Patent Type
- Patents(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-22
- Publication Date
- 2025-10-10
- Estimated Expiration
- 2044-11-22
AI Technical Summary
The production and release of exosomes in tumor cells are relatively small, resulting in insignificant tumor immunotherapy and immunoregulation effects.
A lentiviral vector overexpressing the CDH1 gene was constructed and transfected into tumor cells to stably express CDH1, thereby increasing the production of exosomes and promoting the production and release of exosomes by regulating the expression or activity of CDH1.
The exosome yield per unit cell and unit culture medium volume was significantly improved, enhancing the immunotherapy and immunoregulatory effects of tumors.
Smart Images

Figure HDA0005149156910000011 
Figure HDA0005149156910000012 
Figure HDA0005149156910000013
Abstract
Description
Technical Field
[0001] The present invention belongs to the field of cell engineering, and specifically relates to the use of CDH1 in promoting cell production and / or release of exosomes. More specifically, it relates to the use of the reagent in preparing a kit, the use of the reagent in preparing a drug, and a method for regulating cell production and / or release of exosomes. Background Art
[0002] Cancer is a life-threatening disease worldwide. It is the second leading cause of death globally, after cardiovascular disease. Cancer cells possess unique characteristics, including high proliferation rates, self-renewal abilities, and the ability to switch between different molecular pathways to develop drug resistance. Based on these properties, novel therapeutic approaches, including nucleic acid drugs and anticancer drugs, have been developed to target cancer cells and inhibit their progression.
[0003] Extracellular vesicles (EVs), novel structures secreted by all prokaryotic and eukaryotic cells, have important implications for cancer therapy. EVs include exosomes, microparticles, shedding vesicles, apoptotic bodies, tolerosomes, proteasomes, and protrusions. They are formed by two distinct mechanisms. In the first, EVs are directly generated from the cell membrane. In the second, EVs are generated during exocytosis of multivesicular bodies as part of the endocytic system. EVs participate in cellular biological functions and play a crucial role in pathological conditions. They can transfer a variety of molecules between cells, and therefore, their role in disease, particularly cancer, warrants special attention. Due to their excellent engineering and delivery properties, exosomes can be highly effective in tumor immunotherapy and immunomodulation. Summary of the Invention
[0004] The present invention aims to solve at least one of the technical problems existing in the prior art to a certain extent. To this end, the present invention provides the use of CDH1 in promoting cells to produce and / or release exosomes.
[0005] The present invention is accomplished based on the following findings of the inventors:
[0006] Currently, the number of exosomes produced and / or released by tumor cells is relatively small, and these small numbers of exosomes have little effect on tumor immunotherapy and immunoregulation. To overcome this problem, the inventors constructed a lentiviral vector that overexpresses the CDH1 gene and transfected it into tumor cells, ultimately generating a tumor cell line that stably expresses CDH1. This increased the expression of exosomes in tumor cells, thereby enhancing the effectiveness of tumor immunotherapy and immunoregulation.
[0007] In its first aspect, the present invention provides the use of CDH1 in promoting the production and / or release of exosomes in cells. According to embodiments of the present invention, stably expressing CDH1 in cells can increase the yield of exosomes per unit cell and per unit culture medium volume, thereby increasing the production of exosomes.
[0008] In a second aspect, the present invention provides a use of a reagent in preparing a kit. According to the use of an embodiment of the present invention, the reagent is used to regulate the expression or activity of CDH1, and the kit is used to regulate the production and / or release of exosomes in cells.
[0009] In a third aspect, the present invention provides a use of a reagent in the preparation of a medicament. According to an embodiment of the present invention, the reagent is used to promote the expression or activity of CDH1 in tumor cells, and the medicament is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.
[0010] In a fourth aspect, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises contacting cells to be treated with an agent that regulates the expression or activity of CDH1. This method, according to an embodiment of the present invention, can increase the production and / or release of exosomes by tumor cells.
[0011] Additional aspects and advantages of the present invention will be set forth in part in the description which follows and, in part, will be obvious from the description which follows, or may be learned by practice of the present invention. BRIEF DESCRIPTION OF THE DRAWINGS
[0012] The above and / or additional aspects and advantages of the present invention will become apparent and readily understood from the following description of the embodiments with reference to the accompanying drawings, in which:
[0013] Figure 1 This is a schematic diagram of the structure of the basic carrier LV3 in Example 1 of the present invention.
[0014] Figure 2 Schematic diagram of the structure of the recombinant lentiviral vector in Example 1 of the present invention.
[0015] Figure 3 This is a light microscopic image (10X) of mouse colon cancer cells in Example 2 of the present invention.
[0016] Figure 4 This is a flow cytometry fluorescence image of LV3 lentivirus 293T cells in Example 2 of the present invention.
[0017] Figure 5 Schematic diagram of the exosome extraction process in Example 3 of the present invention.
[0018] Figure 6This is the electron microscope image of CDH1 EVs in Example 3 of the present invention.
[0019] Figure 7 This is the particle size analysis of CDH1 EVs in Example 3 of the present invention.
[0020] Figure 8 This is a test of the number of exosome particles extracted in Example 3 of the present invention. A is the number of particles in the control group at a 10-fold dilution, and B is the number of particles in the CDH1 EVs group at a 20-fold dilution.
[0021] Figure 9 This is the number of particles in the Control group and CDH1 EVs group in Example 3 of the present invention.
[0022] Figure 10 This is a Western blot analysis of the expression of CDH1 protein in exosomes in Example 3 of the present invention.
[0023] Figure 11 This is a fluorescence image of two types of exosomes taken up by mouse colon cancer cells in Example 3 of the present invention.
[0024] Figure 12 The two exosomes in Example 3 of the present invention inhibit the proliferation of mouse colon cancer cells. DETAILED DESCRIPTION
[0025] The embodiments of the present invention are described in detail below. The embodiments described below are exemplary and are only used to explain the present invention, and should not be understood as limiting the present invention.
[0026] It should be noted that the terms "first" and "second" are used for descriptive purposes only and should not be understood to indicate or imply relative importance or implicitly specify the number of the technical features indicated. Therefore, features defined as "first" or "second" may explicitly or implicitly include one or more of such features. Furthermore, in the description of the present invention, unless otherwise specified, "plurality" means two or more.
[0027] In this document, the terms “contain”, “include” or “include” are open expressions, that is, they include the contents specified in the present invention but do not exclude other contents.
[0028] As used herein, the terms "optionally," "optional," or "optionally" generally mean that the subsequently described event or circumstance may but need not occur, and that the description includes instances where the event or circumstance occurs and instances where it does not.
[0029] The present invention provides the use of CDH1 in promoting cell production and / or release of exosomes, the use of the reagent in preparing a kit, the use of the reagent in preparing a drug, and a method for regulating cell production and / or release of exosomes, each of which is described in detail below.
[0030] Use of CDH1 in promoting cell production and / or release of exosomes
[0031] In its first aspect, the present invention provides the use of CDH1 in promoting the production and / or release of exosomes in cells. According to embodiments of the present invention, stably expressing CDH1 in cells can increase the yield of exosomes per unit cell and per unit culture medium volume, thereby increasing the production of exosomes.
[0032] According to an embodiment of the present invention, the nucleotide sequence of CDH1 is as shown in SEQ ID NO: 1 or a nucleotide sequence obtained by deleting, replacing, inserting, inverting or misplacing one or more bases in the sequence shown in SEQ ID NO: 1.
[0033] Atgggagcccggtgccgcagcttttccgcgctcctgctcctgctgcaggtctcctcatggctttgccaggagctggagcctgagtcctgcagtcccggcttcagttccgaggtctacaccttcccggtgccggagaggcacctggagagaggccatgtcctgggcagagtgagatttgaaggatgcactggccggccaaggacagccttcttttcggaagactcccgattcaaagtggcgacagacggcaccatcacagtgaagcggcatctaaagctccacaagctggagaccagtttcctcgtccgcgcccgggactccagtcatagggagctgtctaccaaagtgacgctgaagtccatggggcaccaccatcaccggcaccaccaccgcgaccctgcctctgaatccaacccagagctgctcatgtttcccagcgtgtacccaggtctcagaagacagaaacgagactgggtcatccctcccatcagctgccccgaaaatgaaaagggcgaatttccaaagaacctggttcagatcaaatccaacagggacaaagaaacaaaggttttctacagcatcaccggccaaggagctgacaaaccccccgttggcgttttcatcattgagagggagacaggctggctgaaagtgacacagcctctggatagagaagccattgccaagtacatcctctattctcatgccgtgtcatcaaatgggga (SEQ ID NO: 1).
[0034] According to embodiments of the application, the cell is a tumor cell.
[0035] Use of an agent in the manufacture of a kit
[0036] In a second aspect of the application, the present application provides use of an agent in the manufacture of a kit. According to embodiments of the application, the agent is for modulating expression or activity of CDH1, and the kit is for modulating production and / or release of exosomes in a cell.
[0037] According to an embodiment of the present invention, the reagent is used to promote the expression or activity of CDH1, and the kit is used to promote the production and / or release of exosomes in cells.
[0038] According to an embodiment of the present invention, the reagent includes at least one of a viral vector, a virus, and a bioactive factor for overexpressing CDH1. According to an embodiment of the present invention, the reagent further includes, but is not limited to, gene transfection, signal pathway regulation, and optimized cell culture conditions to promote CDH1 expression.
[0039] According to an embodiment of the present invention, the bioactive factor includes β-hydroxybutyrate.
[0040] According to an embodiment of the present invention, the reagent is used to inhibit the expression or activity of CDH1, and the kit is used to inhibit the production and / or release of exosomes in cells.
[0041] According to an embodiment of the present invention, the reagent includes siRNA for inhibiting CDH1 expression.
[0042] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO: 2.
[0043] CACTGCCAACTGGCTGGAGATTA (SEQ ID NO: 2).
[0044] Use of reagents in the preparation of drugs
[0045] In a third aspect, the present invention provides a use of a reagent in the preparation of a medicament. According to an embodiment of the present invention, the reagent is used to promote the expression or activity of CDH1 in tumor cells, and the medicament is used to treat or prevent cancer or to increase the immune killing effect on tumor cells.
[0046] According to an embodiment of the present invention, the reagent includes at least one of a viral vector, a virus, and a bioactive factor for overexpressing CDH1. According to an embodiment of the present invention, the reagent further includes, but is not limited to, gene transfection, signal pathway regulation, and optimized cell culture conditions to promote CDH1 expression.
[0047] According to an embodiment of the present invention, the bioactive factor includes β-hydroxybutyrate.
[0048] Methods for regulating cell production and / or release of exosomes
[0049] In a fourth aspect, the present invention provides a method for regulating the production and / or release of exosomes by cells. According to an embodiment of the present invention, the method comprises: contacting cells to be treated with an agent that regulates the expression or activity of CDH1. The method according to an embodiment of the present invention can increase the yield of exosomes produced and / or released by cells.
[0050] According to an embodiment of the present invention, the cells are tumor cells.
[0051] According to an embodiment of the present invention, the reagent is used to promote the expression or activity of CDH1, and the reagent includes at least one of a viral vector, a virus, and a bioactive factor for overexpressing CDH1. According to an embodiment of the present invention, the reagent further includes, but is not limited to, gene transfection, signal pathway regulation, and cell culture condition optimization to promote CDH1 expression.
[0052] According to an embodiment of the present invention, the bioactive factor includes β-hydroxybutyrate.
[0053] According to an embodiment of the present invention, the reagent is used to inhibit the expression or activity of CDH1, and the reagent includes siRNA for inhibiting the expression of CDH1.
[0054] According to an embodiment of the present invention, the nucleotide sequence of the target site targeted by the siRNA is shown in SEQ ID NO: 2.
[0055] According to an embodiment of the present invention, the culture medium used for culturing the cells is serum-free 1640 culture medium.
[0056] According to an embodiment of the present invention, the method for producing and / or releasing exosomes is as follows: selecting P3 generation logarithmic growth phase mouse colon cancer cells transfected with a recombinant lentiviral vector, and when the cells grow to 70%-80%, continuing to culture in serum-free 1640 medium, ultracentrifuging, and obtaining exosomes.
[0057] The present invention uses the LV3 vector as a base vector to construct a lentiviral vector overexpressing the CDH1 gene. This vector was then transfected into tumor cells to obtain a cell line stably expressing CDH1. Exosome extraction and testing revealed that this cell line significantly increased the exosome yield per unit cell and per unit culture medium volume, resulting in increased exosome production. Furthermore, the present invention utilizes a lentiviral-mediated GFP tag to purify and isolate exosomes, addressing some of the shortcomings of traditional methods and advancing the research and clinical development of tumor cell exosomes.
[0058] tumor cells
[0059] In a fifth aspect, the present invention provides a tumor cell. According to an embodiment of the present invention, the tumor cell overexpresses CDH1. The tumor cell according to the embodiment of the present invention can increase the production of exosomes.
[0060] Among them, it needs to be explained that the CDH1 (E-cadherin) gene is a tumor suppressor gene located on chromosome 16 (16q22.1). As an adhesion molecule and calcium-dependent, its expression status is related to the differentiation and invasion capabilities of various tumors. The loss of expression of this gene will lead to a stronger proliferation ability of tumor cells, an expansion of the gap between cells, easier shedding, and a stronger ability of epithelial-mesenchymal transition (EMT). In normal cells, E-cadherin mainly exerts its tumor-suppressing effect by binding to E-cadherim and separating it from LEF (lymphoid enhancer factor) / TCF (T cell factor) with the function of proliferating WNT signaling pathway transcription genes. In addition, the loss of the CDH1 gene will bring higher cell viability to A549 cells, that is, the metastasis and invasion capabilities of lung adenocarcinoma cells will be enhanced.
[0061] According to an embodiment of the present invention, the tumor cell is at least one of a colon cancer cell, a breast cancer cell, a luminal B breast malignant tumor cell, and a melanoma cell.
[0062] According to an embodiment of the present invention, the tumor cells are at least one of mouse colon cancer cells, mouse breast cancer cells, and mouse luminal B-type breast malignant tumor cells.
[0063] According to an embodiment of the present invention, the tumor cells are mouse colon cancer cells.
[0064] According to an embodiment of the present invention, the mouse colon cancer cells overexpressing CDH1 are prepared by the following method: constructing a recombinant lentivirus overexpressing CDH1 and transfecting the mouse colon cancer cells.
[0065] Specifically, the tumor cells overexpressing the CDH1 gene of the present invention are prepared by the following method:
[0066] Using the pLV3 vector as the base vector, a recombinant plasmid pLV3-CDH1 that overexpresses the CDH1 gene was constructed and transfected into the 293T cell line to package the recombinant lentivirus, named LV3-CDH1. The recombinant lentivirus LV3-CDH1 was transfected into tumor cells to obtain a tumor cell line that stably expressed CDH1.
[0067] The present invention also provides a method for preparing the above-mentioned tumor cells overexpressing the CDH1 gene, which is prepared by the following method:
[0068] Using the pLV3 vector as the base vector, a recombinant plasmid pLV3-CDH1 that overexpresses the CDH1 gene was constructed and transfected into the 293T cell line to package the recombinant lentivirus, named LV3-CDH1. The recombinant lentivirus LV3-CDH1 was transfected into tumor cells to obtain a cell line stably expressing CDH1.
[0069] According to an embodiment of the present invention, the CDH1 gene is the nucleotide sequence shown in SEQ ID NO: 1, or a nucleotide sequence obtained by deleting, replacing, inserting, inverting or misplacing one or more bases of the sequence shown in SEQ ID NO: 1.
[0070] According to an embodiment of the present invention, the lentivirus is LV3.
[0071] In the present invention, a recombinant lentivirus overexpressing the CDH1 gene is constructed, named pLV3-CDH1, and is transfected into tumor cells to screen and obtain tumor cell lines that highly express CDH1.
[0072] The present invention uses the pLV3 vector as a base vector to construct a recombinant plasmid overexpressing the CDH1 gene, pLV3-CDH1. This plasmid was then transfected into a 293T cell line to produce a recombinant lentivirus, named LV3-CDH1. The recombinant lentivirus LV3-CDH1 was then transfected into tumor cells to generate a cell line stably expressing CDH1. Testing of this cell line demonstrated a significant increase in the exosome yield per unit cell volume and per unit culture medium volume, significantly improving exosome production.
[0073] According to an embodiment of the present invention, the CDH1 overexpression is achieved by at least one of the following methods: viral / non-viral vector-mediated gene / mRNA transfection technology, transposase- or recombinase-mediated gene integration, and CRISPR / CAS system-based gene editing or transcriptional activation.
[0074] According to an embodiment of the present invention, the gene / mRNA transfection technology is achieved by utilizing at least one of the following methods: liposome or LNP-mediated transfection, calcium phosphate-mediated transfection, cationic transfection reagent-mediated transfection, virus-like particle VLP-mediated transfection, electroporation transfection, lentiviral vector gene delivery, adeno-associated virus vector gene delivery, adenoviral vector gene delivery and Sendai virus vector gene delivery.
[0075] Below, the scheme of the present invention will be explained in conjunction with embodiment.It will be understood by those skilled in the art that the following examples are only used to illustrate the present invention and should not be regarded as limiting the scope of the present invention.In the embodiment, if specific technology or conditions are not indicated, the technology or conditions described in the literature in this area or the product instructions are used.The reagents or instruments used are not indicated by the manufacturer, and are all conventional products that can be obtained by commercial purchase.
[0076] Example 1: Construction of CDH1 Lentivirus
[0077] According to the CDH1 gene sequence information (Gene ID: 999), the CDH1 gene shown in SEQ ID NO: 1 was cloned and the Figure 1 The pLV3 shown was used as the basic vector to construct the recombinant vector pLV3-CDH1 containing the CDH1 gene, and the recombinant vector pLV3-CDH1 was packaged by transfecting 293T cell lines to produce Figure 2 LV3-CDH1 lentivirus as indicated.
[0078] Example 2: CDH1 stably expressing tumor cells
[0079] The lentivirus LV3-CDH1 constructed in Example 1 was transfected into mouse colon cancer cells (Wuhan Pronocell Life Science Co., Ltd., catalog number: CL-0071) (virus infection multiplicity MOI value: 20-100) to obtain tumor cells overexpressing the CDH1 gene. The cells were cultured in 1640 medium and their growth and CDH1 expression were observed. The results are as follows: Figure 3 and Figure 4 As shown, the results show that the cell viability of the cultured cells in the present invention is as high as over 90%, and the CDH1 fluorescence expression is normal when detected by flow cytometry.
[0080] Example 3: Extraction and identification of tumor cell-derived exosomes
[0081] (1) Extraction of exosomes from tumor cells:
[0082] P3 generation overexpressing tumor cells (Control group) and CDH1 overexpressing tumor cells constructed in Example 2 (CDH1 EVs group) were selected for culture and exosome extraction.
[0083] The specific method is as follows: When the cell confluence reaches 70%-80%, wash the cells with PBS, select serum-free 1640 medium for 48 hours, and then extract exosomes by ultracentrifugation. Take 100mL of cell culture medium and centrifuge it at 1000g for 10 minutes to remove cell debris, then centrifuge it at 10000g for 30 minutes to remove apoptotic bodies, then collect all the supernatants through a 0.22μm filter membrane, and finally centrifuge it at 100000g for 70 minutes to discard the supernatant, resuspend the precipitate with 1mL PBS, and then centrifuge it at 100000g for 70 minutes to discard the supernatant, resuspend the PBS to obtain exosomes, and store them at -80℃ after aliquoting. The process diagram is as follows Figure 5 shown.
[0084] (2) Electron microscopy detection of tumor cell-derived exosomes:
[0085] The extracted exosomes were resuspended in 20-30 μL PBS, 10 μm was added to the transmission electron microscope copper grid and precipitated for 5 minutes, the floating liquid was aspirated with filter paper, 10 μm of phosphotungstic acid counterstain was added to the transmission electron microscope copper grid and precipitated for 5 minutes, the floating liquid was aspirated with filter paper, and the mixture was dried at room temperature and observed by the microscope. Figure 6 shown.
[0086] Figure 6 The electron microscopy image shows that the size of exosomes is about 50-150nm, and the exosomes are spherical in shape, indicating that there is no difference between the overexpressed CDH1 exosomes and the conventional group, which is consistent with the structure of exosomes.
[0087] (3) Particle size analysis of tumor cell-derived exosomes:
[0088] The extracted exosomes were resuspended in 2 mL of PBS and placed in a Nano ZS90 Plus (Malvern, UK) for exosome size analysis. Figure 7 As shown, the particle size of exosomes detected is between 100-150nm, which corresponds to the size of exosomes detected by TEM and is consistent with the particle size range of exosomes.
[0089] (4) Detection of the number of exosome particles derived from tumor cells:
[0090] The extracted exosomes were resuspended in 2 mL of PBS and diluted 10-fold and 20-fold for the control and CDH1 EVs groups, respectively, for nanoflow cytometry testing. The test showed that the particle count of the control group at a 10-fold dilution was 2.28E+9 particles / mL; the particle count of the CDH1 EVs group at a 20-fold dilution could reach 3.34E+9 particles / mL. Figure 8 、 Figure 9The results showed that the number of exosome particles extracted from tumor cells in the CDH1 EVs group was significantly higher than that in the Control group.
[0091] (5) Western blot detection of tumor cell-derived exosomes:
[0092] Add protein lysis buffer to the extracted exosome precipitate and place on ice for 10-20 minutes, shaking 4-6 times for 20-30 seconds each time. Then centrifuge at 4°C and 11000 rpm for 3-5 minutes. Transfer the supernatant to a new centrifuge tube and perform Western blot to detect CDH1 protein expression. The results are as follows: Figure 10 The results showed that the expression of CDH1 protein could be detected in the CDH1 EVs group extracted by ultracentrifugation.
[0093] (6) Cellular uptake of exosomes:
[0094] Prepare the exosome fluorescent material Dil (Biyuntian Biotechnology Co., Ltd., catalog number: C1036) and mix it with the exosomes extracted above, so that the exosomes are connected with the dye, then wash away the excess dye, add a small amount of exosomes containing Dil fluorescent dye to the cultured tumor cells, continue to culture for 1-4 hours, aspirate the supernatant and wash 2-3 times with PBS, and detect under an inverted fluorescence microscope. The results are as follows Figure 11 As shown, obvious red fluorescence signals of Dil can be observed in the exosomes overexpressing CDH1 compared with the control group.
[0095] (7) Effects of exosomes on tumor cell proliferation:
[0096] Control and CDH1 EVs were used to culture mouse colon cancer cells, and the proliferation of mouse colon cancer cells was detected by CCK8 (Biyuntian Biotechnology Co., Ltd., C0037). The results are as follows Figure 12 The results showed that CDH1 EVs had an inhibitory effect on cancer cells. After 96 hours of co-culture, the survival rate of cancer cells in the CDH1 EVs group was only about 70%.
[0097] In the description of this specification, the reference terms "one embodiment", "some embodiments", "example", "specific example", or "some examples" mean that the specific features, structures, materials or characteristics described in conjunction with the embodiment or example are included in at least one embodiment or example of the present invention. In this specification, the schematic representations of the above terms do not necessarily refer to the same embodiment or example. Moreover, the specific features, structures, materials or characteristics described can be combined in any one or more embodiments or examples in a suitable manner. In addition, those skilled in the art can combine and combine different embodiments or examples described in this specification and features of different embodiments or examples without contradiction.
[0098] Although the embodiments of the present invention have been shown and described above, it will be understood that the above embodiments are illustrative and are not to be construed as limitations on the present invention. A person skilled in the art may change, modify, replace and modify the above embodiments within the scope of the present invention.
Claims
1. The use of the CDH1 gene in promoting the release of exosomes from tumor cells; The tumor cells are mouse colon cancer cells.
2. The use according to claim 1, characterized in that The nucleotide sequence of the CDH1 gene is shown in SEQ ID NO:
1.
3. Use of a reagent in preparing a kit for regulating the expression or activity of the CDH1 gene, wherein the kit is used to promote the release of exosomes in tumor cells; the reagent includes a viral vector for overexpressing the CDH1 gene; and the tumor cells are mouse colon cancer cells.
4. A method for regulating the release of exosomes from tumor cells, characterized in that: include: contacting the tumor cells to be treated with a reagent, wherein the reagent is used to promote the expression or activity of the CDH1 gene in the tumor cells; The tumor cells are mouse colon cancer cells; and the reagents include a viral vector that overexpresses the CDH1 gene.
Citation Information
Patent Citations
Vector composition for indicating active state of Wnt signal in cell by using BiFC (Bimolecular Fluorescence Complementation) and application of vector composition
CN104004098A
Novel exosome release related target and application thereof to monitoring and inhibiting of tumors
CN112522394A