Method for rapidly and economically carrying out gene function analysis on lepidoptera insects and application

Abstract

The invention relates to the technical field of gene engineering, in particular to a method for rapidly and economically carrying out gene function analysis on lepidoptera insects and application. The method comprises the following steps: designing four different sgRNAs by aiming at an exon region of a target gene, and constructing a sgRNAs synthetic primer mixing pool; 4 different sgRNA-DNA templates are synthesized at the same time, 4 different sgRNAs are further synthesized at the same time, and a sgRNAs mixed pool is formed; the sgRNAs-Cas9 protein and Cas9 protein are prepared into an sgRNAs-Cas9 compound, and the sgRNAs-Cas9 compound is microinjected into newly laid eggs; after the injected eggs develop into larvae, genome DNA is extracted, sgRNAs targeted areas are amplified, the mutation rate of target genes is determined through T7E1 enzyme digestion, and phenotype analysis is conducted on the larvae. According to the method, the mutation rate of the target gene is increased through redundant targeting of the four sgRNAs, so that functional analysis of the target gene is quickly realized in the G0 generation, and the research period of the gene function of the lepidoptera insects is greatly shortened. Besides, four different sgRNAs are synthesized at the same time by constructing a primer mixing pool of a plurality of sgRNAs, so that the economic cost for synthesizing the sgRNAs is greatly reduced.

Description

Technical Field

[0001] The invention relates to the technical field of genetic engineering, and relates to a method for rapidly and economically carrying out gene function analysis of lepidopteran insects and its application. Background Art

[0002] Lepidoptera is the second largest order of Insecta, with more than 180,000 known species worldwide. Lepidoptera insects are widely distributed, and most of their larvae feed on plant leaves and tissues. They have a wide host range, reproduce quickly, cause heavy damage, have strong pesticide resistance, and migrate over long distances, causing serious damage to agriculture and forestry around the world. As a major agricultural and forestry country, my country suffers economic losses of tens of billions of yuan each year due to pests, and there is an urgent need to develop new green and efficient pest control technologies. Conducting research on the gene functions of Lepidoptera insects and identifying new genes that can be used for pest control can provide an important basis for the development of new green and efficient pest control strategies.

[0003] RNAi is an important technology for studying gene function. The action of RNAi starts with the recognition and cleavage of dsRNA by Dicer protein to form small interfering siRNA, followed by the binding of siRNA to AGO protein to form RNA-induced silencing complex (RISC), and finally RISC binds to and cleaves the target gene mRNA, resulting in silencing of target gene expression. RNAi is widely used in the study of gene function at the cellular and in vivo levels. A large number of studies have shown that there are large differences in the efficiency of RNAi in different insects. In Coleopteran insects, RNAi can systematically and efficiently achieve gene silencing, so RNAi is widely used in the study of gene function in Coleopteran insects and field control of Coleopteran pests. However, due to factors such as poor stability of dsRNA, low efficiency of dsRNA uptake by cells and intracellular transport of dsRNA, and slow rate of dsRNA processing into siRNA, the efficiency of RNAi in Lepidoptera insects is generally low, which greatly restricts the study of gene function in Lepidoptera insects, especially in non-model Lepidoptera insects.

[0004] The CRISPR / Cas9 gene editing system is another widely used gene function analysis technology. By designing target gene-specific sgRNA and introducing the sgRNA / Cas9 complex into cells, the Cas9 nuclease can be guided to cut at a specific site of the target gene to form a double-strand break. Subsequently, the broken double strands are repaired by non-homologous end joining, and base insertions or deletions are often introduced in this process, eventually causing frameshift mutations in the target gene. At present, this technology has been widely used in functional genomics research in model animals. Although there have been reports of this technology being applied to gene function research in lepidopteran insects such as cotton bollworm, diamondback moth, and fall armyworm, the current methods generally have the disadvantages of low editing efficiency, high cost of identifying genotypes, and long cycle for constructing homozygous mutant strains. In addition, this technology cannot be used to conduct gene function analysis for homozygous lethal genes. Therefore, it is of great value to optimize the CRISPR / Cas9 gene editing technology in lepidopteran insects and develop a fast and economical gene function analysis method system. Summary of the invention

[0005] The invention aims at the problems existing in the existing research methods of gene functions of lepidopteran insects and provides a method for rapidly and economically carrying out gene function analysis of lepidopteran insects.

[0006] The purpose of the present invention is achieved through the following technical solutions:

[0007] A method for rapidly and economically conducting gene function analysis in lepidopteran insects comprises the following steps:

[0008] 1) Design 4 different sgRNAs for the exon region of the target gene, mix the synthetic primers of different sgRNAs in equal amounts to form a mixed pool of sgRNAs primers;

[0009] 2) Using the sgRNAs primer pool, four different sgRNA-DNA templates were synthesized simultaneously in one PCR amplification reaction to form a sgRNAs-DNA template pool;

[0010] 3) Using the sgRNAs-DNA template mixed pool, one in vitro reverse transcription reaction simultaneously synthesized four different sgRNAs to form a sgRNAs mixed pool

[0011] 4) The sgRNAs pool is mixed with Cas9 protein to prepare an sgRNAs-Cas9 complex, which is microinjected into newly laid eggs of lepidopteran insects;

[0012] 5) After the injected eggs develop into larvae, genomic DNA is extracted, the sgRNAs targeting region is amplified by PCR, the mutation rate of the target gene is detected by T7EI digestion, and the larvae are phenotypically analyzed.

[0013] The invention relates to application of the method described in the invention in gene function analysis of lepidopteran insects.

[0014] The invention discloses an application of the method described in the present invention in the functional analysis of Cadherin gene of cotton bollworm.

[0015] A specific sgRNAs target site for rapid knockout of the Cadherin gene of cotton bollworm, including sgRNA-A, sgRNA-B, sgRNA-C, and sgRNA-D, the specific sequences of which are as follows:

[0016] sgRNA-A:AGTTCGATGAGAAGACGGAGCGG (SEQ ID NO.1)

[0017] sgRNA-B:CGAGCCATCGATGGTGATACAGG(SEQ ID NO.2)

[0018] sgRNA-C:GTTCCAGTCGAAAGCCGATGTGG(SEQ ID NO.3)

[0019] sgRNA-D:CGTGAACGATGTCAATGATCAGG(SEQ ID NO.4)

[0020] A rapid and economical method for functional analysis of cadherin genes in cotton bollworm:

[0021] 1) Designing synthetic primers for the sgRNAs, the sequences of which are shown in SEQ ID NO.5-SEQ ID NO.12, and mixing the synthetic primers in equal amounts to form a mixed pool of sgRNAs primers,

[0022] 2) Using the sgRNAs primer pool, four different sgRNA-DNA templates were synthesized simultaneously in one PCR amplification reaction to form a sgRNAs-DNA template pool;

[0023] 3) Using the sgRNAs-DNA template mixed pool, four different sgRNAs were synthesized simultaneously in one in vitro reverse transcription reaction to form a sgRNAs mixed pool;

[0024] 4) The sgRNAs pool is mixed with Cas9 protein to prepare sgRNAs-Cas9 complex, which is microinjected into newly laid cotton bollworm eggs;

[0025] 5) After the injected eggs develop into larvae, genomic DNA is extracted, sgRNAs targeting region is amplified by PCR, Cadherin gene mutation rate is detected by T7EI digestion, and larvae are phenotypically analyzed.

[0026] As a preferred embodiment of the present invention, the total concentration of sgRNAs primers in the sgRNAs primer pool is 2.4 μM.

[0027] As a preferred embodiment of the present invention, the concentration of sgRNAs in the sgRNAs-Cas9 complex is 150 ng / μL, and the concentration of Cas9 protein is 300 ng / μL.

[0028] As a preferred embodiment of the present invention, the PCR amplification primers for the Cadherin gene sgRNAs targeting region are Cad-4145F: GGATTCCCTACCAAACACACAT (SEQ ID NO.13); Cad-4739R: CTCTATCG-TGGAACCCAAAGT (SEQ ID NO.14).

[0029] Compared with the prior art, the present invention has the following beneficial effects:

[0030] The present invention discloses a method for rapidly and economically conducting gene function analysis in lepidopteran insects. The method: (1) greatly improves the mutation rate of target genes in G0 generation individuals through redundant targeting of four sgRNAs, and G0 generation individuals can present a gene function loss phenotype, thereby rapidly realizing gene function analysis in the G0 generation, avoiding the complex process of traditional construction of homozygous gene mutation strains, and greatly shortening the cycle of gene function research in lepidopteran insects; (2) by constructing a primer pool of four sgRNAs, four different sgRNA-DNA templates can be synthesized simultaneously in one PCR amplification reaction, and four different sgRNAs can be further synthesized simultaneously through one reverse transcription reaction, so that four different sgRNAs can be synthesized simultaneously at the cost of synthesizing one sgRNA, thereby greatly reducing the economic cost of synthesizing sgRNAs. BRIEF DESCRIPTION OF THE DRAWINGS

[0031] Figure 1 is a schematic diagram of the design of Cadherin-sgRNAs in cotton bollworm;

[0032] Figure 2 A is the agarose gel electrophoresis image of the cotton bollworm Cadherin-sgRNAs targeting sequence after T7E1 digestion;

[0033] Figure 2 B is the mutation efficiency of Cadherin gene in cotton bollworm;

[0034] Figure 3 A is the result of phenotypic analysis: the survival rate of larvae hatched from eggs without injection and after injection of sgRNAs-Cas9 complex on artificial diet containing different doses of Cry1Ac toxin;

[0035] Figure 3B is a phenotypic analysis picture: the development of larvae hatched from eggs without injection and after injection of sgRNAs-Cas9 complexes on artificial diet containing different doses of Cry1Ac toxin. DETAILED DESCRIPTION

[0036] The following are examples of the present invention, which will further explain the present invention in detail. The terms used herein generally have the meanings commonly understood by those of ordinary skill in the art. The test methods are conventional methods unless otherwise specified. The materials and reagents used are commercially available reagents and materials unless otherwise specified.

[0037] The following embodiments are only key embodiments, not all embodiments, and will not limit the present invention described in the claims.

[0038] Example: Rapid and economical analysis of the function of the cadherin gene in cotton bollworm

[0039] 1. Cadherin gene cloning

[0040] According to the cotton bollworm genome GCA_023701775.1 (NCBI genome database), the Cadherin gene sequence was retrieved and downloaded, and the exons were amplified by designed primers to verify the sequence correctness and detect whether it contained SNP. After detecting the SNP-free sequence, 4 sgRNA target sites that can work efficiently were designed.

[0041] 2. Synthesis of Cas9 protein and sgRNA

[0042] Cas9 protein was from Thermo Fisher Scientific-CN.

[0043] Four targets were designed on exons 8 and 9 of Cadherin of cotton bollworm, named sgRNA-A, sgRNA-B, sgRNA-C, and sgRNA-D. The target sequences are shown in Table 1 and the target positions are shown in Figure 1 .

[0044] Table 1: Cadherin sgRNA target sequences

[0045]

[0046] 1. sgRNAs synthesis primer design

[0047] Synthetic primers were designed according to the target sequences of each sgRNA, as shown in Table 2:

[0048] Table 2: sgRNA synthesis primer sequences

[0049]

[0050] 2. Preparation of sgRNAs-DNA template pool

[0051] 1) To reduce the cost of sgRNA synthesis, the four sgRNA synthesis primers were mixed in equal amounts and then precipitated with ddH 2 O was diluted to 2.4 μM to form a sgRNA primer pool for subsequent sgRNAs-DNA template pool preparation;

[0052] 2) Refer to the sgRNA synthesis kit (GeneArt TM Precision gRNA Synthesis Kit) instructions prepared as shown in Table 3, and PCR amplification was performed;

[0053] Table 3: PCR system

[0054]

[0055] Template amplification

[0056]

[0057] 3) Add enzyme-free water to make up to 100 μL of the product in the previous step, add 500 μL of Buffer GDP and mix well, then add 900 μL of anhydrous ethanol;

[0058] 4) Transfer to a filter column twice, 12000g for 1 min, and remove the filtrate;

[0059] 5) Add 700 μL Buffer GW, incubate at 12000 g for 1 min, remove the filtrate, and repeat this step twice;

[0060] 6) After removing the filtrate, centrifuge the filter column at 12000g for 2 min;

[0061] 7) Transfer the filter column to a 1.5 mL centrifuge tube, add 10 μL Elution buffer, let stand for 1 min, and centrifuge at 12000 g for 1 min;

[0062] 8) The purified product obtained is the sgRNAs-DNA template mixed pool.

[0063] 3. sgRNAs Synthesis and Purification

[0064] 1) The purified product obtained in the previous step was formulated into the following system according to the instructions:

[0065]

[0066] 2) After mixing, incubate at 37°C for 3 h until a white precipitate appears at the bottom of the centrifuge tube;

[0067] 3) After incubation, add 1 μL DNase I and incubate at 37°C for 15 min.

[0068] 4) After incubation, add 180 μL of Nuclease free water to make up the volume to 200 μL, mix well and transfer to a 1.5 mL EP tube;

[0069] 5) Add 100 μL Binding Buffer and mix well;

[0070] 6) Add 300 μL of anhydrous ethanol and mix well;

[0071] 7) Transfer the liquid to the GenET RNA purification column and centrifuge at 14000g for 1 min;

[0072] 8) Discard the filtrate, add 700 μL Washing buffer I, and centrifuge at 14000 g for 1 min;

[0073] 9) Discard the filtrate, add 700 μL Washing buffer II, and centrifuge at 14000 g for 1 min;

[0074] 10) Repeat step 6;

[0075] 11) Discard the filtrate, centrifuge at 14000g for 1 min;

[0076] 12) Discard the filtrate, transfer the purification column to a new 1.5mL EP tube, add 11μL Nuclease-free water, centrifuge at 14000g,

[0077] Heart 1min;

[0078] 13) The purified product is the sgRNAs pool, which is packaged after concentration determination and stored at -80°C for future use.

[0079] 3. Microinjection

[0080] The sgRNAs pool prepared in the previous step was mixed with Cas9 protein, with a final concentration of Cas9 of 300ng / μL and sgRNAs of 150ng / μL. Fresh cotton bollworm eggs (within 2 hours after egg laying) were collected and washed with 0.1% sodium hypochlorite solution. After the eggs were dried on filter paper, they were glued to a glass slide with double-sided tape. About 3nL sgRNAs-Cas9 complex was injected into each egg under a microscope, and the injected eggs were placed in an artificial climate chamber at 26±1℃ until hatching.

[0081] 4. Mutation efficiency detection

[0082] After hatching, the larvae were transferred to a 24-well plate with artificial diet and raised individually. The genomic DNA of the larvae was extracted and stored at -20°C for subsequent testing using the Novozyme EN303 kit. The testing steps are as follows:

[0083] 1. sgRNAs target region amplification

[0084] The genomic DNA of cotton bollworm larvae in the uninjected group and the sgRNAs-Cas9 complex injected group were used as templates, and PCR amplification was performed using amplification primers Cad-4145F: GGATTCCCTACCAAACACACAT (SEQ ID NO.13); Cad-4739R: CTCTATCG-TGGAACCCAAAGT (SEQ ID NO.14), and the Novozyme P505 high-fidelity enzyme was used. The PCR system is shown in Table 4:

[0085] Table 4: PCR system

[0086]

[0087] Template amplification

[0088]

[0089] 2. Product recovery and quantification

[0090] 1) Make up the volume of the product to 100 μL with enzyme-free water, add 500 μL Buffer GDP and mix well;

[0091] 2) Transfer to a filter column, centrifuge at 12000g for 1 min, and remove the filtrate;

[0092] 3) Add 700 μL Buffer GW, centrifuge at 12000 g for 1 min, remove the filtrate, and repeat this step twice;

[0093] 4) After removing the filtrate, centrifuge the filter column at 12000g for 2 min;

[0094] 5) Transfer the filter column to a 1.5 mL centrifuge tube, add 10 μL Elution buffer, let stand for 1 min, and centrifuge at 12000 g for 1 min;

[0095] 6) Measure the concentration and quantify each group of samples to 200 ng.

[0096] 3. T7 Endonuclease I digestion reaction

[0097] 1) Prepare the sample into the reaction system shown in Table 5:

[0098] Table 5: T7 Endonuclease I digestion reaction system

[0099]

[0100] 2) Perform the following annealing procedure in a PCR instrument:

[0101]

[0102] 3) Add 1 μL of T7 Endonuclease I to the annealed product;

[0103] 4) Incubate at 37°C for 15 min;

[0104] 5) The digested products were directly detected by 2% agarose gel electrophoresis.

[0105] Agarose gel electrophoresis results Figure 2 As shown in A, the mutation rate statistics are as follows Figure 2 As shown in B, after injection of the sgRNAs-Cas9 complex, the target gene mutation rate of G0 generation cotton bollworm larvae reached more than 80%.

[0106] 5. Phenotypic Analysis

[0107] Cry1Ac toxin was extracted according to the method of Monnerat et al. for sensitivity analysis of cotton bollworm larvae. Artificial diet for cotton bollworm (900 mL) was poured into a 24-well plate, with a surface area of ​​2 cm in each well. 2 After the feed was cooled and solidified, 100 μL of Cry1Ac toxin solution diluted with PBS solution (0.01 M, pH 7.4) was evenly covered on the surface of the feed and air-dried at room temperature. The final concentration of Cry1Ac was 0.025 μg / cm 2 A newly hatched larva was placed in each well of a 24-well plate and placed in an incubator for 7 days before the results were investigated. Larvae that developed to the third instar or weighed more than 5 mg were considered alive, otherwise they were considered dead.

[0108] The results of Cry1Ac sensitivity analysis are as follows Figure 3 As shown in A and 3B, the survival rate of cotton bollworm larvae developed from eggs injected with sgRNAs-Cas9 complex on artificial diet containing Cry1Ac toxin was 54%, while all larvae developed from eggs not injected died, indicating that Cadherin gene knockout would reduce the sensitivity of cotton bollworm larvae to Cry1Ac toxin. This result is consistent with the conclusions of multiple previous studies, proving that the method of the present invention can quickly and efficiently realize the functional analysis of Cadherin gene in cotton bollworm.

[0109] Finally, it should be noted that the above embodiments are only used to illustrate the implementation scheme of the present invention, and are not intended to limit the present invention in other forms. Personnel in the art may use the above disclosed technical content to change or modify it into an equivalent embodiment with equivalent changes. However, any simple modification, equivalent change and modification of the above embodiments based on the technical essence of the present invention without departing from the technical solution of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. A method for rapidly and economically carrying out gene function analysis of Lepidoptera insects, characterized in that: The following steps are involved: 1) Design 4 different sgRNAs for the exon region of the target gene, mix the synthetic primers of different sgRNAs in equal amounts to form a mixed pool of sgRNAs primers; 2) Using the sgRNAs primer pool, four different sgRNA-DNA templates were synthesized simultaneously in one PCR amplification reaction to form a sgRNAs-DNA template pool; 3) Using the sgRNAs-DNA template mixed pool, one reverse transcription reaction simultaneously synthesizes four different sgRNAs to form a sgRNAs mixed pool 4) The sgRNAs pool is mixed with Cas9 protein to prepare an sgRNAs-Cas9 complex, which is microinjected into newly laid eggs of lepidopteran insects; 5) After the injected eggs develop into larvae, genomic DNA is extracted, the sgRNAs targeting region is amplified by PCR, the mutation rate of the target gene is detected by T7EI digestion, and the larvae are phenotypically analyzed.

2. Application of the method according to claim 1 in gene function analysis of Lepidoptera insects.

3. Application of the method according to claim 1 in functional analysis of Cadherin gene in cotton bollworm.

4. A specific sgRNAs target site for rapid and efficient knockout of the Cadherin gene of cotton bollworm, characterized in that: Including sgRNA-A, sgRNA-B, sgRNA-C, sgRNA-D, the specific sequences are as follows: sgRNA-A: SEQ ID NO.1 sgRNA-B: SEQ ID NO.2 sgRNA-C: SEQ ID NO.3 sgRNA-D:SEQ ID NO.

4.

5. A method for rapid and economical analysis of the function of the cadherin gene in cotton bollworm, characterized in that: The following steps are involved: 1) Designing synthetic primers for the sgRNA target site of claim 4, the sequences of which are shown in SEQ ID NO.5-SEQ ID NO.12, and mixing the synthetic primers for the sgRNA target site in equal amounts to form a mixed pool of sgRNA primers; 2) Using the sgRNAs primer pool, four different sgRNA-DNA templates were synthesized simultaneously in one PCR amplification reaction to form a sgRNAs-DNA template pool; 3) Using the sgRNAs-DNA template mixed pool, one reverse transcription reaction simultaneously synthesizes four different sgRNAs to form a sgRNAs mixed pool; 4) The sgRNAs pool is mixed with Cas9 protein to prepare sgRNAs-Cas9 complex, which is microinjected into newly laid eggs; 5) After the injected eggs develop into larvae, genomic DNA is extracted, the sgRNAs targeting region is amplified by PCR, the mutation rate of the target gene is detected by T7EI digestion, and the larvae are phenotypically analyzed.

6. The method for rapidly and economically carrying out functional analysis of Cadherin gene in cotton bollworm according to claim 5, characterized in that: The total concentration of sgRNAs primers in the sgRNAs primer pool is 2.4 μM.

7. The method for rapidly and economically carrying out functional analysis of cadherin gene in cotton bollworm according to claim 5, characterized in that: The sgRNAs concentration in the sgRNAs-Cas9 complex is 150 ng / μL, and the Cas9 protein concentration is 300 ng / μL.

8. The method for rapidly and economically carrying out functional analysis of Cadherin gene in cotton bollworm according to claim 5, characterized in that: The PCR amplification primer sequences of the Cadherin gene sgRNAs targeting region are Cad-4145F: SEQ ID NO.13; Cad-4739R: SEQ ID NO.14.

Images