Rice arbuscular mycorrhiza symbiosis specifically induced nuclear factor YC subunit gene and application thereof

Abstract

The invention discloses a rice arbuscular mycorrhiza specifically induced nuclear factor YC subunit gene and application thereof. The nucleotide sequence of the rice nuclear factor YC subunit gene OsNF-YC3 is as shown in SEQ ID NO. 1. The amino acid sequence of the protein OsNF-YC3 coded by the gene OsNF-YC3 is as shown in SEQ ID NO. 2. The rice nitrate transporter gene OsNF-YC3 is applied to promotion of interaction of plants and arbuscular mycorrhizal fungi and improvement of phosphorus absorption in the symbiotic process of the plants.

Description

Technical Field

[0001] The invention belongs to the field of agricultural bioengineering and relates to a rice arbuscular mycorrhizal symbiosis-specific induced nuclear factor YC subunit gene and application thereof. Background Art

[0002] Arbuscular mycorrhizal symbiosis is a very common mutualistic relationship between the roots of terrestrial plants and arbuscular mycorrhizal fungi in the phylum Glomeromycota in the soil. Except for a few plants such as the Cruciferae family that cannot establish mycorrhizal symbiosis, the roots of more than 80% of terrestrial plants can establish connections with mycorrhizal fungi in the soil to form mycorrhizae, a special symbiotic organ (van der Heijden et al., 2015; Tedersoo et al., 2020). In this widespread symbiotic relationship, the extraradical hyphae of mycorrhizal fungi can help plant roots obtain a variety of nutrients such as nitrogen, phosphorus, potassium and sulfur from farther soil; in return, plants provide mycorrhizal fungi with organic carbon fixed by photosynthesis as a carbon source required to support their life activities (Luginbuehl et al., 2017; Wang et al., 2017). Not only that, mycorrhizal plants have stronger stress resistance, which enables them to adapt to the complex and diverse environmental changes on the earth (Tedersoo et al., 2020; Shi et al., 2023).

[0003] The establishment of mycorrhizal symbiosis is a complex physiological process. In recent years, more and more transcription factors have been reported to coordinate with each other in the establishment of mycorrhizal symbiosis and the bidirectional nutrient transport between plants and mycorrhizal fungi, forming a cascade regulatory network to jointly regulate the symbiotic process. NF-Y (nuclear factor Y) family proteins are a class of nuclear factors widely present in eukaryotic cells. They usually interact with three subunits (NF-YA, NF-YB and NF-YC) to form heterotrimers to perform functions in cells. There are 11 NF-YA subunits, 13 NF-YB subunits and 16 NF-YC subunits in rice. In recent years, the biological functions of multiple rice NF-Y genes have been gradually analyzed. These genes are involved in regulating various physiological activities of rice in response to biotic and abiotic stresses, heading time and rice quality. However, the relationship between rice NF-Y family members and mycorrhizal symbiosis is still unclear.

[0004] The present invention identifies the first nuclear factor YC subunit gene OsNF-YC3 in monocotyledonous plants that is specifically induced to express by arbuscular mycorrhizae from rice, studies its relationship with mycorrhizal symbiosis, proposes an important process of using the OsNF-YC3 gene to improve the interaction between plants and beneficial microbial arbuscular mycorrhizal fungi, and a method for improving the absorption and utilization efficiency of rice phosphorus during the symbiotic process between plants and microorganisms. Summary of the invention

[0005] The invention aims to provide a rice nuclear factor YC subunit gene.

[0006] Another object of the present invention is to provide a protein encoded by the gene.

[0007] Another object of the present invention is to provide application of the gene.

[0008] The purpose of the present invention can be achieved through the following technical solutions:

[0009] A rice nuclear factor YC subunit gene OsNF-YC3, the nucleotide sequence of which is shown in SEQ ID NO.1.

[0010] The amino acid sequence of the protein OsNF-YC3 encoded by the gene OsNF-YC3 is shown in SEQ ID NO.2.

[0011] A recombinant expression vector containing the rice nuclear factor YC subunit gene OsNF-YC3.

[0012] The rice nuclear factor YC subunit gene OsNF-YC3 is used to improve the colonization efficiency of arbuscular mycorrhizal fungi in plant roots and promote the absorption of phosphorus by plants through mycorrhizal symbiosis.

[0013] The application of the rice nuclear factor YC subunit gene OsNF-YC3 in rice variety improvement.

[0014] The recombinant expression vector is used to improve the colonization efficiency of arbuscular mycorrhizal fungi in plant roots and promote the absorption of phosphorus by plants through mycorrhizal symbiosis.

[0015] The application of the recombinant expression vector in rice variety improvement.

[0016] Beneficial Effects

[0017] 1. The present invention discloses a rice mycorrhizal-specific induced nuclear factor YC subunit gene (OsNF-YC3 gene) and the protein encoded by it. The gene is from rice (Oryza sativa L.) and can be introduced into plants as a target gene to improve the colonization efficiency of arbuscular mycorrhizal fungi in plant roots and promote the absorption of phosphorus by plants through mycorrhizal symbiosis, so as to improve plant varieties. The encoded protein has the function of promoting the colonization of mycorrhizal fungi in plant roots and improving the absorption and utilization efficiency of phosphorus by plants. ( Figure 7 ; Figure 8 )

[0018] 2. The function of the OsNF-YC3 gene provided by the inventors is to promote the interaction between plants and beneficial microorganisms, arbuscular mycorrhizal fungi, and improve the efficiency of phosphorus absorption and utilization by rice through the mycorrhizal symbiotic pathway. Transcriptional level analysis showed that the OsNF-YC3 gene was specifically induced by arbuscular mycorrhizae and was specifically expressed only in cells containing arbuscules.

[0019] 3. The OsNF-YC3 gene of the present invention is derived from rice and has optimized codons suitable for expression in monocotyledonous plants such as rice. Its genetically engineered recipient plants are more suitable for monocotyledonous plants such as rice, sorghum, and corn in addition to dicotyledonous plants such as tobacco, soybean, and tomato.

[0020] 4. Use the OsNF-YC3 gene of the present invention as the target gene to construct a plant expression vector, wherein any promoter such as CaMV35s promoter, Ubiquitin promoter, self promoter or other mycorrhizal specific promoters in rice such as OsPT11 promoter can be used, and the expression vector can include an enhancer when necessary, whether it is a transcription enhancer or a translation enhancer. In order to simplify the identification of transformed cells, selective markers including enzymes for antibiotic resistance (such as mycin phosphotransferase) can be used, and enzymes for compounds that can be identified by color change (such as β-glucuronidase) or luminescence (such as green fluorescent protein) can also be used. Marker-free selection can also be used. The expression vector used can use Ti plasmids, Ri plasmids, plant virus vectors, etc. Agrobacterium-mediated method, gene gun method, pollen tube channel method or other methods can be used to transform into plants. BRIEF DESCRIPTION OF THE DRAWINGS

[0021] Figure 1 .Structure of rice nuclear factor YC subunit gene OsNF-YC3

[0022] Black boxes represent exons, and white boxes represent transcribed untranslated regions.

[0023] Figure 2 .Evolutionary analysis of nuclear factor YC subunits in different species

[0024] Figure 3 . Analysis of amino acid sequence conservation of NF-YC3 subunits in different species

[0025] Figure 4 Analysis of OsNF-YC3 expression pattern

[0026] NM: tissue not inoculated with mycorrhizal fungi; AM: tissue inoculated with mycorrhizal fungi; Stem: stem; Leafblade: leaf; Leafsheath: leaf sheath; Root: root.

[0027] Figure 5 .pTCK303::FlAG vector map

[0028] Figure 6 .RT-qPCR identification of OsNF-YC3 overexpression lines

[0029] WT: wild type; OxOsNF-YC3-1, -2: OsNF-YC3 overexpression lines.

[0030] Figure 7 .Overexpression of rice nuclear factor YC subunit gene OsNF-YC3 improves the colonization efficiency of mycorrhizal fungi in roots

[0031] WT: wild type; OxOsNF-YC3-1, -2: OsNF-YC3 overexpression lines.

[0032] H: hyphae infection rate; A: arbuscular infection rate; V: vesicle infection rate; T: total infection rate. The values ​​shown are mean ± SE (n = 4). Asterisks indicate significant differences (two-sided Student's T test: ns P>0.05; *P<0.05; **P<0.01; ***P<0.001).

[0033] Figure 8 .Overexpression of rice nuclear factor YC subunit gene OsNF-YC3 promotes rice's absorption of phosphorus WT: wild type; OxOsNF-YC3-1, -2: OsNF-YC3 overexpression lines.

[0034] Values ​​shown are mean ± SE (n = 4); asterisks indicate significant differences (two-sided Student's T test: **P < 0.01; ***P < 0.001). DETAILED DESCRIPTION

[0035] Example 1

[0036] Molecular cloning of the nuclear factor YC subunit gene OsNF-YC3 specifically induced by rice mycorrhizal symbiosis

[0037] Select the "Nipponbare" rice seeds with full grains, disinfect them with 70% ethanol for 2 minutes, soak them again with 30% NaClO for 30 minutes, wash the disinfected seeds with sterile water and place them in MS culture medium, and culture them in a tissue culture room with 14 hours of light, 10 hours of darkness and a constant temperature of 30°C for 5-7 days. After two days of hardening, the sterile seedlings were transferred to the rice IRRI nutrient solution for 2-3 days. Eight seedlings with consistent growth were selected and planted in a sterile matrix containing 4L of sand and stone mixture (the ratio of sand to quartz sand was 2:1). Every two seedlings were planted in a hole and inoculated with arbuscular mycorrhizal fungi containing about 500 R.irregularis spores, and low-phosphorus (30μM) nutrient solution was irrigated once a week. After six weeks, 0.1g of rice roots inoculated with mycorrhizal fungi were taken to extract RNA, and cDNA was obtained by reverse transcription. Using the cDNA of rice roots after inoculation as a template, the DNA fragment of rice nuclear factor YC subunit gene OsNF-YC3 was cloned by PCR using OsNF-YC3 F / OsNF-YC3 R as primers, and the gene sequence of OsNF-YC3 was obtained by sequencing. Sequence analysis showed that the gene does not contain introns, and the coding region consists of 378 base pairs ( Figure 1 ).

[0038] OsNF-YC3 F:ATGAGGCAGGCGAGGCCCTACT

[0039] OsNF-YC3 R:TTACTTATAGTCCGTATGATCGTCG

[0040] In order to determine whether the newly cloned gene encodes a nuclear factor C subunit, we searched for all nuclear factor YC subunits in rice on the plant transcription factor website (https: / / planttfdb.gao-lab.org / ), and found through comparison that the gene was the gene OsNF-YC3 encoding a nuclear factor C subunit in rice. The rice nuclear factor YC subunit gene OsNF-YC3 of the present invention is the first report in rice, and it is also the first NF-Y subunit related to arbuscular mycorrhizal symbiosis found in monocots, and is expected to be used to improve the symbiotic efficiency between plants and arbuscular mycorrhizal fungi and the absorption and utilization of phosphorus by plants.

[0041] Example 2

[0042] Sequence information and characterization analysis of OsNF-YC3

[0043] The OsNF-YC3 of the present invention is located on chromosome 4 of the rice Nipponbare genome, and the coding region consists of 378 base pairs, with a 197bp 5'UTR (transcription non-translation region) before the start codon, a 118bp 3'UTR after the stop codon, only one exon, and no intron. The analysis results of the Expasy website show that OsNF-YC3 encodes 125 amino acids, and the encoded nuclear factor protein is about 13221.04Da in size and has an isoelectric point of 8.85. According to the prediction of the UniProt website, the rice nuclear factor OsNF-YC3 protein has a transcription factor CBF / NF-Y / archaeal histone domain at the 24th-96th amino acid position, which meets the protein characteristics of the NF-YC subunit. Evolutionary analysis revealed that the nucleotide sequence of OsNF-YC3 protein is highly conserved with alfalfa MtNF-YC6 and MtNF-YC11, Lotus japonicus LjNF-YC3, tomato SlNF-YC3 and sorghum SbNF-YC3 nucleotides, and is in the same evolutionary branch, while the non-mycorrhizal plant Arabidopsis has no NF-YC subunit homologous to rice OsNF-YC3. This indicates that the OsNF-YC3 gene is highly conserved in mycorrhizal plants ( Figure 2 , Figure 3 ).

[0044] Example 3

[0045] Expression study of OsNF-YC3

[0046] Primers were designed using the sequences in Example 1, and the housekeeping gene OsActin (LOC4333919) in rice was used as an internal reference. The relative expression level of OsNF-YC3 was quantitatively detected in rice roots, leaves, leaf sheaths, and stems inoculated with mycorrhizal fungi. The results showed that OsNF-YC3 was expressed at a very low level in rice leaves, leaf sheaths, stems, and roots not inoculated with mycorrhizal fungi, but was specifically and strongly induced to express only in rice roots inoculated with arbuscular mycorrhizal fungi, and its expression level was upregulated by nearly 100 times compared with the control. (Appendix Figure 4 )

[0047] The primers used for quantitative RT-qPCR are as follows:

[0048] OsActin QF:CAACACCCCTGCTATGTACG

[0049] OsActin QR:CATCACCAGAGTCCAACACAA

[0050] OsNF-YC3 QF:AGGCGTGCGAGCTGTTCATC

[0051] OsNF-YC3 QR:CGCCGAGGTCTGCCGTGA

[0052] Example 4

[0053] Obtaining sense and antisense OsNF-YC3 transgenic rice plants

[0054] According to the full-length coding sequence of OsNF-YC3 obtained in Example 1, the amplified product obtained in Example 1 was used as a template to design primers to amplify the OsNF-YC3 gene fragment, and vector restriction site sequences were introduced into the 5' and 3' ends thereof, respectively.

[0055] OxOsNF-YC3 F:TTCTGCAGGTCGACTCTAGA GGATCC ATGAGGCAGGCGAGG CCCTA (the underlined sequence is the restriction site; the italicized sequence is the homology arm)

[0056] OxOsNF-YC3 R:TCATGGTCTTTGTAGTCCAT ACTAGT CTTATAGTCCGTATGAT CGT (the underlined sequence is the restriction site; the italic sequence is the homology arm)

[0057] The amplified product was inserted into the cloning vector pEASY-Blunt (Full Gold). In order to insert the CDS of OsNF-YC3 into the overexpression vector and use it for subsequent research, we first modified the overexpression vector based on pTCK303, that is, the pTCK303 vector was linearized using restriction endonucleases SpeⅠ and SacⅠ, and the DNA fragment encoding 3×Flag was inserted between these two restriction sites. The modified vector was renamed pTCK303::FLAG ( Figure 5 ). Subsequently, we further recombined the coding sequence of OsNF-YC3 into the binary expression vector pTCK303::FLAG. The recombinant plasmid verified to be correct by sequencing was introduced into Agrobacterium tumefaciens EHA105 and then transformed into Nipponbare rice through genetic transformation experiments. GUS staining and RT-qPCR were used to verify the positive transgenic plants and the overexpression effect of OsNF-YC3 ( Figure 6 The stable genetic materials obtained through seed breeding were inoculated with mycorrhizal fungi to detect the mycorrhizal colonization efficiency in their roots and the phosphorus content in the aboveground parts. The results showed that the total infection rate, arbuscular abundance, and hyphae infection rate of transgenic rice roots were significantly higher than those of wild-type rice, and the phosphorus content in the aboveground parts of transgenic plants was significantly higher than that of wild-type plants ( Figure 7 ; Figure 8 ).

[0058] 3×Flag:

[0059] ATGGACTACAAAGACCATGACGGTGATTATAAAGATCATGATATCGATTACAAGGATGACGATGACAAGTGA(SEQ ID NO.3)

[0060] In order to further study the function of OsNF-YC3 in the symbiosis between plants and mycorrhizal fungi, we used CRISPR-Cas9 technology to create Osnf-yc3 mutant materials based on the method of Miao et al. (Miao et al., 2013): First, two specific target sites were designed on the OsNF-YC3 exon, and after gradient annealing, they were inserted into the middle of the two Bsa I restriction sites of the pOs-sgRNA intermediate vector by enzyme digestion and enzyme ligation. Subsequently, the two spacers were recombined together with sgRNA and U3 promoter into the expression vector pH-Ubi-Cas9-7 by gateway recombination technology. The recombinant plasmid verified to be correct by sequencing was introduced into Agrobacterium tumefaciens EHA105 and transferred into Nipponbare rice through genetic transformation experiments. The OsNF-YC3 fragment of the transgenic strain was amplified by PCR and its mutation effect was determined after sequencing. When Osnf-yc3 mutant transgenic plants were inoculated with arbuscular mycorrhizal fungi, the colonization efficiency of mycorrhizal fungi in the roots of the mutants decreased sharply, the abundance of arbuscules was significantly reduced, the development of arbuscules was impaired, and the aboveground biomass and phosphorus content of the plants were significantly lower than those of wild-type rice.

[0061] Spacer1 F:GGCAGAGGCAGGCGAGGCCCTACT,

[0062] Spacer1 R:AAACAGTAGGGCCTCGCCTGCCTC,

[0063] Spacer2 F:GGCAATCTTCTTGATGCGAGCCAG,

[0064] Spacer2 R:AAACCTGGCTCGCATCAAGAAGAT,

[0065] Osnf-yc3 F:ATGGCCGCGTATAAATATCCA,

[0066] Osnf-yc3 R:TCGAAGAGATCGGTGTTCTGC.

[0067] The above examples show that the rice mycorrhizal-specific induced nuclear factor YC subunit gene OsNF-YC3 cloned in the present invention is the first mycorrhizal-induced nuclear factor NF-YC subunit gene cloned in rice. The function of such genes in the symbiotic process between monocotyledonous plants and beneficial microbial mycorrhizal fungi has not been described so far. Examples 3 and 4 show that the gene is related to the colonization process and arbuscular development of mycorrhizal fungi in the rice root system, and affects the absorption of phosphorus by rice through the symbiotic pathway. This gene is more suitable for genetic improvement of stress resistance (nutrient stress) of multiple food crops such as rice, sorghum, corn and soybeans due to its significant and specific induction by arbuscular mycorrhizal fungi.

[0068] The inventors cloned a cDNA from the monocot rice (Oryza sativa L.), which encodes the nuclear factor YC subunit and is named OsNF-YC3. Transcriptional expression analysis shows that OsNF-YC3 is specifically and strongly induced to express only in the rice root system inoculated with arbuscular mycorrhizal fungi, while the expression level in rice leaves, leaf sheaths, stems and roots not inoculated with mycorrhizal fungi is very low. Transgenic studies have shown that when the OsNF-YC3 gene is transferred into rice, the total infection rate, arbuscular abundance and hyphae infection rate of transgenic rice mycorrhizal fungi are significantly improved, and the phosphorus content of the aboveground part of the transgenic plants is significantly higher than that of the wild type. When the Osnf-yc3 mutant transgenic plants are inoculated with arbuscular mycorrhizal fungi, compared with the wild type, the colonization efficiency of mycorrhizal fungi in the mutant root system is sharply reduced, the arbuscular abundance is significantly reduced, the arbuscular development is impaired, and the aboveground biomass and phosphorus content of the plants are significantly lower than those of the wild type rice. In the method of the present invention, the OsNF-YC3 gene can be used as the target gene to construct a plant expression vector, wherein any promoter such as CaMV35s promoter, Ubiquitin promoter, self promoter or other mycorrhizal specific promoters in rice such as OsPT11 promoter can be used, and the expression vector can include an enhancer when necessary, whether it is a transcription enhancer or a translation enhancer. In order to simplify the identification of transformed cells, selective markers including enzymes resistant to antibiotics (such as mycin phosphotransferase) can be used, and enzymes of compounds that can be identified by color change (such as β-glucuronidase) or luminescence (such as green fluorescent protein) can also be used. Marker-free selection can also be used. The expression vector used can use Ti plasmids, Ri plasmids, plant virus vectors, etc. Agrobacterium-mediated method, gene gun method, pollen tube channel method or other methods can be used to transform into plants.

Claims

1. A rice nuclear factor YC subunit gene OsNF-YC3, characterized in that The nucleotide sequence is shown in SEQ ID NO.

1.

2. The protein OsNF-YC3 encoded by the gene OsNF-YC3 according to claim 1, characterized in that The amino acid sequence is shown in SEQ ID NO.

2.

3. A recombinant expression vector containing the rice nuclear factor YC subunit gene OsNF-YC3 according to claim 1.

4. Use of the rice nuclear factor YC subunit gene OsNF-YC3 according to claim 1 in promoting the interaction between plants and arbuscular mycorrhizal fungi and improving phosphorus absorption during plant symbiosis.

5. Use of the rice nuclear factor YC subunit gene OsNF-YC3 according to claim 1 in rice variety improvement.

6. Use of the recombinant expression vector according to claim 3 in improving the colonization efficiency of arbuscular mycorrhizal fungi in plant roots and promoting the absorption of phosphorus by plants through mycorrhizal symbiosis.

7. Use of the recombinant expression vector according to claim 3 in rice variety improvement.

Images