Molecular marker related to oil content of brassica napus and application of molecular marker

Abstract

The invention discloses a molecular marker related to the oil content of brassica napus and application of the molecular marker, and belongs to the technical field of molecular marker assisted breeding. A transcription factor BnaA09.MYB52 for coding an MYB structural domain is proved to be capable of influencing the oil content of cabbage type rape seeds, molecular markers corresponding to different haplotypes of the gene and primers of the molecular markers are designed by utilizing re-sequencing data, and the DNA molecular markers can be used for distinguishing the functional haplotypes of the gene of a cabbage type rape strain to be detected; the gene molecular marker can be used for detecting and predicting the oil content of the brassica napus, can also be used for molecular marker-assisted selective breeding of the high-oil-content brassica napus, can effectively accelerate the process of high-oil-content breeding of the brassica napus, is suitable for large-scale popularization and application, and has a wide application prospect.

Description

Technical Field

[0001] The invention belongs to the technical field of molecular marker-assisted breeding, and in particular relates to a molecular marker related to the oil content of Brassica napus and an application thereof. Background Art

[0002] Every 1% increase in rapeseed oil content is equivalent to a 2.3-2.5% increase in yield, which shows that increasing seed oil content is one of the most effective means to increase oil yield. According to the oil content statistics of rapeseed varieties collected by the National Rapeseed Modern Agricultural System, the average seed oil content is 43.79%, which is still a considerable gap from the reported super-high rapeseed lines, and there is still a lot of room for improvement in rapeseed seed oil content. At present, there are as many as hundreds of oil content QTLs located in rapeseed (Yan et al 2022), but only orf188 , BnPMT6, BnSFAR4 and BnSFAR45 Be cloned.

[0003] The applicant's research group used 505 rapeseed-associated populations to locate a major QTL for oil content on the A09 linkage group ( ZS11_qOC.A09 ), BnaA09.MYB52 It was predicted to be the key gene involved in the regulation of seed oil content in this QTL. The transgenic results showed that BnaA09.MYB52 Negative regulation of rapeseed seed oil content (unpublished), BnaA09.MYB52 It is a gene with important application value in rapeseed breeding practice. However, to apply this gene to the breeding of rapeseed with high oil content, it is still urgent to develop a simple and effective technical means (such as molecular markers). Currently, there is no relevant report on molecular markers for this gene. Summary of the invention

[0004] The purpose of the present invention is to provide a molecular marker related to the oil content of Brassica napus and its application, which can detect the oil content of Brassica napus, thereby assisting the selection and breeding of varieties with high oil content and accelerating the process of breeding Brassica napus with high oil content.

[0005] To achieve the above object, the present invention provides a molecular marker related to the oil content of Brassica napus. The molecular marker is related to the A09 chromosome of Brassica napus. BnaA09.MYB52 The gene is tightly linked, and its nucleotide sequence is shown in SEQ ID NO.1 or SEQ ID NO.2, wherein the sequence shown in SEQ ID NO.1 is a molecular marker associated with low oil content of Brassica napus, and the sequence shown in SEQ ID NO.2 is a molecular marker associated with high oil content of Brassica napus.

[0006] On the other hand, the present invention provides a primer for amplifying the molecular marker, which has two pairs of primers, and their nucleotide sequences are shown in SEQ ID NO.3-6, wherein SEQ ID NO.3 and 4 are forward and reverse primers for amplifying the nucleotide sequence shown in SEQ ID NO.1, and SEQ ID NO.5 and 6 are forward and reverse primers for amplifying the nucleotide sequence shown in SEQ ID NO.2.

[0007] Among them, the amplified fragment length of the forward and reverse primers shown in SEQ ID NO.3 and 4 is 619 bp, which can be used to identify rapeseed varieties with low oil content; the amplified fragment length of the forward and reverse primers shown in SEQ ID NO.5 and 6 is 611 bp, which can be used to identify rapeseed varieties with high oil content.

[0008] The invention also provides the application of the molecular marker or primer in the identification of oil content varieties of Brassica napus.

[0009] The present invention further provides a method for identifying oil content varieties of Brassica napus, the method comprising the following steps: 1) Extracting genomic DNA from Brassica napus; 2) using the genomic DNA extracted in step 1) as a template and performing PCR amplification using the primers; 3) Perform gel electrophoresis on the PCR amplification product of step 2).

[0010] The PCR amplification reaction system is: 5 μL Vazyme 2×Taq Plus Master Mix, 0.25 μL forward primer, 0.25 μL reverse primer, 2 μL DNA template, and 2.5 μL ddH2O.

[0011] The reaction procedure of the PCR amplification is as follows: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C or 58°C for 15 s, extension at 72°C for 1 min, 35 cycles; and finally extension at 72°C for 10 min.

[0012] Result determination: If a band of about 600 bp is amplified using the primers shown in SEQ ID NOs. 3 and 4, but no band is amplified using the primers shown in SEQ ID NOs. 5 and 6, then it is identified as a rapeseed variety with a low oil content; if a band of about 600 bp is amplified using the primers shown in SEQ ID NOs. 5 and 6, but no band is amplified using the primers shown in SEQ ID NOs. 3 and 4, then it is identified as a rapeseed variety with a high oil content.

[0013] The beneficial effects of the present invention are: 1) The present invention locates and screens candidate genes through genome-wide association analysis BnaA09.MYB52 Functional studies have shown that this gene negatively regulates the oil content of Brassica napus seeds. BnaA09.MYB52 It has a great impact on the oil content of Brassica napus and plays a key regulatory role in the oil accumulation in Brassica napus seeds. It can be used for regulatory network construction and molecular marker-assisted breeding, and is suitable for large-scale promotion and application.

[0014] 2) Based on BnaA09.MYB52 Haplotype analysis was conducted and corresponding molecular markers were designed, which can detect the oil content of Brassica napus, assist in the selection and breeding of high-oil content varieties, and accelerate the process of breeding high-oil content Brassica napus.

[0015] 3) The present invention has the advantages of accurate results, simplicity, speed, low cost, and no environmental impact in the identification of oil content varieties of Brassica napus. BRIEF DESCRIPTION OF THE DRAWINGS

[0016] Figure 1 : Schematic diagram of the oil content distribution results of the Brassica napus associated population in the present invention.

[0017] Figure 2 : The present invention uses the oil content phenotype of the Brassica napus associated population in combination with genomic variation to perform a Manhattan plot of genome-wide association analysis.

[0018] Figure 3 : The present invention utilizes the rapeseed oil content gene BnaA09.MYB52 Schematic diagram of haplotype analysis performed with the molecular markers.

[0019] Figure 4 :Gel electrophoresis of molecular markers of different rapeseed varieties. HapA is 10 rapeseed germplasms with low oil content (numbered 1-10); HapB is 10 rapeseed germplasms with high oil content (numbered 11-20). DETAILED DESCRIPTION

[0020] For ease of understanding of the present invention, the present invention will be described more fully below. However, the present invention can be implemented in many different forms and is not limited to the embodiments described herein. If not specifically indicated, the technical means used in the embodiments are conventional technical means well known to those skilled in the art. If not specifically indicated, the reagents used in the embodiments are commercially available.

[0021] Example 1 1. Planting and oil content determination of related populations 505 Brassica napus self-pollinated seeds were planted in the experimental field of Rapeseed Engineering Technology Research Center of Huazhong Agricultural University in 2012-2013, 2013-2014, 2015-2016, 2016-2017 and 2017-2018, in the experimental field of Anhui Academy of Agricultural Sciences in 2016-2017 and 2017-2018, and in the experimental field of Sichuan Academy of Agricultural Sciences in 2016-2017. Each material was planted in 2 rows, with 10 plants in each row, 21 cm plant spacing, 30 cm row spacing, and field management according to local field management methods.

[0022] At harvest, 8 plants with uniform growth were selected from each row of materials. After harvesting, the whole plant was hung in the hanging storage room to dry naturally. Then the whole plant was threshed, and about 5 grams of seeds were taken from each plant after removing weeds. The seed oil content was measured using the NIRSystems 5000 near-infrared instrument of Foss Company (Tang et al 2021). The BLUP values ​​of oil content of 410 Brassica napus-associated populations are shown in the figure. Figure 1 shown.

[0023] 2. Genome resequencing data analysis The rapeseed reference genome B. napus v4.1 was downloaded from the BnIR database (https: / / yanglab.hzau.edu.cn / ). The reads were aligned to the reference genome using the ‘mem -M -k 32 -t 4’ code in the BWA software. The duplicate results were removed using the SAM tool. The Genome Analysis Toolkit (GATK v3.6) was used to identify sequence variations in associated populations. SNPs with an alignment quality of less than 20 or a sequencing depth of less than 50 were filtered out. Finally, a total of 11,700,689 SNPs were identified.

[0024] 3. Genome-wide association analysis 1. In the genome-wide association analysis, the linear mixed model provided by the FaST-LMM software package was used to identify QTL loci related to oil content on a genome-wide scale using 11,700,689 SNPs markers combined with phenotypic values ​​(i.e., oil content). Figure 2 ).

[0025] 2. A major QTL locus for oil content was identified on chromosome A09 of Brassica napus ( ZS11_ qSOC.A09 ), and the 100 kb before and after the lead SNP was defined as the QTL interval.

[0026] 3. Use the POCKET algorithm to perform functional scoring on candidate genes in the QTL interval (Tang et al 2021), where genes BnaA09.MYB52had the highest score, so this gene was selected as the key candidate gene of this QTL interval for subsequent functional verification.

[0027] IV. Candidate genes BnaA09.MYB52 Haplotype identification and molecular marker development 1. In the related groups BnaA09.MYB52 The promoter, 3'-UTR and coding region sequences were analyzed and two haplotypes (HapA and HapB) were identified. The average oil content of haplotype A was 46.2%±2.2%, and the average oil content of haplotype B was 47.3%±2.7%. The oil content phenotypes of the two haplotypes were significantly different ( Figure 3 ).

[0028] 2. Based on BnaA09.MYB52 The haplotype sequence was used to design and develop relevant molecular markers. The primer nucleotide sequences of the molecular markers are as follows: HapA: CGAAAGCAGAACTGTAGAAG TATGGTTATAAGTCGTGTCAAGATGTGTGGTTCTTCATCTCCACCTAAATAAAACGAATTATAATAAAACAAAGCTAGATTTTTGCTACTTTGGATATATATTTCTTGGTGGCTGATAACCACTCCCAACTTAATCATATCTATA CTCCAACCTTGATTTCGTCTTTCCGTTATTAACTTATTATACTTCACAATTAAAGAAGCTAAACTAAACCTTGTAAAAAAAAAATTATAATTTTTTTTAAAAATGTTTTTCTTTACATCTAGTTACGTAAAAGATCAGAGCTTCA TTCATCATCACAAGTTATCCGAGTCAAAATAGTCTGCCTATGAAATCATAAGTTCAATAGAGAAATTCATTTGGTAATGCATTTTCTTCATCATTGGTAACATGGTGCTTTATGTTAACAATAAAACCTCTTAATGAGCTCTAA CTGATTCGTAATGAAACCAAACATATATAAATAAACAATCTTAGATTTGATGTACAAGAAAAGTTGGGCTGTCTTAGTTAACATTTGGCTCAAACAAGAGCTCTAACTGATTAGTAAGCTTTACATGTCATTAACAGATGATCTA CCTTATAGTAC ATGTTGTACGG HapB: CGAAAGCAGAACTGTAGAAG TATGGTTATAAGTCGTGTCAAGATGTGTGTTTCTTCATCTCCACCTAAATAAAACGAATTATAATAAAACAAAGCTAGATTTTTGCTACTTTGGATATATATTTCTTGGTGGCTGATAACCACTCCCAACTTAATCATATCTA TACTCCAACCTTGATTTCGTCTTTCCGTTATTAACTTATTATACTTCACAATTAAAGAAGCTAAACTAAACCTTGTAAAAAATATTTTTTTTTTAAAATGTTTTTCTTTACATCTAGTTACGTAAAAGATCAGAGCTTCATTC ATCATCACAAGTTATCCGAGTCAAAATAGTCTGCCTATGAAATCATAAGTTCAATAGAGAAATTCATTTGGTGGATGCATTTTCTTCATCATTGGTAACATGGTGCTTTATGTTAACAATAAAACCTCTTAATGAGCTCTAACT GATTCGTAATGAAACCAAACATATATAAATAAACAATCTTAGATTTGATGTACAAGAAAAGTTGGGCTGTCTTAGTTAACATTTGGCTCAAACAAGAGCTCTAACTGATTAGTAAGCTTTACATGTCATTAACAGATGATCTA CCTTATAGTACGGATTA ACA Note: The underlined primers are designed and developed molecular marker primers.

[0029] 3. Use the above molecular markers to identify the genotype of the Brassica napus plants to be tested. The identification process is as follows: (1) Extraction of rapeseed leaf DNA using the CTAB method a. Take 1 cm thick young leaves from each plant 2 Place in a 2 mL centrifuge tube, add steel beads, add 250 μL of 2% CTAB, grind on a grinder for 5 min, and then add 500 μL of CTAB to the centrifuge tube; b. Soak in a 65℃ water bath for 60 min, shaking every 15 min; c. The homogenate was cooled to room temperature after water bath, and a mixed solution of chloroform and isoamyl alcohol with a volume ratio of 24:1 was added to the centrifuge tube, gently inverted upside down to mix for 15 min, and then centrifuged at 12000 rpm for 10 min; d. Place the centrifuge tubes on the operation board in order, and pipette the supernatant into a new 1.5 mL centrifuge tube with a volume of 500 μL; e. Add 50 μL of KAc solution to the supernatant, then add 500 μL of ice ethanol, cover the centrifuge tube, shake it gently a few times to mix the ice ethanol and the supernatant thoroughly, and then place it in a -20℃ refrigerator for 20-30 min to allow the genomic DNA to precipitate; f. Centrifuge the tube at 12,000 rpm for 6 min, discard the supernatant, add 500 μL 75% ethanol and let it stand for another 5 min, discard the supernatant, repeat this process once, and the precipitate is the genomic DNA; g. The centrifuge tube containing the DNA was placed in a fume hood to dry, and the genomic DNA of each plant was obtained; h. Add 200 μL ddH2O to the air-dried centrifuge tube containing DNA to dissolve the DNA, and store it at -20℃ after dissolution.

[0030] (2) PCR amplification of molecular markers The above molecular markers were used as primers, and the genomic DNA of the Brassica napus plant to be tested extracted by the CTAB method was used as a template for PCR amplification. The PCR amplification was a 10 μL reaction system, and each reaction system specifically included: Vazyme 2×Taq Plus Master Mix 5 μL DNA template 2 μL 10 μM forward primer 0.25 μL 10 μM reverse primer 0.25 μL 2.5 μL of ultrapure water.

[0031] The PCR reaction program was as follows: pre-denaturation at 94°C for 5 min, 1 cycle; denaturation at 94°C for 30 s, annealing at 56°C or 58°C for 30 s, extension at 72°C for 1 min, a total of 35 cycles; extension at 72°C for 5 min, 1 cycle; and finally storage at 4°C.

[0032] (3) Amplification products and electrophoresis analysis The amplified products of all the Brassica napus plants to be tested were electrophoresed on a 1.5% agarose gel, stained with the nucleic acid dye ethidium bromide, and imaged under ultraviolet light to obtain the genotype information of the tested samples. Figure 4All low-oil rapeseed germplasm DNA templates can amplify a band of about 600 bp (numbered 1-10) using primers SEQ ID NO.3 and 4 (MYBA), but no band can be amplified using primers SEQ ID NO.5 and 6 (MYBB); all high-oil rapeseed germplasm DNA templates can amplify a band of about 600 bp (numbered 11-20) using primers SEQID NO.3 and 4 (MYBA), but no band can be amplified using primers SEQID NO.3 and 4 (MYBA), indicating that the molecular marker can effectively distinguish high-oil and low-oil rapeseed germplasm.

[0033] Finally, the above embodiments are preferred implementation schemes of the present invention, and the present invention is not limited to the specific details in the above embodiments. Any modification, equivalent replacement, improvement, etc. made under the functional and structural principles of the present invention should be included in the protection scope of the present invention.

Claims

1. A molecular marker related to oil content in Brassica napus, the nucleotide sequence of which is shown in SEQ ID NO.1 or SEQ ID NO.2, and which is related to the oil content in Brassica napus A09 chromosome. BnaA09.MYB52 The genes are tightly linked, The sequence shown in SEQ ID NO.1 is a molecular marker associated with low oil content in Brassica napus, and the sequence shown in SEQ ID NO.2 is a molecular marker associated with high oil content in Brassica napus.

2. A primer for amplifying the molecular marker according to claim 1, wherein the nucleotide sequence is as shown in SEQ ID NO.3-6, wherein: SEQ ID NO.3 and 4 are forward and reverse primers for amplifying the nucleotide sequence shown in SEQ ID NO.1, and SEQ ID NO.5 and 6 are forward and reverse primers for amplifying the nucleotide sequence shown in SEQ ID NO.

2.

3. Use of the molecular marker described in claim 1 or the primer described in claim 2 in identifying oil content varieties of Brassica napus.

4. A kit for identifying oil content varieties of Brassica napus, comprising the primers according to claim 2.

5. A method for identifying oil content varieties of Brassica napus, the method comprising the following steps: 1) Extracting genomic DNA from Brassica napus; 2) using the genomic DNA extracted in step 1) as a template and performing PCR amplification using the primers described in claim 2; 3) Perform gel electrophoresis on the PCR amplification product of step 2).

6. The method according to claim 5, characterized in that The reaction system of the PCR amplification was: 5 μL Vazyme 2×Taq Plus Master Mix, 0.25 μL forward primer, 0.25 μL reverse primer, 2 μL DNA template, and 2.5 μL ddH2O.

7. The method according to claim 5, characterized in that The reaction procedure of the PCR amplification is: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 30 s, annealing at 56°C or 58°C for 15 s, extension at 72°C for 1 min, 35 cycles; and finally extension at 72°C for 10 min.

8. The method according to claim 5, characterized in that: If a 600 bp band is amplified using the primers shown in SEQ ID NOs. 3 and 4, but no band is amplified using the primers shown in SEQ ID NOs. 5 and 6, it is identified as a rapeseed variety with a low oil content; if a 600 bp band is amplified using the primers shown in SEQ ID NOs. 5 and 6, but no band is amplified using the primers shown in SEQ ID NOs. 3 and 4, it is identified as a rapeseed variety with a high oil content.

Images