Construction method and application of spontaneous mouse encephaledema model

Abstract

The invention relates to the field of animal models and application thereof, in particular to a construction method and application of a spontaneous mouse encephaledema model. The method comprises the following steps: mating a PEN2fl / + mouse with a PEN2fl / + mouse to obtain a PEN2fl / fl homozygote mouse; then, the obtained PEN2fl / fl mouse and an hGFAPCre / + mouse are subjected to mating, and PEN2fl / + is obtained; an hGFAPCre / + mouse; finally, obtaining PEN2fl / +; the hGFAPCre / + mouse and a PEN2fl / fl mouse are subjected to mating, and PEN2fl / fl is obtained; the hGFAPCre / + mouse model is a spontaneous mouse encephaledema model. The protein level of PEN2 in the spontaneous mouse encephaledema model is remarkably reduced, and a severe encephaledema phenotype is shown. The model can be used for establishing a cerebral edema drug screening platform, and can also be used for research on cerebral edema related diseases, such as pathogenesis research on cerebral edema caused by infection, glioma, traumatic brain injury and the like, and research and development of technologies and products for diagnosis and treatment of related diseases.

Description

Technical Field

[0001] The invention relates to an animal model and its application field, and in particular to a method for constructing a spontaneous mouse brain edema model and its application. Background Art

[0002] Brain edema, as a common complication in pathological processes such as craniocerebral injury, cerebrovascular disease and intracranial infection, has a high morbidity and mortality rate, which has become a major challenge that needs to be urgently addressed in the field of global public health. The pathogenesis of brain edema is complex and diverse, mainly involving multiple links such as increased permeability of the blood-brain barrier, metabolic disorders of brain tissue, activation of inflammatory responses and toxic damage to nerve cells. These factors work together to cause an abnormal increase in the water content of neural tissue, which in turn causes increased intracranial pressure, affects brain tissue blood perfusion, and ultimately causes irreversible neuronal damage or even death. Especially after traumatic brain injury (TBI), the rapid development and spread of brain edema is often one of the key factors leading to poor prognosis of patients.

[0003] At present, although some progress has been made in the treatment of cerebral edema in clinical practice, most of them focus on symptom relief, such as reducing intracranial pressure through diuretics and surgical decompression, and lack direct and effective treatment methods for the cause. Therefore, the development of new and efficient drugs for the treatment of cerebral edema has become an important direction of medical research. The key to drug development lies in efficient and reliable disease models to simulate human disease states and evaluate drug efficacy and safety. However, traditional mouse models of cerebral edema, such as models induced by intracranial injection of pathogens or physical injury, have many limitations. These models often cannot fully simulate the pathophysiological changes in the natural course of disease, and the degree of occurrence, progression rate and spatial distribution of cerebral edema vary greatly, which affects the repeatability and accuracy of drug screening results. Therefore, establishing a mouse model of spontaneous cerebral edema that is closer to clinical practice is of great significance for accelerating the development of drugs for the treatment of cerebral edema. Summary of the invention

[0004] The technical problem to be solved by the present invention is to provide a spontaneous mouse brain edema model and a construction method thereof in view of the lack of existing brain edema mouse models in the prior art.

[0005] The technical problem that the present invention needs to solve is to provide the application of the above-mentioned spontaneous mouse brain edema model.

[0006] In order to solve the above technical problems, the technical solution adopted by the present invention is as follows:

[0007] A spontaneous mouse brain edema model and a method for constructing the same, comprising the following steps:

[0008] (1) PEN2 fl / + Mice and PEN2 fl / +Mating of mice to obtain PEN2 fl / fl Homozygous mice;

[0009] (2) PEN2 obtained in step (1) fl / fl Mouse and hGFAP Cre / + Mating of mice to obtain PEN2 fl / + ;hGFAP Cre / + Mice;

[0010] (3) PEN2 obtained in step (2) fl / + ;hGFAP Cre / + Mice and PEN2 fl / fl Mating of mice to obtain PEN2 fl / fl ;hGFAP Cre / + Mouse (abbreviated as PEN2 ΔhGFAP ), which is the spontaneous mouse brain edema model.

[0011] Among them, the PEN2 fl / + The mouse is a loxp transgenic heterozygous mouse, which is obtained by adding loxp1 site and loxp2 site to the intron region on both sides (776bp-1210bp) of the third and fourth exons of the presenilin enhancer 2 protein genome (NC_000073.7) in C57BL / 6 mice; the hGFAP Cre / + Mouse astrocyte-specific Cre recombinase mice were purchased from The Jackson Laboratory.

[0012] Wherein, the spontaneous mouse brain edema model is a mouse in which the presenilin enhancer 2 in astrocytes is knocked out.

[0013] Specifically, the mouse with knockout of presenilin enhancer 2 in astrocytes is specifically astrocyte-specific expression of Cre recombinase mouse hGFAP Cre / + Knockout of the third and fourth exons in the gene encoding the presenilin enhancer 2 protein.

[0014] Specifically, the mRNA sequence of the protein coding gene of the presenilin enhancer 2 is Accession: NM_001364016.1 in Gene Bank, and the genome sequence is Accession: NC_000073.7 in Gene Bank.

[0015] Wherein, the spontaneous mouse brain edema model is subjected to genotype identification using double PCR.

[0016] Specifically, the specific primers used in the dual PCR include primers for identification of loxp mouse tails and primers for identification of Cre mouse tails.

[0017] Specifically, the primers for identifying the loxp mouse tail are: F: GACCCGTAGAAGAGCAGTCAGT and R: ATAAAGAATAGGCTGGGTGGTG.

[0018] Specifically, the primers for identifying the Cre mouse tail are F: ATCGCCATCTTCCAGCAGGC and R: AAAACGCTGGTTAGCACCGC.

[0019] The application of the spontaneous mouse brain edema model constructed by the method for constructing the spontaneous mouse brain edema model in studying brain edema diseases is also within the scope of protection of the present invention.

[0020] The use of the spontaneous mouse cerebral edema model constructed by the method for constructing the spontaneous mouse cerebral edema model in developing drugs for preventing and / or treating cerebral edema is also within the scope of protection of the present invention.

[0021] The use of the spontaneous mouse cerebral edema model constructed by the method for constructing the spontaneous mouse cerebral edema model in screening drugs for preventing and / or treating cerebral edema is also within the scope of protection of the present invention.

[0022] Beneficial effects:

[0023] (1) The present invention specifically expresses Cre recombinase in astrocytes to express mouse hGFA PCre / + A spontaneous mouse brain edema model (i.e., astrocyte conditional knockout PEN2 mice, abbreviated as PEN2) was constructed. ΔhGFAP ), the mice began to develop brain edema in the cerebral cortex at 8 days after birth, and at 11 days after birth, the cerebral cortex was completely dissolved by water, showing a severe brain edema phenotype.

[0024] (2) Compared with the commonly used hydrocephalus model construction method, the astrocyte conditional knockout PEN2 mouse constructed by the construction method provided by the present invention has the advantages of spontaneous cerebral edema, small individual differences, few interfering factors, fast breeding speed and low cost.

[0025] (3) Currently, there are few brain edema models, which mainly use physical injury methods, such as physical blows, contusions or clamping of brain or spinal cord tissues. The model is complicated to make, the injury area is difficult to control, and the model is uneven, which affects its application in drug screening. The brain edema model of astrocyte conditional knockout PEN2 mice provided by the present invention has the following characteristics: 1) no pathogen or traumatic modeling is required, stable reproduction can be achieved, and spontaneous brain edema phenotype; 2) the experimental technology requirements are not high and easy to control, which can avoid the death of mice caused by operation and other reasons during the modeling process, and the brain edema area is uneven; 3) the individual astrocyte conditional knockout PEN2 mice are lighter and smaller than normal mice, and the brain edema phenotype is easy to detect, which can be used to determine the area and area of ​​brain edema, and the model has high credibility; 4) the individual differences between the same genotype mice in the gene knockout background are small, etc.

[0026] (4) The present invention induces brain edema in mice by conditionally knocking out PEN2 through manipulating astrocytes, which has significant innovation and good application prospects. It can be used to establish a drug screening platform for brain edema. At the same time, it can be used for the study of diseases related to brain edema, such as infection, glioma, traumatic brain injury, etc., and the study of the pathogenesis of brain edema, as well as the development of technologies and products for the diagnosis and treatment of related diseases. BRIEF DESCRIPTION OF THE DRAWINGS

[0027] The present invention will be further described in detail below with reference to the accompanying drawings, and the above and / or other advantages of the present invention will become more clear.

[0028] Figure 1 For PEN2 ΔhGFAP Schematic diagram of the mating process in mice.

[0029] Figure 2 For PEN2 ΔhGFAP Electropherograms of mouse genotype identification.

[0030] Figure 3 For PEN2 ΔhGFAP Protein level validation of the PEN2 knockout effect in the mouse cerebral cortex.

[0031] Figure 4 For wild-type mice (WT) and PEN2 ΔhGFAP Diagram of the mouse brain anatomy.

[0032] Figure 5 For wild-type mice (WT) and PEN2 ΔhGFAP Nissl staining of mouse brain sections was used to evaluate the results.

[0033] Figure 6 For wild-type mice (WT) and PEN2 ΔhGFAP Results of imaging assessment of mice. DETAILED DESCRIPTION

[0034] The present invention will be further described in detail below in conjunction with specific implementations, and the above and / or other advantages of the present invention will become more clear.

[0035] The experimental methods described in the following examples are conventional methods unless otherwise specified; the reagents and materials described are commercially available unless otherwise specified.

[0036] In the following examples, mouse breeding and experiments were performed under protocols approved by the Animal Care and Use Committee of Gulou Hospital. All experiments were performed in accordance with the Guide for the Care and Use of Laboratory Animals of Gulou Hospital.

[0037] In the following embodiments, the male and female parents used for breeding are 2 to 12 months old; the mouse breeding conditions are: a specific pathogen-free (SPF) grade breeding room, a room temperature of 22°C ± 2°C, a humidity of 55 to 65%, 12-hour light and dark alternation, moderate light intensity, and good ventilation and cleanliness; the feed used is: a complete nutritional granular feed provided by Jiangsu Collaborative Pharmaceutical Biotechnology Co., Ltd.

[0038] Example 1: Preparation and genotype identification of astrocyte conditional knockout PEN2 mice

[0039] 1. Experimental Materials

[0040] All primers in the examples were synthesized by Qingke Biotechnology Co., Ltd.

[0041] In the following embodiments, the hGFAP Cre / + The mice are astrocyte-specific Cre recombinase mice, the English name is FVB-Tg (GFAP-cre) 25Mes / JStrain #004600, purchased from The Jackson Laboratory. This strain of mice is a transgenic mouse with a Cre recombinase gene driven by the human glial fibrillary acid protein (hGFAP) promoter, which is specifically expressed in astrocytes. After mating with loxp transgenic heterozygous mice, Cre-mediated recombination can delete the target gene sequence. These deletions are cell-specific and only occur in astrocytes. hGFAP Cre / + The specific preparation method of mice has been disclosed in the article hGFAP-cre transgenic mice for manipulation of glialand neuronal function in vivo (DOI: 10.1002 / gene.10008).

[0042] The PEN2 fl / +The mice are loxP transgenic heterozygous mice, which are obtained by adding loxP1 sites and loxP2 sites to the intronic regions on both sides (776bp-1210bp) of the third and fourth exons of the presenilin enhancer 2 protein genome (NC_000073.7) in C57BL / 6 mice, respectively. The specific preparation method has been disclosed in the article Conditional inactivation of Pen-2 in the developing neocortex leads to rapid switch of apical progenitors to basal progenitors (DOI: 10.1523 / JNEUROSCI.2523-18.2019).

[0043] The antibody PEN2 (A8678) was purchased from Abclonal, and the antibody α-Tubulin (K200064) was purchased from Solarbio.

[0044] The mouse tail lysis solution: Solution A: 25 mM Tris-HCL (pH 8.0), 10 mM EDTA; Solution B: 200 mM NaOH, 1% (W / V) SDS.

[0045] The 2×Tap Master mix (Dye plus) (P112) was purchased from Vazyme.

[0046] 2. Astrocyte conditional knockout PEN2 mice (PEN2 ΔhGFAP )

[0047] 2.1、PEN2 fl / + Mice and PEN2 fl / + Mating of mice to obtain PEN2 fl / fl Homozygous mice;

[0048] 2.2, PEN2 obtained in step 2.1 fl / fl Mouse and hGFAP Cre / + Mating of mice to obtain PEN2 fl / + ;hGFAP Cre / + Mice;

[0049] 2.3. PEN2 obtained in step 2.2 fl / + ;hGFAP Cre / + Mice and PEN2 fl / fl Mating of mice to obtain PEN2 fl / fl ;hGFAP Cre / + Mouse.

[0050] As Cre recombinase binds to the loxP site, gene deletion occurs. fl / + ;hGFAP Cre / + The mice were heterozygous for astrocyte-specific knockout of the PEN2 gene; PEN2 fl / fl ;hGFAP Cre / + The mice were homozygous for astrocyte-specific knockout of the PEN2 gene, abbreviated as PEN2 ΔhGFAP PEN2 ΔhGFAP The mating flow chart of mice is shown in Figure 1.

[0051] 3. Mouse genotype identification

[0052] From PEN2 fl / fl Mouse, PEN2 fl / + ;hGFAP Cre / + PEN2 fl / fl ;hGFAP Cre / + (PEN2 ΔhGFAP ) and cut off a 0.5 cm tail, added 100 μL of rat tail lysis buffer A, heated and lysed at 95°C for 15 min, cooled to room temperature, added 100 μL of rat tail lysis buffer B, centrifuged at 12000 rpm for 5 min, and took the supernatant for PCR amplification using primers to identify PEN2 ΔhGFAP The genotype of mice was PEN2 fl / + Mouse or PEN2 fl / + ;hGFAP Cre / + The mice were wild type (WT).

[0053] The primers include primers for identification of loxp mouse tail and primers for identification of Cre mouse tail.

[0054] The primers for loxP mouse tail identification are as follows:

[0055] F: GACCCGTAGAAGAGCAGTCAGT; R: ATAAAGAATAGGCTGGGTGGTG

[0056] The primers for Cre mouse tail identification are as follows:

[0057] F: ATCGCCATCTTCCAGCAGGC; R: AAAACGCTGGTTAGCACCGC

[0058] According to the knockout principle of loxp sites and Cre recombinase, the genotype of breeding mice can be determined by simply detecting the presence or absence of loxp sites and Cre recombinase in the genome. ΔhGFAPThe results of mouse tail genotyping are as follows Figure 2 As shown, the primers identified in the loxP mouse tail were used for amplification: PEN2 fl / + =533 bp and 468 bp; PEN2 fl / fl =533bp; PEN2 + / + =468 bp; amplified using primers identified from Cre mouse tail, hGFAP Cre / + =429 bp, hGFAP + / + =0bp. If the primers identified by loxp mouse tail amplify a 533bp band, and the primers identified by Cre mouse tail amplify a 429bp band, the mouse is PEN2 ΔhGFAP Mouse. Figure 2 Counting from left to right, lanes 1 and 6 are PEN2 ΔhGFAP Electrophoresis bands of mice.

[0059] 4. Western blotting to verify PEN2 ΔhGFAP Effects of PEN2 knockout in mice

[0060] 4.1. Isolation and protein extraction of mouse cerebral cortex

[0061] Wild-type (WT) and PEN2 cells at 7 days postnatal age were collected. ΔhGFAP The mouse cerebral cortex was added with 300 μL of RIPA lysis buffer, homogenized with a homogenizer, and placed on ice for 15 minutes to allow the tissue to be fully lysed. Then, the supernatant was taken and the protein concentration was determined using a BCA quantitative kit; a total protein loading of 30 μg was prepared.

[0062] 4.2. Verification of the knockout effect of PEN2 in the cerebral cortex of PEN2 cKO mice

[0063] Using wild type (WT) and PEN2 ΔhGFAP Mouse cerebral cortex protein samples were subjected to 12.5% ​​SDS-PAGE electrophoresis (80v, 30min; 100v, 90min), the protein bands were transferred to NC membrane (ice bath; 100v, 90min), the NC membrane was blocked with 5% skim milk (60min), incubated with primary antibody (overnight), incubated with horseradish peroxidase HRP-labeled secondary antibody (60min), and developed with enhanced chemiluminescence reagent (ECL) and exposed.

[0064] The results of Western blotting to detect PEN2 protein levels are shown in Figure 3 As shown, compared with wild-type (WT) mice, PEN2 ΔhGFAP The protein level of PEN2 in the cerebral cortex of mice was significantly downregulated, proving that the knockout effect of PEN2 in the cerebral cortex was significant.

[0065] Example 2: Phenotypic verification of brain edema in astrocyte conditional knockout PEN2 mice

[0066] 1. Experimental Materials

[0067] 1.1. Experimental reagents: 4% PDF fixative, sucrose, anti-slip slides, and Leica 819 pathology blades were purchased from Nanjing Yifeixue Biotechnology Co., Ltd. OCT embedding medium (4583) and Nissl staining kit (methyl violet method) (G1432) were purchased from Solarbio.

[0068] 1.2 Experimental animals: Wild-type (WT) mice and PEN2 mice 7 to 12 days after birth ΔhGFAP Mice were used for experiments.

[0069] 2. Experimental methods

[0070] 2.1. Anatomical observation of WT and PEN2 ΔhGFAP Morphology of brain edema in the mid-cerebral cortex of mice

[0071] WT and PEN cKO mice were collected at 9 and 11 days after birth, their brains were removed, and photos of the mouse brains were taken under natural light using a Xiaomi mobile phone (Redmi K70pro).

[0072] WT and PEN2 ΔhGFAP Mouse brain anatomy Figure 4 As shown, after taking a photo, it was shown that at 9 days after birth, PEN2 ΔhGFAP The cerebral cortex of mice showed depression, indicating that the cortical parenchyma was edematous; at 11 days after birth, PEN2 ΔhGFAP The cerebral cortex of mice dissolved due to edema.

[0073] 2.2 Nissl staining for WT and PEN2 ΔhGFAP Morphology of brain edema in the mid-cerebral cortex of mice.

[0074] WT and PEN2 cells were collected at 7 and 9 days after birth ΔhGFAP The brain of mice was removed and fixed with 4% paraformaldehyde (PFA) overnight. After dehydration with 30% sucrose solution, it was embedded with OCT embedding agent and sliced. The slices were dried in a 37°C oven, washed twice with 1× PBS buffer, placed in Nissl staining reagent for 1 min, taken out, washed twice with clean water, dried and sealed.

[0075] WT and PEN2 cells were collected at 7 and 9 days after birth ΔhGFAP Mouse brain, sectioning, Nissl staining and microscopic imaging. Figure 5 It was shown that at 7 days after birth, PEN2 ΔhGFAPMice did not show brain edema phenotype; at 9 days after birth, PEN2 ΔhGFAP The mice showed significant brain edema in the cerebral cortex.

[0076] 2.3 Imaging Assessment of WT and PEN2 ΔhGFAP Brain edema in mice.

[0077] T2-weighted MRI data were collected using a high-field PET-MRI dual-modality small animal imaging system (Bruker 9.4T BioSpec 94 / 30MRI & PET Insert). ΔhGFAP Mice were anesthetized with 1.25% tribromoethanol (20 μL / g / mouse) and placed in an 86 mm magnet aperture device for scanning. The breathing of the rats was monitored in real time during the imaging process. The specific parameters were as follows: field-of-view was 1.6 cm × 1.6 cm, 28 consecutive slices were obtained in the coronal direction, each slice thickness was 0.6 mm, echo time was 33 ms, repetition time was 2802.49 ms, relaxation enhancement factor was 8, number of averages was 2, matrix size was 192 mm × 192 mm, and in-plane resolution was 0.141 mm × 0.141 mm.

[0078] Coronal sections of the cerebral cortex of WT and PEN2 cKO mice were collected using T2-weighted MRI data at 11 days after birth. ΔhGFAP Significant high water molecule signals appeared in the cerebral cortex of mice ( Figure 6 Compared with wild-type mice, PEN2 ΔhGFAP The proportion of water molecule signals in the total brain area of ​​mice increased significantly ( Figure 6 (right picture in the figure).

[0079] Comparison: Comparison of commonly used methods for constructing hydrocephalus animal models

[0080] The commonly used methods for constructing hydrocephalus animal models are compared, and the details are shown in Table 1.

[0081] Table 1 Comparison of modeling methods for hydrocephalus animals

[0082]

[0083]

[0084] Combined with the above comparison, the method for constructing the brain edema model of the present invention is simple to operate, low in cost, and the results are easy to observe. The constructed brain edema model has 1) no pathogen or traumatic modeling is required, stable reproduction can be achieved, and spontaneous brain edema phenotype; 2) the experimental technology requirements are not high and easy to control, which can avoid the death of mice caused by operation and other reasons during the modeling process, and the uneven area of ​​brain edema; 3) the individual PEN2 mice with conditional knockout of astrocytes are lighter and smaller than normal mice, and the brain edema phenotype is easy to detect, which can be used to judge the area and area of ​​brain edema, and the model has high credibility; 4) the individual differences of the same genotype mice in the gene knockout background are small.

[0085] The present invention provides a method for constructing a spontaneous mouse brain edema model and its application ideas and methods. There are many methods and ways to implement the technical solution. The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, without departing from the principle of the present invention, several improvements and modifications can be made, and these improvements and modifications should also be regarded as the protection scope of the present invention. All components not specified in this embodiment can be implemented by existing technologies.

Claims

1. A method for constructing a spontaneous mouse brain edema model, characterized in that: The steps include: (1) PEN2 fl / + Mice and PEN2 fl / + Mating of mice to obtain PEN2 fl / fl Homozygous mice; (2) PEN2 obtained in step (1) fl / fl Mouse and hGFAP Cre / + Mating of mice to obtain PEN2 fl / + ;hGFAP Cre / + Mice; (3) PEN2 obtained in step (2) fl / + ;hGFAP Cre / + Mice and PEN2 fl / fl Mating of mice to obtain PEN2 fl / fl ;hGFAP Cre / + Mice, namely the spontaneous mouse brain edema model; Among them, the PEN2 fl / + The mice are loxp transgenic heterozygous mice; the hGFAP Cre / + Mice expressing Cre recombinase specifically in astrocytes.

2. The construction method according to claim 1, characterized in that: The spontaneous mouse brain edema model is a mouse in which the presenilin enhancer 2 in astrocytes is knocked out.

3. The construction method according to claim 2, characterized in that: The mouse for knocking out presenilin enhancer 2 in astrocytes, specifically by astrocyte-specific expression of Cre recombinase mouse hGFAP Cre / + Knockout of the third and fourth exons of the gene encoding the presenilin enhancer 2 protein.

4. The construction method according to claim 2 or 3, characterized in that: The mRNA sequence of the protein coding gene of the presenilin enhancer 2 is Accession: NM_001364016.1 in Gene Bank, and the genome sequence is Accession: NC_000073.7 in Gene Bank.

5. The construction method according to claim 1, characterized in that: The spontaneous mouse brain edema model was used for genotyping using dual PCR; The specific primers used in the double PCR include primers for identification of loxp mouse tail and primers for identification of Cre mouse tail.

6. The construction method according to claim 5, characterized in that: The primers for identifying the loxp mouse tail are: F: GACCCGTAGAAGAGCAGTCAGT and R: ATAAAGAATAGGCTGGGTGGTG.

7. The construction method according to claim 5, characterized in that: The primers for identifying the Cre mouse tail are F: ATCGCCATCTTCCAGCAGGC and R: AAAACGCTGGTTAGCACCGC.

8. Application of the spontaneous mouse brain edema model constructed by the construction method of claim 1 in studying brain edema diseases.

9. Use of the spontaneous mouse brain edema model constructed by the construction method of claim 1 in developing drugs for preventing and / or treating brain edema.

10. Use of the spontaneous mouse brain edema model constructed by the construction method of claim 1 in screening drugs for preventing and / or treating brain edema.

Images