MsCYP1 gene of sorghum aphid as well as encoding protein, dsRNA (double-stranded ribonucleic acid) and application of MsCYP1 gene

Abstract

The invention discloses a sorghum aphid MsCYP1 gene as well as an encoding protein, dsRNA (double-stranded ribonucleic acid) and application thereof, and aims to solve the technical problem that a key gene is lacked when an RNA (ribonucleic acid) interference technology is used for biological prevention and control of sorghum aphids at present. According to the application, the sorghum aphid protein MsCYP1 capable of being secreted into sorghum cells is screened, and the protein and the coding gene thereof can inhibit the content of hydrogen peroxide in sorghum and the immune response of the sorghum. Meanwhile, according to the cDNA sequence of the MsCYP1 gene of the sorghum aphid, dsRNA for the gene is designed, the dsRNA is introduced into the body of the sorghum aphid in an artificial feeding mode, it is found that the dsRNA can remarkably inhibit the MsCYP1 gene of the sorghum aphid, then the honeydew secretion amount and the reproduction rate of the sorghum aphid are affected, the MsCYP1 gene can serve as an RNAi target gene to be used for aphid prevention and control, pesticide use is reduced, and the application prospect is good. The ecological balance is maintained.

Description

Technical Field

[0001] The present invention relates to the field of biological control technology, and specifically to a sorghum aphid MsCYP1 Genes, their encoded proteins, dsRNA and applications. Background Art

[0002] Sorghum is the fifth largest food crop in the world and one of the earliest cultivated cereal crops in China. It plays an extremely important role in agricultural production. Sorghum has strong resistance to drought, waterlogging, salinity, barrenness, and high temperature. It can be used for food, feed, brewing, bioenergy, and chemical materials. It is the most promising dual-purpose food and feed crop and energy plant. However, sorghum is affected by sorghum aphids ( Melanaphis sacchari ) and the number of insects on a single plant can reach 30,000. Therefore, sorghum aphids are identified as the main pests in sorghum production in my country. Sorghum aphids use their piercing-sucking mouthparts to invade the plant body, suck the juice from the back of sorghum leaves and the phloem of the stems, and excrete high-sugar honeydew, which not only causes mold growth, but also causes the loss of nutrients, which in turn leads to crop yield reduction and even the death of the entire plant. In addition, sorghum aphids are also the vectors of plant viral diseases such as cereal red leaf disease, sugarcane yellow leaf disease and sugarcane mosaic disease, posing an indirect threat to crops. If insecticide measures are taken, the yield loss caused by sorghum aphids can reach 46% to 78%, and at the same time seriously affect the various economic traits of sorghum, such as reducing the protein content of the grains, significantly reducing the sugar content of the stems, and causing the affected stems to be intolerant of storage, causing devastating disasters. Therefore, effective control of sorghum aphids is crucial to ensuring sorghum yield and quality.

[0003] The traditional method of preventing and controlling sorghum aphids is to use chemical pesticides. Chemical control is fast-acting, highly effective, and not restricted by geography or time. However, the large-scale use of chemical pesticides will cause environmental pollution and is not in line with the theme of green development. Secondly, pesticide residues in sorghum will cause harm to humans and animals. Long-term use of chemical pesticides will also make aphids resistant and lose their control effects.

[0004] RNA interference (RNAi) refers to the efficient and specific degradation of homologous mRNA by double-stranded RNA (dsRNA) entering the cell, thereby inhibiting and downregulating the expression of target genes. Currently, RNAi technology has been widely studied and applied in the field of modern agriculture. Silencing target genes through artificial feeding, microinjection of dsRNA and nanoparticle-mediated methods has been widely used in the identification and analysis of insect gene functions. Therefore, the discovery of key genes with RNAi biological control in sorghum aphids is of great significance for ensuring my country's food security and environmental safety.

[0005] The information disclosed in this background technology section is only used to deepen the understanding of the background technology of the present disclosure, and should not be regarded as acknowledging or suggesting in any form that the information constitutes the prior art known to those skilled in the art. Summary of the invention

[0006] In view of at least one of the above technical problems, the present disclosure provides a sorghum aphid MsCYP1 The genes, their encoded proteins, dsRNA and applications are intended to solve the technical problem of the lack of key genes in the current use of RNA interference technology for biological control of sorghum aphids.

[0007] According to one aspect of the present disclosure, a sorghum aphid gene is provided. MsCYP1 , whose nucleotide sequence is shown in SEQ ID NO.1.

[0008] According to a second aspect of the present disclosure, a sorghum aphid gene is provided. MsCYP1 The encoded protein has an amino acid sequence as shown in SEQ ID NO.2.

[0009] According to a third aspect of the present disclosure, a method for inhibiting the sorghum aphid gene is provided. MsCYP1 Expressed dsRNA.

[0010] In some embodiments of the present disclosure, the dsRNA is a double-stranded RNA consisting of nucleotides of the sequence shown in SEQ ID NO. 3 and its reverse complementary sequence.

[0011] According to a fourth aspect of the present disclosure, a biological material is provided, which contains the sorghum aphid gene MsCYP1 or said dsRNA.

[0012] In some embodiments of the present disclosure, the biological material includes recombinant DNA, an expression cassette, a plasmid vector, a viral vector or an engineered bacterium.

[0013] According to a fifth aspect of the present disclosure, the sorghum aphid gene MsCYP1 , the encoded protein, the dsRNA or the biological material, used in any one of the following (1) to (6): (1) Controlling sorghum aphids or preparing products for controlling sorghum aphids; (2) Reducing the survival rate of sorghum aphids or preparing products that reduce the survival rate of sorghum aphids; (3) Suppression of sorghum aphid genes MsCYP1 Expression or preparation of aphid-inhibiting gene for sorghum aphid MsCYP1 Products expressed; (4) Modulating the immune response of sorghum and / or the hydrogen peroxide content of sorghum or preparing products that modulate the immune response of sorghum and / or the hydrogen peroxide content of sorghum; (5) Inhibiting sorghum aphid feeding and / or honeydew secretion or preparing products that inhibit sorghum aphid feeding and / or honeydew secretion; (6) Inhibiting the reproduction and / or growth of sorghum aphids or preparing products for inhibiting the reproduction and / or growth of sorghum aphids.

[0014] According to a sixth aspect of the present disclosure, a product is provided, wherein the active ingredient is any one of the following A to D: A. The above sorghum aphid gene MsCYP1 ; B, the above-mentioned encoded protein; C. the above dsRNA; D. the above biological materials; The product has at least one of the following functions (1) to (6): (1) Control of sorghum aphids; (2) Reduce the survival rate of sorghum aphids; (3) Suppression of sorghum aphid genes MsCYP1 Express; (4) modulating sorghum immune responses and / or sorghum hydrogen peroxide content; (5) inhibiting sorghum aphid feeding and / or honeydew secretion; (6) Inhibit the reproduction and / or growth of sorghum aphids.

[0015] One or more technical solutions provided in the embodiments of the present application have at least any of the following technical effects or advantages: 1. We screened out the sorghum aphid protein MsCYP1 that can be secreted into sorghum cells. This protein and its encoding gene can inhibit the hydrogen peroxide content and immune response in sorghum.

[0016] 2. According to Sorghum aphid MsCYP1 The cDNA sequence of the gene was obtained, and the dsRNA targeting the gene was designed. The dsRNA was introduced into the sorghum aphid by artificial feeding, and it was found that it could significantly inhibit the growth of sorghum aphid. MsCYP1 genes, which in turn affect the honeydew secretion (feeding amount) and reproduction rate of sorghum aphids. MsCYP1 The gene can be used as an RNAi target gene for aphid control, which is beneficial to reduce the use of pesticides and maintain ecological balance. BRIEF DESCRIPTION OF THE DRAWINGS

[0017] Figure 1 In one embodiment of this application dsMsCYP1 Agarose gel electrophoresis of dsGFP.

[0018] Figure 2 In one embodiment of the present application, after artificial feeding of dsRNA MsCYP1Analysis results of relative gene expression; dsGFP: sorghum aphids fed with dsGFP; dsMsCYP1: sorghum aphids fed with dsMsCYP1; ** indicates P<0.01, reaching extremely significant difference.

[0019] Figure 3 The results of the analysis of the reproduction rate and honeydew amount of sorghum aphids after artificial feeding in an embodiment of the present application; wherein, A: the result of the amount of honeydew excreted by sorghum aphids after two days of feeding after artificial feeding, B: the number of newly generated sorghum aphids 2, 4, and 6 days after artificial feeding; * indicates P < 0.05, and ** indicates P < 0.01.

[0020] Figure 4 This is the result of expressing the sorghum aphid MsCYP1 protein in sorghum protoplasts in one embodiment of the present application; wherein, GFP-Flag: GFP-Flag fusion protein is expressed in sorghum protoplasts; MsCYP1-Flag: MsCYP1-Flag fusion protein is expressed in sorghum protoplasts.

[0021] Figure 5 In one embodiment of the present application, overexpression MsCYP1 The results of hydrogen peroxide accumulation in sorghum protoplasts; GFP+chitosan: the accumulation of hydrogen peroxide in sorghum protoplasts expressing GFP gene after chitin treatment (control group); MsCYP1+chitosan: chitin treatment expressing MsCYP1 Accumulation of hydrogen peroxide in sorghum protoplasts after expressing the gene; ** indicates P < 0.01. DETAILED DESCRIPTION

[0022] The specific implementation methods of the present invention are described below in conjunction with examples, but the following examples are only used to illustrate the present application in detail and do not limit the scope of the present application in any way.

[0023] Unless otherwise specified, the instruments and equipment involved in the following embodiments are all conventional instruments and equipment; unless otherwise specified, the reagents involved are all commercially available conventional reagents; unless otherwise specified, the detection methods involved are all conventional methods.

[0024] Embodiment 1, sorghum aphid MsCYP1 Isolation of genes In this case, by analyzing the proteome of sorghum after sorghum aphids feed on sorghum, a sorghum aphid protein MsCYP1 that can be secreted into sorghum cells was identified, and primers were designed based on the coding sequence of the protein: MsCYP1-F: 5'-ATGGCGTCCACCACGTTT-3'; MsCYP1-R: 5'-TTAACTCAATTGTCCACA-3'.

[0025] PCR amplification was performed using the cDNA of Sorghum aphid as a template, and a 50µl reaction system of high-fidelity enzyme KOD-FX-Neo (TOYOBO, Japan) was used for amplification. The PCR conditions were: 94℃ pre-denaturation for 2 min; 98℃ denaturation for 10 s, 68℃ annealing and extension for 30 s / kb, 32 cycles. The PCR reaction system is shown in Table 1.

[0026] Table 1 PCR reaction system .

[0027] After PCR amplification, the amplified product was recovered by gel recovery and then connected to pEASY ® -Blunt Zero vector, screen positive clones and sequence them. The sequencing result is shown in SEQ ID NO:1.

[0028] Example 2: Preparation of dsMsCYP1 and its control dsGFP Using the cDNA of sorghum aphid as a template and dsMsCYP1-F and dsMsCYP1-R as primers (the underlined region is the T7 RNA polymerase promoter sequence), PCR amplification was performed to obtain the PCR amplification product.

[0029] F: 5'- TAATACGACTCACTATAGGG TCGAGCTTCGCAGTGATGTT-3′; R: 5'- TAATACGACTCACTATAGGG TGTCCACAATTAGCGACAGTGA-3'.

[0030] Using the GFP-containing plasmid as a template and dsGFP-F and dsGFP-R as primers (the underlined region is the T7 RNA polymerase promoter sequence), PCR amplification was performed to obtain a PCR amplification product.

[0031] F: 5'- TAATACGACTCACTATAGGG ATGGTGAGCAAGGGCGAGGA-3′; R: 5'- TAATACGACTCACTATAGGG TTGAAGTTCACCTTGATGCCGT-3'.

[0032] The above amplified product was ligated to pEASY ® -Blunt Zero vector was sent for sequencing to obtain the correct positive clone, and the clone plasmid was used as a template and amplified with the above primers. The amplified product was purified and recovered to a concentration of 1μg / μL and used as a template for dsRNA synthesis.

[0033] Add 1 μg template, 2 μL 10× T7 Reaction Buffer, 2 μL ATP Solution (75 mM), 2 μL CTP Solution (75 mM), 2 μL GTP Solution (75 mM), 2 μL UTP Solution (75 mM), 2 μL T7 Enzyme Mix, and Nuclease-free Water to a volume of 20 μL. Flick to mix and centrifuge briefly. Place in PCR at 37°C for 4 hours to complete transcription and produce dsRNA.

[0034] Subsequently, nuclease digestion was performed to remove the template DNA and ssRNA: 20 μL dsRNA, 21 μL Nuclease-free Water, 5 μL 10× Digestion Buffer, 2 μL DNase I, and 2 μL RNase were added, mixed thoroughly, centrifuged briefly, and placed in a PCR instrument at 37°C for 1 h to obtain dsRNA from which the template DNA and ssRNA had been removed.

[0035] Finally, filter and recover the dsRNA: 50 μL dsRNA, 50 μL 10× Binding Buffer, 150 μL Nuclease-free Water, 250 μL 100% Ethanol, mix by inversion, add to the filter, centrifuge for 2 min, wash with 500 μL Wash Solution, add 50 μL Elution Solution, centrifuge for 2 min to obtain dsRNA, and use NANOdrop UV spectrophotometer and agarose gel electrophoresis to detect concentration and purity. If the detected band is a single bright band, such as Figure 1 As shown, and its OD260 / 280 is between 1.8-2.0, it indicates that the dsRNA quality is good. The dsRNA is adjusted to 250 ng / μL and stored at -20℃ for later use.

[0036] Example 3: Artificial feeding and effect detection of dsMsCYP1 and dsGFP Preparation of sorghum aphids: Take sorghum aphids of uniform size that are reared on BTx623 sorghum seedlings, place them in a petri dish, and starve them for 12 h. Artificial feeding: prepare 15% sucrose water and mix it with dsRNA in a 1:1 ratio to make artificial feed, and use artificial feeding to introduce dsMsCYP1 into sorghum aphids.

[0037] Sampling began 24 h after artificial feeding of sorghum aphids, with 5 aphids as one replicate and repeated 3 times. At the same time, sorghum aphids fed with dsGFP were taken as controls, and changes in gene expression were verified by qRT-PCR.

[0038] The specific operation is as follows: After sampling, RNA was extracted and reversed with Invitrogen SuperScript II reverse transcriptase (Cat. No. 18064014) according to the instructions to obtain cDNA products. The cDNA product was diluted 10 times with water, and then the reaction system was prepared according to the instructions of SYBRHPremix ExTaqTM II (TaKaRa) and real-time quantitative PCR was performed on the Roche LightCycler 480 instrument. Real-time quantitative PCR reaction conditions: 95℃ pre-denaturation for 1 min, 95℃ denaturation for 10 s, 60℃ annealing and extension for 30 s, and the latter two steps were repeated for 40 cycles, and finally 65℃-95℃, increasing 0.5℃ each step, and 5s for melting curve to determine the specificity of the amplified product.

[0039] Primers for internal reference gene actin: Actin-F: 5'-TGTGACGATGATGTAGCAGCTT-3'; Actin-R: 5'-TACCGACCATGACTCCTTGATG-3'.

[0040] MsCYP1 quantitative primers: QMsCYP1-F: 5'-ACTGCTCCACTCCGAATCAC-3'; QMsCYP1-R: 5'-TCGGGAGACTCATTTTTGGCA-3'.

[0041] The results are as follows Figure 2 As shown, compared with the control group fed with dsGFP, the sorghum aphids fed with dsMsCYP1 had MsCYP1 The relative expression level of the gene was significantly reduced, with a very significant difference compared with the control (P<0.01). This indicates that artificial feeding of dsMsCYP1 can cause MsCYP1 RNA interference of genes leads to a significant decrease in gene expression.

[0042] Example 4: Phenotypic detection of sorghum aphids after artificial feeding Sorghum aphid honey dew experiment: Sorghum aphids fed with dsMsCYP1 were placed in a culture dish (a layer of filter paper soaked in water was laid in the dish), and a 2 cm sorghum seedling stem was placed. After two days, the filter paper was removed and stained with 0.1% ninhydrin. ImageJ was used to calculate the stained area. Three aphids were used each time and repeated five times. The results are shown in the figure. Figure 3As shown in the figure, the amount of honey dew in sorghum aphids after feeding with dsMsCYP1 was significantly reduced. MsCYP1 The expression level of the gene affects the feeding of sorghum aphids.

[0043] Sorghum aphid reproduction rate experiment: Sorghum aphids were divided into two groups, one artificially fed with dsGFP and the other artificially fed with dsMsCYP1. After 24 hours of feeding, they were put back on the sorghum seedlings BTx623. Ten aphids were placed each time, and the experiment was repeated 5 times. The results are shown in the figure. Figure 3 As shown, the aphid production of sorghum aphids artificially fed with dsMsCYP1 was significantly lower than that of sorghum aphids artificially fed with dsGFP from the 4th day of feeding, indicating that dsMsCYP1 can inhibit the reproduction of sorghum aphids.

[0044] Example 5: Sorghum aphid MsCYP1 Construction of gene expression vector Containing MsCYP1 The plasmid of the gene was used as a template and amplified using the high-fidelity enzyme KOD-FX-Neo (TOYOBO, Japan) and primers EMsCYP1-F and EMsCYP1-R (the underlined region is the linker sequence for constructing the vector). MsCYP1 ORF sequence of the gene.

[0045] F: 5'- AGATCCAGTGGGATCC ATGGCGTCCACCACGTTTCG-3′; R: 5'- TTATAGTCAAGCTTGGTACC ACTCAATTGTCCACAATT-3'.

[0046] After PCR amplification, the gene was connected to the vector pHZ-206 (with a Flag tag) using the In-Fusion cloning kit (TaKaRa, Japan) to construct the recombinant plasmid MsCYP1-Flag, which was then transformed into the DH5α Escherichia coli strain, single clones were picked, positive clones were identified by PCR and sent for sequencing, and the recombinant plasmids with correct sequencing were saved.

[0047] Example 6: Sorghum aphid MsCYP1 Verification of sorghum cell immune function after gene overexpression Combined with the maize protoplast preparation method (Coy et al. Protoplast Isolation and Transfection in Maize. In: Wang, K., Zhang, F. (eds) Protoplast Technology. Methods in Molecular Biology. 2022. 2464.), the sorghum protoplast preparation was optimized as follows: sorghum seedlings grown on 1 / 2 MS medium for 14 days were selected, the young stems were cut into 0.5 cm small segments, and placed in enzymatic hydrolysis solution (10 mM MES-KOH, 0.6 M D-mannitol, 1.5% w / v Cellulase R-10, 0.75% w / v Macerozyme R-10, 0.1% w / v BSA, 1 mM CaCl2), 28 ℃, 80 rpm, enzymatic hydrolysis for 4 h, and sorghum protoplasts were collected. The recombinant plasmid MsCYP1-Flag in Example 5 was introduced into sorghum protoplasts using the sorghum protoplast transient transformation system to express the recombinant protein MsCYP1-Flag in sorghum protoplasts, with GFP-Flag as a control. After transformation, the cells were cultured at 28°C for 16 h, and sorghum protoplast proteins were extracted for western blot detection. The results are as follows: Figure 4 As shown in the figure, the sorghum aphid MsCYP1 protein can be stably expressed in sorghum cells. MsCYP1 Genes and controls GFP After transformation and culture for 16 h, 0.04% chitin was added for 8 h, and the protoplast cells were collected. The hydrogen peroxide content was determined using a hydrogen peroxide content kit (Ke Ming Biotechnology). Figure 5 As shown in the figure, after chitin treatment, the hydrogen peroxide content of protoplasts expressing MsCYP1 protein decreased significantly, indicating that MsCYP1 Genes can suppress sorghum cellular immune responses.

[0048] Although some preferred embodiments of the present invention have been described, those skilled in the art may make other changes and modifications to these embodiments once they have learned the basic creative concept. Therefore, the appended claims are intended to be interpreted as including the preferred embodiments and all changes and modifications that fall within the scope of the present invention.

[0049] Obviously, those skilled in the art can make various changes and modifications to the present invention without departing from the spirit and scope of the inventive concept. Thus, if these modifications and variations of the present application fall within the scope of the claims of the present application and their equivalents, the present application is also intended to include these modifications and variations.

Claims

1. A sorghum aphid gene MsCYP1 , characterized in that, Its nucleotide sequence is shown in SEQ ID NO.

1.

2. A sorghum aphid gene according to claim 1 MsCYP1 The encoded protein is characterized in that Its amino acid sequence is shown in SEQ ID NO.

2.

3. Inhibition of the sorghum aphid gene of claim 1 MsCYP1 Expressed dsRNA.

4. The dsRNA according to claim 4, characterized in that It is a double-stranded RNA composed of nucleotides of the sequence shown in SEQ ID NO. 3 and its reverse complementary sequence.

5. A biological material containing the sorghum aphid gene according to claim 1 MsCYP1 Or the dsRNA according to claim 3.

6. The biomaterial according to claim 5, characterized in that The biological material includes recombinant DNA, expression box, plasmid vector, virus vector or engineering bacteria.

7. The sorghum aphid gene of claim 1 MsCYP1 , the coding protein according to claim 2, the dsRNA according to claim 3 or the biological material according to claim 5, for use in any one of the following (1) to (6): (1) Controlling sorghum aphids or preparing products for controlling sorghum aphids; (2) Reducing the survival rate of sorghum aphids or preparing products that reduce the survival rate of sorghum aphids; (3) Suppression of sorghum aphid genes MsCYP1 Expression or preparation of aphid-inhibiting gene for sorghum aphid MsCYP1 Products expressed; (4) Modulating the immune response of sorghum and / or the hydrogen peroxide content of sorghum or preparing products that modulate the immune response of sorghum and / or the hydrogen peroxide content of sorghum; (5) Inhibiting sorghum aphid feeding and / or honeydew secretion or preparing products that inhibit sorghum aphid feeding and / or honeydew secretion; (6) Inhibiting the reproduction and / or growth of sorghum aphids or preparing products for inhibiting the reproduction and / or growth of sorghum aphids.

8. Products whose active ingredient is any one of the following A to D: A. The sorghum aphid gene of claim 1 MsCYP1 ; B. The encoded protein according to claim 2; C. The dsRNA according to claim 3; D. The biological material according to claim 5; The product has at least one of the following functions (1) to (6): (1) Control of sorghum aphids; (2) Reduce the survival rate of sorghum aphids; (3) Suppression of sorghum aphid genes MsCYP1 Express; (4) modulating sorghum immune responses and / or sorghum hydrogen peroxide content; (5) inhibiting sorghum aphid feeding and / or honeydew secretion; (6) Inhibit the reproduction and / or growth of sorghum aphids.

Images