Composition and kit for detecting chlamydia pneumoniae, mycoplasma pneumoniae and respiratory adenovirus

Abstract

The invention relates to a composition and a kit for detecting chlamydia pneumonia, mycoplasma pneumonia and respiratory adenovirus, the composition comprises a primer pair and a probe corresponding to the primer pair, the primer pair comprises a primer pair 1 aiming at the chlamydia pneumonia, a primer pair 2 aiming at the mycoplasma pneumonia and a primer pair 3 aiming at the respiratory adenovirus; the probes comprise a specific probe 1 aiming at chlamydia pneumonia, a specific probe 2 aiming at mycoplasma pneumonia and a specific probe 3 aiming at respiratory adenovirus. According to the invention, the optimal primer pair and probe combination is screened out from the designed six groups of specific primer pairs and probes, so that the requirement of high sensitivity is met, the detection result is highly accurate, the detection sensitivity can reach 1copies / reaction, and the anti-interference capability is relatively strong. The PCR amplification reagent in the kit is presented in the form of a freeze-dried product, can be stored at room temperature, and has stable performance within 12 months, and the detection sensitivity and precision meet the detection requirements.

Description

Technical Field

[0001] The present invention relates to the field of molecular biological detection, and in particular to a composition and a kit for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus. Background Art

[0002] Human Chlamydia pneumoniae (C.pneumoniae) infection is universal throughout the world. Chlamydia pneumoniae is transmitted from person to person through respiratory secretions. Therefore, small-scale epidemics may exist in semi-enclosed environments such as families, schools, the military, and other densely populated work areas. Infection with Chlamydia pneumoniae may also be associated with the onset of asthma, coronary heart disease, and atherosclerosis, and acute attacks and exacerbations of chronic obstructive pulmonary disease. At present, Chlamydia pneumoniae has become the main pathogen causing community-acquired pneumonia after Pneumococcus and Haemophilus influenzae. Together with Legionella pneumophila and Mycoplasma pneumoniae, it has become three atypical pathogens of community-acquired pneumonia, accounting for 10% to 20% of community-acquired pneumonia.

[0003] Mycoplasma pneumonia (M.Pneumonia) is the pathogen of human mycoplasma pneumonia. The pathological changes of mycoplasma pneumonia are mainly interstitial pneumonia, sometimes complicated by bronchopneumonia, which is called primary atypical pneumonia. It is mainly transmitted through droplets, with an incubation period of 2 to 3 weeks, and the highest incidence rate is in adolescents. The clinical symptoms are mild, often accompanied by general respiratory symptoms such as headache, sore throat, fever, cough, but there are also individual deaths reported. It can occur all year round, but mostly in autumn and winter.

[0004] Adenovirus (ADV) is a widely distributed group of viruses with double-helix DNA genomes. The acute infectious diseases caused by ADV are prone to invade the respiratory and digestive tract mucosa, conjunctiva, urinary tract and lymph nodes, and mainly manifest as acute upper respiratory tract infection (acute respiratory tract infection caused by adenovirus accounts for 2% to 4%), followed by eye and gastrointestinal infections. The general population is susceptible, especially children, and about half of the patients are latently infected. Infants and young children are susceptible to adenovirus pneumonia, which accounts for about 10% of childhood pneumonia. The disease is severe and the mortality rate is high. The mortality rate of adenovirus pneumonia in young patients is 8% to 10%, and there is no specific treatment. According to the survey of serum-specific antibodies and virus isolation in the population, it can be seen that adenovirus infection is very widespread.

[0005] At present, many companies have obtained CFDA registration certificates for respiratory virus-related detection products, involving a variety of detection methods, among which the most widely used methods are colloidal gold method, enzyme-linked immunosorbent assay, and PCR fluorescent probe method. In addition, manufacturers have also sampled methods such as double amplification method, isothermal amplification method, chemiluminescence method, magnetic microparticle chemiluminescence method, latex method, and immunochromatography. However, there are few products that can detect Mycoplasma pneumoniae, Chlamydia pneumoniae, and respiratory adenovirus at the same time, and the sensitivity is not high, which may cause false negative problems. Summary of the invention

[0006] The present invention aims at the deficiencies in the prior art and provides a composition and a kit with high detection sensitivity for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus.

[0007] The specific technical solutions of the present invention are as follows:

[0008] A composition for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, comprising primer pairs and corresponding probes, wherein the primer pairs include primer pair 1 for Chlamydia pneumoniae, whose nucleotide sequences are shown in SEQ ID NO.01 and SEQ ID NO.02; primer pair 2 for Mycoplasma pneumoniae, whose nucleotide sequences are shown in SEQ ID NO.03 and SEQ ID NO.04; primer pair 3 for respiratory adenovirus, whose nucleotide sequences are shown in SEQ ID NO.05 and SEQ ID NO.06;

[0009] The probes include a specific probe 1 for Chlamydia pneumoniae, whose nucleotide sequence is shown in SEQ ID NO.07; a specific probe 2 for Mycoplasma pneumoniae, whose nucleotide sequence is shown in SEQ ID NO.08; a specific probe 3 for respiratory adenovirus, whose nucleotide sequence is shown in SEQ ID NO.09; SEQ ID NO.01: 5′-GTGGTAGCAAATCCCCAA-3′

[0010] SEQ ID NO.02: 5′-TGTTTTCCTAGCCACCTCG-3′

[0011] SEQ ID NO.03: 5′-CGCACTTCCTTTGCGTATC-3′

[0012] SEQ ID NO.04: 5′-TCTCTACAACACGACCAGC-3′

[0013] SEQ ID NO.05: 5′-GTGGACAGCTATGATCCCG-3′

[0014] SEQ ID NO.06: 5′-CCCATGCAGTGTCTCTAGG-3′

[0015] SEQ ID NO.07: 5′-CATCCTAATCCTAAAATAGAA-3′

[0016] SEQ ID NO.08: 5′-CGTGAATGGTTTACCGATGGTCC-3′

[0017] SEQ ID NO. 09: 5'-GTTCGTATTATTGAAAATCATGG-3'.

[0018] Furthermore, the specific probe 1, the specific probe 2, and the specific probe 3 are all connected with fluorescent labeling groups, and the fluorescent labeling groups on the specific probe 1, the specific probe 2, and the specific probe 3 generate different fluorescent signals during the PCR process.

[0019] Furthermore, the specific probe 1 is connected to a FAM fluorescent labeling group, the specific probe 2 is connected to a JOE fluorescent labeling group, and the specific probe 3 is connected to a CY5 fluorescent labeling group.

[0020] Furthermore, the concentrations of the specific probe 1, the specific probe 2, and the specific probe 3 are all 0.02-0.06 μM.

[0021] Furthermore, the concentration of each primer in the primer pair 1, the primer pair 2, and the primer pair 3 is 0.07-0.08 μM.

[0022] Furthermore, the primer pair also includes a primer pair for detecting human genome β-globin, and its nucleotide sequence is shown in SEQ ID NO.10 and SEQ ID NO.11; the probe also includes a specific probe for detecting human genome β-globin, and its nucleotide sequence is shown in SEQ ID NO.012;

[0023] SEQ ID NO.10: 5′-GCTTACATTTGCTTCTGACA-3′

[0024] SEQ ID NO.11: 5′-AGTAACGGCAGACTTCTCC-3′

[0025] SEQ ID NO. 12: 5'-ACTAGCAACCTCAAACAGACACC-3'.

[0026] Furthermore, the concentration of each primer in the primer pair for detecting human genome β-globin is 0.07-0.08 μM, and the concentration of the specific probe for detecting human genome β-globin is 0.02-0.06 μM.

[0027] The present invention also relates to a kit for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, comprising the above-mentioned composition for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus.

[0028] Furthermore, the kit includes a PCR reaction system, a positive control substance, a negative control substance and a preservation solution, and the PCR reaction system includes a buffer, a hot-start DNA polymerase and the composition for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus.

[0029] Furthermore, the PCR reaction system is a freeze-dried product, and the freeze-drying steps of the freeze-dried product are as follows:

[0030] The PCR reaction system and DNA polymerase are precooled, sublimation-dried, freeze-dried, and analytical-dried to obtain a PCR amplification reagent freeze-dried product;

[0031] Precooling stage: precooling temperature is -50~-40℃, precooling time is 150~200min;

[0032] Sublimation drying and freeze drying stage: under the condition of vacuum degree of 0-0.1mbar, freeze-dry at -40--30℃ for 100-150min, then heat to -30--20℃ and freeze-dry for 220-260min, and heat to -20--10℃ and freeze-dry for 150-200min again;

[0033] Desorption and drying stage: maintain the temperature at 4-10°C for 30-40 minutes, then raise the temperature to 10-20°C and maintain for 30-40 minutes.

[0034] The present invention screens out the best primer pair and probe combination from the designed 6 groups of specific primer pairs and probes, meets the requirement of high sensitivity, and the detection result is highly accurate. The kit composed of the specific primers and probes of the present invention can achieve a detection sensitivity of 1 copies / reaction. The kit provided by the present invention has a strong anti-interference ability, and the interfering substances in the following concentration range in the sample do not affect normal amplification. Dexamethasone (≤0.3mg / mL), zanamivir (≤0.2mg / mL), menthol (≤0.1mg / mL), oxymetazoline (≤0.2mg / mL).

[0035] The kit provided by the present invention adopts a fluorescent PCR method to detect Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, and adopts a specific probe 1 for Chlamydia pneumoniae, a specific probe 2 for Mycoplasma pneumoniae and a specific probe 3 for respiratory adenovirus. The fluorescent marker groups connected to the specific probes 1, 2 and 3 generate different fluorescent signals during the PCR process. Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus can be detected simultaneously by sampling once, and screening and diversion are completed in one step.

[0036] It should be emphasized that the inventors found in the experimental research process that the difficulty of the present invention is: to select a variety of genes that can achieve simultaneous amplification detection, it is necessary to consider the factors that may cause the failure of detection due to the interaction between multiple primers and probes, and to consider the influence of the probe sequence on specificity, sensitivity and accuracy. In addition, it is necessary to select a specific design idea in the study, and further experiments are required to verify the sequence of the probe to obtain the technical solution described in the present invention. Considering the complexity of mutual reaction between the primer sequences and probes when simultaneously amplifying and detecting multiple genes from different viruses, as well as the specificity, sensitivity and accuracy of the probe design in the fluorescent PCR detection method, in view of this, there is currently no public technology that can achieve the beneficial effects of the present invention, which also reflects the complexity and difficulty in actual operation.

[0037] The kit provided by the present invention innovatively adds a nucleic acid extraction reagent to the preservation solution of the sampling tube, which can eliminate the sample extraction step. After sampling, the sample can be directly taken to the machine, and the rapid amplification can produce results in only 25 minutes. The PCR amplification reagent in the kit provided by the present invention is presented in the form of a lyophilized product, which can be stored at room temperature, has stable performance within 12 months, and the detection sensitivity and precision meet the detection requirements. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1 This is a graph showing the test results of the positive control substance in Example 2 of the present invention;

[0039] Figure 2 This is a graph showing the test results of the negative control substance in Example 2 of the present invention. DETAILED DESCRIPTION

[0040] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of them. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work belong to the scope of protection of the present invention. The parts not mentioned in the present invention are all prior art.

[0041] The concentration of each primer in the primer pair and the concentration of the probe in the present invention refer to the concentration in the PCR reaction system.

[0042] The present invention discloses a composition for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, comprising primer pairs and corresponding probes, wherein the primer pairs comprise a primer pair 1 for Chlamydia pneumoniae, whose nucleotide sequences are shown in SEQ ID NO.01 and SEQ ID NO.02; a primer pair 2 for Mycoplasma pneumoniae, whose nucleotide sequences are shown in SEQ ID NO.03 and SEQ ID NO.04; a primer pair 3 for respiratory adenovirus, whose nucleotide sequences are shown in SEQ ID NO.05 and SEQ ID NO.06;

[0043] The probes include a specific probe 1 for Chlamydia pneumoniae, whose nucleotide sequence is shown in SEQ ID NO.07; a specific probe 2 for Mycoplasma pneumoniae, whose nucleotide sequence is shown in SEQ ID NO.08; a specific probe 3 for respiratory adenovirus, whose nucleotide sequence is shown in SEQ ID NO.09; SEQ ID NO.01: 5′-GTGGTAGCAAATCCCCAA-3′

[0044] SEQ ID NO.02: 5′-TGTTTTCCTAGCCACCTCG-3′

[0045] SEQ ID NO.03: 5′-CGCACTTCCTTTGCGTATC-3′

[0046] SEQ ID NO.04: 5′-TCTCTACAACACGACCAGC-3′

[0047] SEQ ID NO.05: 5′-GTGGACAGCTATGATCCCG-3′

[0048] SEQ ID NO.06: 5′-CCCATGCAGTGTCTCTAGG-3′

[0049] SEQ ID NO.07: 5′-CATCCTAATCCTAAAATAGAA-3′

[0050] SEQ ID NO.08: 5′-CGTGAATGGTTTACCGATGGTCC-3′

[0051] SEQ ID NO. 09: 5'-GTTCGTATTATTGAAAATCATGG-3'.

[0052] Furthermore, the specific probe 1, the specific probe 2, and the specific probe 3 are all connected with fluorescent labeling groups, and the fluorescent labeling groups on the specific probe 1, the specific probe 2, and the specific probe 3 generate different fluorescent signals during the PCR process.

[0053] Furthermore, the specific probe 1 is connected to a FAM fluorescent labeling group, the specific probe 2 is connected to a JOE fluorescent labeling group, and the specific probe 3 is connected to a CY5 fluorescent labeling group.

[0054] Furthermore, the concentrations of the specific probe 1, the specific probe 2, and the specific probe 3 are all 0.02-0.06 μM.

[0055] Furthermore, the concentration of each primer in the primer pair 1, the primer pair 2, and the primer pair 3 is 0.07-0.08 μM.

[0056] Furthermore, the primer pair also includes a primer pair for detecting human genome β-globin, and its nucleotide sequence is shown in SEQ ID NO.10 and SEQ ID NO.11; the probe also includes a specific probe for detecting human genome β-globin, and its nucleotide sequence is shown in SEQ ID NO.012;

[0057] SEQ ID NO.10: 5′-GCTTACATTTGCTTCTGACA-3′

[0058] SEQ ID NO.11: 5′-AGTAACGGCAGACTTCTCC-3′

[0059] SEQ ID NO. 12: 5'-ACTAGCAACCTCAAACAGACACC.

[0060] Furthermore, the concentration of each primer in the primer pair for detecting human genome β-globin is 0.07-0.08 μM, and the concentration of the specific probe for detecting human genome β-globin is 0.02-0.06 μM.

[0061] The present invention also relates to a kit for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, comprising the above-mentioned composition for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus.

[0062] Further, the kit includes a PCR reaction system, a positive control, a negative control and a preservation solution, wherein the PCR reaction system includes a buffer, a hot start DNA polymerase and a composition for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus. The concentrations of the positive control and the negative control in the kit are both conventional concentrations in the art, and the ratio between the PCR reaction system and the DNA polymerase is also conventional in the art, which will not be described in detail here.

[0063] The present invention selects a method that can realize simultaneous amplification and detection of multiple pathogen genes, which not only considers the factors that may cause the failure of detection due to the interaction between multiple primers and probes, but also considers the influence of the probe sequence on specificity, sensitivity and accuracy. In the study, it is necessary to select a specific design idea, and further experiments are required to verify and optimize the sequence of the probe to obtain the technical solution described in the present invention. Taking into account the complexity of mutual reactions between primer sequences and probes when simultaneously amplifying and detecting multiple genes from different viruses, as well as the specificity, sensitivity and accuracy of probe design in the fluorescent PCR detection method; the present invention selects the optimal primer pair and probe combination from the designed 6 groups of specific primer pairs and probes to meet the requirements of high sensitivity, and the detection results are highly accurate. The kit composed of the specific primers and probes described in the present invention can achieve a detection sensitivity of 1 copies / reaction.

[0064] The kit for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus using fluorescent PCR provided by the present invention comprises: design and synthesis of primer pairs and corresponding probes, with ATPase operon gene of Chlamydia pneumoniae (CP), CARDS gene of Mycoplasma pneumoniae (MP) and E1A gene of respiratory adenovirus (ADV) as target regions, respectively designing specific primer pairs and corresponding probes for amplifying corresponding nucleic acid fragments, and respectively labeling corresponding probes with FAM, JOE and CY5 fluorescence. The probe adopts highly specific TaqMan probe, can be combined with corresponding nucleic acid fragments, and hydrolyzed under the action of exonuclease activity of hot start DNA polymerase to generate fluorescent signals, and a real-time amplification curve can be obtained according to the relationship between the fluorescent signal and the number of amplification cycles.

[0065] The amplification primer pair includes primer pair sequences corresponding to Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, and the nucleotide sequence of the primer pair is shown in SEQ ID NO.01-SEQ ID NO.06.

[0066] The amplification probes corresponding to the primer pairs include probe sequences corresponding to Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, and the probe sequences are shown in SEQ ID NO.07-SEQ ID NO.09.

[0067] The Tm value (melting temperature) of each primer is close to 57°C, the length of the amplified product ranges from 100 to 150 bp, and the Tm value of each probe is close to 67°C. Each pair of primers and probes is tested and optimized for amplification until a smooth amplification curve with a high signal value is obtained. Multiple pairs of primers and probes are tested for composite amplification to confirm that the reaction system will not cause non-specific amplification, primer interactions or cross reactions.

[0068] The present invention also discloses a method for using the detection kit, which includes the following steps: placing the collected sample into the preservation solution of the kit, aspirating 25 μl of the preservation solution containing the sample, placing it into a PCR amplification tube, and then placing it on a fluorescent PCR instrument for PCR amplification. The PCR amplification program is pre-denaturation at 97°C for 30 seconds; 97°C for 8 seconds, 57°C for 15 seconds, 42 cycles (collecting fluorescence); and finally maintaining at 4-16°C.

[0069] The storage solution includes 16-20 mM Tris-HCl, 16-20 mM NaCl, 4-6 mg / mL KCl, 0.1-0.2 v% Tween 20, 0.1-0.2 v% Triton X-100, 0.1-0.2 v% Nonidet P-40, 10-20 mg / mL NaOH, 8-10 mg / mL betaine, 4-5 mg / mL BSA, 0.04-0.05 mg / mL proteinase K and 0.8-1 mg / mL lithium dodecyl sulfate.

[0070] The amplification adopts polymerase chain reaction, and the reaction can be carried out in a PCR reaction system. The buffer components in the PCR reaction system are: 50-70mM Tris-HCl, 25-45mM KCl, 2-2.5mM MgCl2, 0.6-0.8mM dNTPs, 10-20mM (NH4)2SO4, 0.01-0.02v% BSA, 0.02-0.05v% Tween20, 0.005-0.01w% gelatin, 0.01-0.02v% glycerol, 0.05-0.1v% Triton-X, 0.1-0.2v% DMSO, 8-10mM TMAC, 1.5-3w% trehalose and 1-2w% sucrose.

[0071] The PCR reaction system of the present invention adopts the form of freeze-dried products, and the freeze-drying steps of the freeze-dried products are as follows: the PCR reaction system is precooled, sublimation-dried, freeze-dried, and analytical-dried to obtain a PCR amplification reagent freeze-dried product; precooling stage: the precooling temperature is -50 to -40°C, and the precooling time is 150 to 200 minutes; sublimation-dried freeze-dried stage: under the condition of a vacuum degree of 0 to 0.1 mbar, freeze-dried at -40 to -30°C for 100 to 150 minutes, then heated to -30 to -20°C for freeze-dried for 220 to 260 minutes, and then heated to -20 to -10°C for freeze-dried for 150 to 200 minutes; analytical-dried stage: kept at 4 to 10°C for 30 to 40 minutes, and then heated to 10 to 20°C for freeze-dried for 30 to 40 minutes.

[0072] The DNA polymerase required for the reaction is a hot-start DNA polymerase, antibody-blocked or chemically modified, and each amplification system (25 μL) requires 2.5 U to 5 U of DNA polymerase. In addition to the primer pair and the corresponding probe mixture, buffer and hot-start DNA polymerase, the amplification system of the present invention also includes a positive control and a negative control.

[0073] This kit uses a specific primer pair and probe designed for detecting β-globin in the human genome as an internal standard (IC). The nucleotide sequence (5′-3′) of the primer pair is as shown in SEQ ID NO.10: GCTTACATTTGCTTCTGACA, and SEQ ID NO.11 is as shown in AGTAACGGCAGACTTCTCC; the nucleotide sequence (5′-3′) of the probe is as shown in SEQ ID NO.12: ACTAGCAACCTCAAACAGACACC, and its 5′ end is connected to a ROX group and its 3′ end is connected to a BHQ group.

[0074] The kit provided by the present invention has a large annealing temperature range, and the amplification system can be used on various general fluorescent PCR instruments (such as ABI7500, SLAN, Rocgene, etc.) and rapid amplification fluorescent PCR instruments (GN7120 rapid nucleic acid analyzer). The optimal amplification program is pre-denaturation at 97°C for 30 seconds; 97°C for 8 seconds and 57°C for 15 seconds, 42 cycles (collecting fluorescence); and finally maintaining at 4-16°C.

[0075] This kit has strong anti-interference ability, and the interfering substances in the sample within the following concentration range will not affect normal amplification: Dexamethasone (≤0.3mg / mL), Zanamivir (≤0.2mg / mL), Menthol (≤0.1mg / mL), Oxymetazoline (≤0.2mg / mL).

[0076] The PCR reagents in this kit are presented in the form of lyophilized products and can be stored at room temperature for 12 months. The detection sensitivity and precision meet the detection requirements.

[0077] Example 1 Design of primer and probe combinations for detection kits for Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus

[0078] 1. Design principles for primer pairs and probes for detection of Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus

[0079] Primer and probe length: each primer is 16 to 30 bases long, and the fluorescent probe is 20 to 35 bases long; the GC% in primers and probes is required to be 40 to 60%, the primer Tm value is 50 to 60°C, and the probe Tm value is 8 to 10°C higher than the primer Tm value; base pairing should be avoided as much as possible between the primers themselves, the probes themselves, and the 3' ends between primers and probes; more than 6 pairs of continuous base pairing should be avoided as much as possible between the primers themselves, the probes themselves, and the primers and probes; the target fragment amplified by the upstream and downstream primers is 100 to 150 bp in length, the probe is located between the upstream and downstream primers, as close to the upstream primer as possible, and guanine should be avoided at the 5' end of the probe; the selected primers and probes are required to be designed in the conserved regions in the genome of Chlamydia pneumoniae, Mycoplasma pneumoniae or respiratory adenovirus, can specifically detect the target viral nucleic acid, and have no cross reaction with other species.

[0080] 2. Design of primer pairs and probes for detection of Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus

[0081] The genome sequences of Chlamydia pneumoniae, Mycoplasma pneumoniae or respiratory adenovirus were retrieved from Genbank, and homology comparison was performed to find the homologous conserved segments of CP, MP or ADV genes and the internal standard β-globin gene. Through the search and analysis of the Blast tool in the GenBank database, six sets of primers and probe groups were designed (as shown in Table 1 below). The 5′ end of the probe of the CP gene was labeled with a fluorescent reporter group (FAM) and the 3′ end was labeled with DBQ1; the 5′ end of the probe of the MP gene was labeled with a fluorescent reporter group (JOE) and the 3′ end was labeled with BHQ1; the 5′ end of the probe of the ADV gene was labeled with a fluorescent reporter group (CY5) and the 3′ end was labeled with BHQ2.

[0082] Table 1. Information of six candidate primer pairs and probes

[0083]

[0084]

[0085] 3. Screening of primer pairs and probes for detection of Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus

[0086] The reference samples of Chlamydia pneumoniae, Mycoplasma pneumoniae, and adenovirus prepared by GeneDan Biotechnology Co., Ltd. (Batch No.: CP / MP / ADV-20230601SG) were selected. The CP, MP, and ADV reference samples with 1 copy / reaction were tested three times, and their Ct values ​​and test results were counted. The test results are shown in Table 2 below.

[0087] Table 2 Comparison of detection sensitivity of six candidate primer pairs and probes

[0088]

[0089]

[0090] By comparing the detection results of the six sets of primer pairs and probes, it was found that the first set of primer pairs and probes could not detect 1 copy / reaction of the ADV reference, the second set of primer pairs and probes could not detect 1 copy / reaction of the MP and ADV references, the third set of primer pairs and probes could stably detect 1 copy / reaction of the CP, MP and ADV references, and the fourth, fifth and sixth sets of primer pairs and probes could not stably detect 1 copy / reaction of the CP, MP and ADV references; therefore, the third set of primer pairs and probes is the best, with higher detection sensitivity, and can detect 1 copy / reaction of the reference, meeting the requirement of high sensitivity.

[0091] Example 2 Preparation of a kit for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus 1. Primer pairs and probes for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus

[0092] Amplification primer pairs and corresponding probes were designed for Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, respectively. The primer pair probe sequences, primer pair probe concentrations and fluorescent labeling methods are shown in Table 3. In addition, this kit selects human genome β-globin as the internal standard (IC), and its primer probe information is as follows (primer pair sequence (5′-3′): GCTTACATTTGCTTCTGACA, AGTAACGGCAGACTTCTCC; probe sequence (5′-3′): ROX-ACTAGCAACCTCAAACAGACACC-BHQ2).

[0093] Table 3 Primer pair probe information

[0094]

[0095] 2. Preparation of Detection System for Chlamydia pneumoniae, Mycoplasma pneumoniae and Respiratory Adenovirus

[0096] The kit contains the following ingredients:

[0097]

[0098] The PCR amplification system for each 25 μL is as follows:

[0099] Components Add PCR reaction system 20μL Storage solution containing sample template 5μL

[0100] The plasmid contained in the positive control was an 800 bp fragment corresponding to the detection target region, with a concentration of 5000 copies / reaction, purchased from Sangon Biotech (Shanghai) Co., Ltd. Hot start DNA polymerase was purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0101] 3. Freeze-drying of PCR amplification reagents for Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus

[0102] The freeze-drying system is as follows:

[0103]

[0104] The reagents were freeze-dried using a freeze dryer (model: LGJ-12S) purchased from Jiangsu Scientific Instruments Co., Ltd.

[0105] The freeze-drying process is as follows:

[0106] Take 20 μL of the prepared PCR reaction system and put it into a freeze dryer for precooling: the precooling temperature is -50°C and the duration is 170 min; then evacuate the vacuum, and after the vacuum is completely evacuated (vacuum degree 0-0.1 mbar), enter the sublimation drying stage;

[0107] Sublimation drying stage: the temperature is set to -35°C for 120 minutes; then the temperature is raised to -20°C for 260 minutes; the temperature is further raised to -20°C for 160 minutes;

[0108] Analysis and drying stage: the temperature was set to 8°C for 35 minutes; then the temperature was raised to 15°C and the freeze-drying was completed after 30 minutes to obtain the freeze-dried product of the PCR amplification reagent.

[0109] Example 3 Application of a kit for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus 1. Amplification of positive control

[0110] Mix 1 portion of the lyophilized product of the PCR reaction system prepared in Example 2 with 25 μL of the positive control, mix well and centrifuge briefly, and place the centrifuged mixture into a fluorescent PCR instrument (the model used in this example is the GN7120 rapid nucleic acid analyzer, GeneDx Biotechnology Co., Ltd.) for PCR amplification.

[0111] PCR amplification program: initial denaturation at 97°C for 30 seconds; 97°C for 8 seconds, 57°C for 15 seconds, 42 cycles (fluorescence collection); finally, maintaining at 4-16°C.

[0112] After amplification, GN7120 was used to analyze the data. The test results are as follows: Figure 1 As shown, the horizontal axis is the cycle number, and the vertical axis is the relative fluorescence signal. The amplification curves of CP, MP, ADV and IC are clear, showing a standard S-shaped curve, and there is no obvious fluctuation in the fluorescence background.

[0113] 2. Amplification of negative control

[0114] Mix 1 portion of the lyophilized product of the PCR reaction system prepared in Example 2 with 25 μL of the negative control, mix well and centrifuge briefly, and place the mixed solution after centrifugation into a fluorescent PCR instrument (the model used in this example is GN7120 Rapid Nucleic Acid Analyzer, GeneDx Biotechnology Co., Ltd.) for PCR amplification.

[0115] PCR amplification program: initial denaturation at 97°C for 30 seconds; 97°C for 8 seconds, 57°C for 15 seconds, 42 cycles (fluorescence collection); finally, maintaining at 4-16°C.

[0116] After amplification, GN7120 was used to analyze the data. The test results are as follows: Figure 2 As shown, the horizontal axis is the cycle number, and the vertical axis is the relative fluorescence signal value. The IC amplification curve is clear and presents a standard S-shaped curve. There is no obvious fluctuation in the fluorescence background and no non-specific amplification occurs.

[0117] Example 4 Comparison of the kit for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus with commercially available kits

[0118] 1. Sample and commercial kit information

[0119] 20 clinical samples were provided by Nanjing Jiangbei People's Hospital. Two specimens were collected from the same patient, one was placed in the preservation solution of the kit of the present invention, and the other was placed in the preservation solution of the comparison kit.

[0120] The comparison kit was the Mycoplasma pneumoniae / Chlamydia pneumoniae / Adenovirus Nucleic Acid Detection Kit (PCR-fluorescent probe method), national device registration number 20223401535, purchased from Zhengzhou Antu Bioengineering Co., Ltd.

[0121] 2. Sample Pretreatment

[0122] The cells scraped with oropharyngeal swabs are placed in the preservation solution of the respective kits. The kit of the present invention can be directly tested on the machine after sampling. The comparison kit is operated according to the method recommended in the instruction manual. The following table shows the specific operation steps and time in Table 4.

[0123] Table 4 Comparison of pre-treatment steps with the comparison kit

[0124]

[0125] 3. Amplification Procedure

[0126] The kit of the present invention adopts a rapid amplification program, and the comparison kit performs amplification according to the program recommended in the instruction manual. The specific amplification program and time are shown in Table 5.

[0127] Table 5 Comparison of amplification procedures with commercial kits

[0128]

[0129] 4. Sample testing

[0130] The PCR reaction solution was prepared according to the sample addition in Example 2 and prepared into a lyophilized product, and then rapid amplification was performed on GN7120, and the GN7120 rapid nucleic acid analyzer was obtained from GeneDan Biotechnology Co., Ltd.; the comparison kit was operated according to its instructions, and the model used was ABI7500. The test results are shown in Table 6.1. After data statistics, the positive compliance rate of the kit of the present invention was 100%, the negative compliance rate was 100%, and the total compliance rate was 100% compared with the comparison kit.

[0131] Table 6.1 Comparison of positive and negative test results with the comparison kit

[0132]

[0133]

[0134] 5. Reference sample testing

[0135] Chlamydia pneumoniae, Mycoplasma pneumoniae, and adenovirus corporate reference materials (batch number: CP / MP / ADV-20230601SG) were used for gradient dilution to obtain 20 copies / reaction, 10 copies / reaction, 5 copies / reaction, 2 copies / reaction, and 1 copy / reaction reference materials, which were detected using the kit of the present invention and the comparison kit, respectively. The test was repeated 20 times, and the detection rate was statistically analyzed.

[0136] The test results are shown in Table 6.2. According to data statistics, the test kit of the present invention has a higher detection sensitivity of up to 1 copies / reaction (detection rate ≥ 95%) compared with the comparative test kit.

[0137] Table 6.2 Comparison of test results with reference products of the comparison kit

[0138]

[0139] Example 5 Performance Verification of a Kit for Detecting Chlamydia Pneumoniae, Mycoplasma Pneumoniae and Respiratory Adenovirus 1. Precision Verification

[0140] The reference samples of Chlamydia pneumoniae, Mycoplasma pneumoniae, and adenovirus prepared by GeneDan Biotech Co., Ltd. (batch number: CP / MP / ADV-20230601SG) were selected for precision verification; the precision verification was based on the precision test method of the CLSI guideline EP05-A3 (Evaluation of Precision of Quantitative Measurement Procedures; Approved Guideline—Third Edition). According to the EP05-A3 guidance document and the "20x2x2" model, the reference samples of Mycoplasma pneumoniae, Chlamydia pneumoniae, and respiratory adenovirus were diluted to obtain 500 copies / reaction, and the mixed samples of 500 copies / reaction of CP, MP, and ADV reference samples were tested for precision. Two people (A and B) tested for 20 days, repeated twice a day, and their Ct values ​​were counted and the obtained coefficient of variation CV was calculated. The model used for this precision verification was the GN7120 rapid nucleic acid analyzer, which was obtained from GeneDan Biotech Co., Ltd.

[0141] The test results are shown in Table 7. According to data statistics, the CV of each detection target of the present invention is less than 5%.

[0142] Table 7 Precision verification of kits for detection of Mycoplasma pneumoniae, Chlamydia pneumoniae and respiratory adenovirus

[0143]

[0144] The precision CV values ​​obtained based on the above data are as follows:

[0145]

[0146] Note: S R Standard deviation, CV coefficient of variation

[0147] Based on the above experiments, 20 days of testing were carried out under the same conditions, with 2 analysis batches per day, and each batch was repeated twice by different people. A total of 80 test results showed that the detection precision of the Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus test kits were all within 5%.

[0148] 2. Detection sensitivity verification

[0149] Select the reference samples of Chlamydia pneumoniae, Mycoplasma pneumoniae, and adenovirus prepared by GeneDan Biotechnology Co., Ltd. (Batch No.: CP / MP / ADV-20230601SG). The reference samples of Mycoplasma pneumoniae, Chlamydia pneumoniae, and respiratory adenovirus were diluted to obtain 1 copy / reaction. The detection sensitivity of the mixed sample of CP, MP, and ADV reference samples with 1 copy / reaction was tested. Repeat the test 20 times. The model used for this detection sensitivity verification was the GN7120 rapid nucleic acid analyzer, which was obtained from GeneDan Biotechnology Co., Ltd.

[0150] The test results are shown in Table 8. According to data statistics, the detection rate of each target is 100%. The detection sensitivity of the kit of the present invention can reach 1 copies / reaction.

[0151] Table 8 Detection sensitivity verification of kits for detection of Mycoplasma pneumoniae, Chlamydia pneumoniae and respiratory adenovirus

[0152]

[0153] 3. Validation of analytical specificity

[0154] The samples tested were herpes virus, Candida albicans, Bordetella pertussis, Corynebacterium spp., rhinovirus, Staphylococcus epidermidis, bocavirus, enterovirus, herpes simplex virus type 1, Pneumocystis jiroveci, Klebsiella pneumoniae, Streptococcus pneumoniae, syncytial virus, Streptococcus pyogenes, Streptococcus pyogenes, influenza A virus, Staphylococcus aureus, cytomegalovirus, Moraxella catarrhalis, Haemophilus influenzae, measles virus, Neisseria spp., Neisseria meningitidis, human parainfluenza virus (types 1, 2, and 3), human coronavirus, human metapneumovirus, Lactobacillus spp., Legionella pneumophila, varicella-zoster virus, Streptococcus salivarius, avirulent Mycobacterium tuberculosis, and influenza B virus.

[0155] Using healthy people's throat swab samples, cross-reacting pseudoviruses and bacteria were diluted to 10 5 PFU / ml and 10 6 CFU / ml.

[0156] Pseudoviruses and bacteria used in cross-reactions were purchased from Nanjing Novozyme Biotechnology Co., Ltd.

[0157] The model used for this analysis specificity verification was the GN7120 rapid nucleic acid analyzer, which was obtained from GeneDx Biotechnology Co., Ltd.

[0158] Cross-reactivity evaluation is divided into two aspects, including gene sequence alignment and cross-reactivity verification.

[0159] a) Gene sequence alignment

[0160] The whole genome sequence of the cross-reactive sample was obtained from NCBI and clustered with the CP, MP, and ADV target sequences. The test results are shown in Table 9. After data statistics, the target sequences of CP, MP, and ADV in the kit of the present invention have no homology with the gene sequences of respiratory bacteria and pathogens.

[0161] Table 9 Gene sequence comparison results

[0162]

[0163]

[0164] b) Verification of cross-reactivity

[0165] The kit of the present invention was used for detection, and the detection results are shown in Table 10. According to data statistics, common respiratory bacteria and pathogens have no cross-interference with the kit of the present invention.

[0166] Table 10 Cross-reaction verification results

[0167]

[0168]

[0169] 4. Interference studies

[0170] The test substances selected for the Interfering Substance Research Institute include dexamethasone, zanamivir, menthol, and oxymetazoline; four concentration levels are set for each interfering substance, including dexamethasone 0.1mg / mL, 0.2mg / mL, 0.3mg / mL, and 0.4mg / mL; zanamivir 0.1mg / mL, 0.15mg / mL, 0.2mg / mL, and 0.25mg / mL; menthol 0.06mg / mL, 0.08mg / mL, 0.1mg / mL, and 0.12mg / mL; oxymetazoline 0.1mg / mL, 0.15mg / mL, 0.2mg / mL, and 0.25mg / mL; oral pharyngeal swab samples from healthy people containing different interfering substances were used to dilute the Mycoplasma pneumoniae, Chlamydia pneumoniae, and respiratory adenovirus reference substances (batch number: CP / MP / ADV-20230601SG) to 1 copy / reaction. Interference study test was performed on 1 copy / reaction of mixed samples of CP, MP and ADV reference substances. The determination was repeated 20 times.

[0171] The reference materials of Mycoplasma pneumoniae, Chlamydia pneumoniae and respiratory adenovirus were batch numbers A40, A41 and A21 and were purchased from Guangdong Hexin Health Technology Co., Ltd.

[0172] The model used in this interference study was the GN7120 rapid nucleic acid analyzer, which was obtained from GeneDx Biotechnology Co., Ltd.

[0173] Table 11 Interference substance test results

[0174]

[0175]

[0176] By testing interfering substances of different concentrations, it was determined that the kit provided by the present invention has strong anti-interference ability, and the interfering substances in the following concentration range in the sample do not affect normal amplification: dexamethasone (≤0.3 mg / mL), zanamivir (≤0.2 mg / mL), menthol (≤0.1 mg / mL), oxymetazoline (≤0.2 mg / mL).

[0177] The present invention uses a fluorescent PCR method to detect Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus. Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus can be detected by sampling once, and screening and diversion can be completed in one step. A nucleic acid extraction reagent is innovatively added to the sampling tube, which can eliminate the sample extraction step. After sampling, the sample can be directly taken on the machine, and the rapid amplification can produce results in only 25 minutes. Compared with other test kits on the market, the time is greatly shortened. For specific data, see Table 12. The sensitivity is high and the detection results are highly accurate.

[0178] Table 12. Comparison of detection time with mainstream commercial nucleic acid detection kits on the market

[0179]

[0180]

[0181] 5. Stability verification

[0182] The PCR amplification reagent in the kit provided by the present invention is presented in the form of a lyophilized product, can be stored at room temperature, and is stable within 12 months.

[0183] The kit prepared in Example 2 was stored at 28° C., and the kit within one month of its expiration date was used to verify the detection sensitivity and precision.

[0184] The corporate reference materials of Chlamydia pneumoniae, Mycoplasma pneumoniae, and adenovirus prepared by GeneDx Biotechnology Co., Ltd. (Batch No.: CP / MP / ADV-20230601SG) were selected for stability verification, and the Mycoplasma pneumoniae, Chlamydia pneumoniae, and respiratory adenovirus reference materials were gradiently diluted to obtain 500 copies / reaction and 1 copy / reaction, respectively.

[0185] Among them, 500 copies / reaction of CP, MP and ADV reference mixed samples were tested for precision. Two people (A and B) tested for 20 days, repeated twice a day, and their Ct values ​​were counted and the obtained coefficient of variation CV was calculated. 1 copy / reaction of CP, MP and ADV reference mixed samples were tested for sensitivity, and the test was repeated 20 times.

[0186] The model used for this test stability verification is the GN7120 rapid nucleic acid analyzer, which was obtained from GeneDx Biotechnology Co., Ltd.

[0187] Inspection standard:

[0188] 1) Detection sensitivity: The detection rate of each target should be ≥95%;

[0189] 2) Precision: The coefficient of variation (CV) of each target Ct value was ≤5%.

[0190] The test results of the test kit within 1 month of the expiration date are as follows:

[0191]

[0192] Precision test results of the kit within 1 month of expiration date:

[0193]

[0194]

[0195] The precision CV values ​​obtained based on the above data are as follows:

[0196]

[0197] Note: S R Standard deviation, CV coefficient of variation

[0198] The stability of the test kit within one month of the expiration date was verified, and the test results showed that the detection rate of each target was 100% for the detection sensitivity test of the mixed sample of CP, MP and ADV reference materials with 1 copy / reaction; the coefficient of variation CV of the Ct values ​​of CP, MP and ADV targets were 2.0%, 2.1% and 2.1% respectively for the precision test of the mixed sample of CP, MP and ADV reference materials with 500 copies / reaction. The detection sensitivity and precision test results met the inspection standards, indicating that the test kit of this product can be stored at 28°C for 12 months.

[0199] The present invention provides a composition and a kit for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, which are applied to the detection of Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, and have the characteristics of strong fluorescent signal and high sensitivity. The kit of the present invention has a wide coverage for detecting respiratory pathogens, and the sample can be directly tested on the machine without extraction after collection, and the PCR reaction can be completed within 25 minutes, and the analysis specificity is high, and the detection sensitivity can reach 1 copies / reaction. The PCR amplification reagent in the kit provided by the present invention is presented in the form of a lyophilized product, which can be stably stored for 12 months at room temperature.

[0200] Finally, it should be noted that the above embodiments are only used to illustrate the technical solutions of the present invention, rather than to limit it. Although the present invention has been described in detail with reference to the aforementioned embodiments, those skilled in the art should understand that they can still modify the technical solutions described in the aforementioned embodiments, or replace some or all of the technical features therein with equivalents. However, these modifications or replacements do not cause the essence of the corresponding technical solutions to deviate from the scope of the technical solutions of the embodiments of the present invention.

Claims

1. A composition for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, characterized in that The invention comprises a primer pair and a corresponding probe, wherein the primer pair comprises a primer pair 1 for Chlamydia pneumoniae, whose nucleotide sequence is shown in SEQ ID NO.01 and SEQ ID NO.02; a primer pair 2 for Mycoplasma pneumoniae, whose nucleotide sequence is shown in SEQ ID NO.03 and SEQ ID NO.04; a primer pair 3 for respiratory adenovirus, whose nucleotide sequence is shown in SEQ ID NO.05 and SEQ ID NO.06; The probes include a specific probe 1 for Chlamydia pneumoniae, whose nucleotide sequence is shown in SEQ ID NO.07; a specific probe 2 for Mycoplasma pneumoniae, whose nucleotide sequence is shown in SEQ ID NO.08; and a specific probe 3 for respiratory adenovirus, whose nucleotide sequence is shown in SEQ ID NO.09; SEQ ID NO.01: 5′-GTGGTAGCAAATCCCCCAA-3′ SEQ ID NO.02: 5′-TGTTTTCCTAGCCACCTCG-3′ SEQ ID NO.03: 5′-CGCACTTCCTTTGCGTATC-3′ SEQ ID NO.04: 5′-TCTCTACAACACGACCAGC-3′ SEQ ID NO.05: 5′-GTGGACAGCTATGATCCCG-3′ SEQ ID NO.06: 5′-CCCATGCAGTGTCTCTAGG-3′ SEQ ID NO.07: 5′-CATCCTAATCCTAAAATAGAA-3′ SEQ ID NO.08: 5′-CGTGAATGGTTTACCGATGGTCC-3′ SEQ ID NO.09: 5'-GTTCGTATTATTGAAAATCATGG-3'.

2. The composition according to claim 1, characterized in that The specific probe 1, the specific probe 2, and the specific probe 3 are all connected with fluorescent labeling groups, and the fluorescent labeling groups on the specific probe 1, the specific probe 2, and the specific probe 3 generate different fluorescent signals during the PCR process.

3. The composition according to claim 2, characterized in that The specific probe 1 is connected to a FAM fluorescent labeling group, the specific probe 2 is connected to a JOE fluorescent labeling group, and the specific probe 3 is connected to a CY5 fluorescent labeling group.

4. The composition according to claim 1, 2 or 3, characterized in that The concentrations of the specific probe 1, the specific probe 2 and the specific probe 3 are all 0.02-0.06 μM.

5. The composition according to claim 1, 2 or 3, characterized in that The concentration of each primer in the primer pair 1, the primer pair 2 and the primer pair 3 is 0.07-0.08 μM.

6. The composition according to claim 1, characterized in that The primer pair also includes a primer pair for detecting human genome β-globin, and its nucleotide sequence is shown in SEQ ID NO.10 and SEQ ID NO.11; the probe also includes a specific probe for detecting human genome β-globin, and its nucleotide sequence is shown in SEQ ID NO.012; SEQ ID NO.10: 5′-GCTTACATTTGCTTCTGACA-3′ SEQ ID NO.11: 5′-AGTAACGGCAGACTTCTCC-3′ SEQ ID NO. 12: 5'-ACTAGCAACCTCAAACAGACACC-3'.

7. The composition according to claim 6, characterized in that The concentration of each primer in the primer pair for detecting human genome β-globin is 0.07-0.08 μM, and the concentration of the specific probe for detecting human genome β-globin is 0.02-0.06 μM.

8. A kit for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus, characterized in that: A composition for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus according to any one of claims 1 to 7.

9. The kit according to claim 8, characterized in that The kit comprises a PCR reaction system, a positive control substance, a negative control substance and a preservation solution. The PCR reaction system comprises a buffer, a hot start DNA polymerase and the composition for detecting Chlamydia pneumoniae, Mycoplasma pneumoniae and respiratory adenovirus.

10. The kit according to claim 9, characterized in that The PCR reaction system is a freeze-dried product, and the freeze-drying steps of the freeze-dried product are as follows: The PCR reaction system and DNA polymerase are precooled, sublimation-dried, freeze-dried, and analytical-dried to obtain a PCR amplification reagent freeze-dried product; Precooling stage: precooling temperature is -50~-40℃, precooling time is 150~200min; Sublimation drying and freeze drying stage: under the condition of vacuum degree of 0-0.1mbar, freeze-dry at -40--30℃ for 100-150min, then heat to -30--20℃ and freeze-dry for 220-260min, and heat to -20--10℃ and freeze-dry for 150-200min again; Desorption and drying stage: maintain the temperature at 4-10°C for 30-40 minutes, then raise the temperature to 10-20°C and maintain for 30-40 minutes.

Images