Protective effect of costunolide on hypoxic ischemic brain injury of newborn rats

Abstract

The invention provides a protection effect of costunolide on hypoxic ischemic brain injury (HIBD) of newborn rats, and belongs to the technical field of medicines. It is found for the first time that after HI brain injury, costunolide treatment reduces the cerebral infarction area, neuron loss is reduced, and development of gray matter and white matter of the brain is promoted. In addition, costunolide can inhibit neuronal inflammation, and is represented as reduction of proinflammatory cytokines such as TNF-alpha, IL-1beta, IL-6, IL-18 and the like and reduction of activation of microglial cells and astrocytes. The invention provides a promising candidate drug for clinical treatment of neonatal HIBD in the future.

Description

Technical Field

[0001] The invention belongs to the field of medical technology, and particularly relates to the protective effect of costunolide on hypoxic-ischemic brain damage in neonatal rats. Background Art

[0002] Neonatal hypoxic-ischemic brain damage (HIBD) refers to neurological dysfunction caused by lack of oxygen and insufficient blood supply to the brain during delivery. The global incidence of HIBD is 1.5 per 1,000 (95% confidence interval 1.3 to 1.7), and many survivors suffer severe and permanent damage, including visual and hearing impairment, epilepsy, cerebral palsy, and other neuropathological sequelae. Mild hypothermia is the only clinical standard treatment for HIBD and has been shown to reduce the risk of infant death or major disability. Despite this, up to 40% of neonates with moderate to severe HIBD who receive this treatment die or have long-term complications. In addition, the short therapeutic window of mild hypothermia is a significant disadvantage. Therefore, effective and safe treatments are urgently needed to alleviate neonatal HIBD.

[0003] Costunolide (COS) is a natural bioactive sesquiterpene lactone extracted from the root of the Asteraceae plant Costus sinensis. The natural small molecule COS has the ability to transport across the blood-brain barrier and target brain cells. COS has significant neuroprotective potential for central nervous system diseases, including Parkinson's disease, chronic cerebral hypoperfusion, and stroke. However, to date, no studies have shown whether COS can improve the neurological outcome of neonatal HI brain injury. Summary of the invention

[0004] In view of this, the object of the present invention is to provide the use of costunolide in the preparation of a medicament for treating neonatal brain damage.

[0005] In order to achieve the above-mentioned object of the invention, the present invention provides the following technical solutions:

[0006] Application of costunolide in preparing medicine for treating neonatal brain damage.

[0007] Preferably, the neonatal brain damage is hypoxic-ischemic brain damage.

[0008] Preferably, the costunolide reduces the cerebral infarction area and improves cerebral edema in neonates with hypoxic-ischemic brain damage.

[0009] Preferably, the costunolide promotes the recovery of neuronal morphology in neonates with hypoxic-ischemic brain damage and increases the neuronal density in the CA1, CA3, DG and cortical regions of the hippocampus.

[0010] Preferably, the costunolide promotes myelination and the development of neuronal dendrites.

[0011] Preferably, the costunolide activates the PI3K / AKT signaling pathway and alleviates inflammation-induced neuronal dysfunction.

[0012] Preferably, the costunolide inhibits hypoxia-ischemia-induced neuronal damage by regulating the PI3K / AKT / NF-κB pathway.

[0013] Preferably, the costunolide inhibits neuronal inflammation.

[0014] Preferably, the costunolide reduces oxygen-glucose deprivation damage to PC12 cells.

[0015] Preferably, the active ingredient of the drug includes costunolide.

[0016] Compared with the prior art, the present invention has the following beneficial effects:

[0017] The present invention provides the use of costunolide in the preparation of a drug for treating neonatal brain injury. The present invention first discovered that after hypoxic-ischemic (HI) injury, COS treatment greatly reduced the area of ​​cerebral infarction, alleviated neuronal loss, and promoted the development of gray and white matter in the brain. In addition, it was demonstrated that COS can inhibit neuronal inflammation, as manifested by a reduction in proinflammatory cytokines such as TNF-α, IL-1β, IL-6, and IL18, as well as a reduction in microglia and astrocyte activation. Its mechanism of action is through activating the PI3K / AKT signaling pathway while inhibiting the NF-κB pathway. The present invention provides a promising candidate drug for the future clinical treatment of neonatal HIBD. BRIEF DESCRIPTION OF THE DRAWINGS

[0018] Figure 1 The effect of COS on HI brain injury in newborn SD rats, where A is the cerebral blood flow image detected by laser Doppler imaging 24 hours after injury; B is the statistical graph of cerebral blood flow; C is the TTC image of newborn SD rats 24 hours after injury; D is the statistical graph of left cerebral infarction area; E is the gross image of brain tissue in each group 24 hours after modeling in newborn SD rats; F is the statistical graph of brain water content; *p<0.05, **p<0.01, ns, no significant difference;

[0019] Figure 2COS alleviates HI-induced brain injury through PI3K / AKT-mediated NF-κB inhibition, where A is KEGG analysis; B is a heat map showing the differential expression of PI3K / AKT signaling pathway genes between sham-operated rats and HI rats; C is a heat map showing the differential expression of NF-κB signaling pathway genes between sham-operated rats and HI rats; D is Western blot analysis of p-PI3K, PI3K, p-AKT and AKT expression; E is Western blot analysis of NF-κB in nuclear and cytoplasmic extracts of rat cerebral cortex tissue; F is statistical analysis of Figure D; G is statistical analysis of Figure E; *p < 0.05;

[0020] Figure 3 COS alleviates OGD-induced PC12 cell injury through the PI3K / AKT / NF-κB signaling pathway, where A is the survival rate of PC12 cells at different OGD times; B is the drug toxicity of different doses of COS; C is the effect of COS on the survival rate of PC12 cells in OGD 18h injury; D is the protein levels of p-PI3K, PI3K, p-AKT and AKT in PC12 cells 18h after OGD injury; E is the change of NF-κB protein level in nuclear and cytoplasmic extracts of PC12 cells 18h after OGD injury; F is the statistical analysis of Figure D; G is the statistical analysis of Figure E; H is the nuclear translocation of NF-κB by immunofluorescence analysis; *p<0.05, **p<0.01;

[0021] Figure 4 COS can reduce acute inflammation in the brain tissue of HI rats and inhibit the activation of microglia and astrocytes, where A is the protein level of TNF-α, IL-6, IL-18 and IL-1β in the cortex of SD rats 24 hours after HI injury; B is the statistical analysis of Figure A; C is the mRNA level of TNF-α, IL-6, IL-18 and IL-1β in the cortex of SD rats 24 hours after HI injury; D is the fluorescence statistical analysis of Figure F; E is the fluorescence statistical analysis of Figure G; F is the immunofluorescence staining of IBA-1 in rat brain tissue; G is the immunofluorescence staining of GFAP in rat brain tissue; *p<0.05, **p<0.01;

[0022] Figure 5 COS inhibited the inflammatory response of PC12 cells 18 hours after OGD, where A is the expression of TNF-α, IL-6, IL-18, and IL-1β mRNA in each group of cells analyzed by qRT-PCR; B is the protein level of TNF-α, IL-6, IL-18, and IL-1β in PC12 cells; C is the statistical analysis of Figure B; D is the immunofluorescence staining of IL-6 in PC12 cells; E is the fluorescence statistical analysis of Figure D; **p < 0.01;

[0023] Figure 6 The neuroprotective effect of COS on SD rats after HI brain injury, where A is HE staining of brain tissue of rats 7 days after modeling; B is Nissl staining of brain tissue of rats 7 days after modeling;

[0024] Figure 7 COS has the effect of stabilizing microtubule function and promoting the development of white matter in rats after HI brain injury, where A is the protein level of MAP-2 and MBP in the left brain tissue of rats 7 days after modeling; B is the statistical analysis of Figure A; C is the immunofluorescence staining of MAP-2 in rat brain tissue; D is the immunofluorescence staining of MBP in rat brain tissue; E is the statistical analysis of Figure C; F and G are the statistical analysis of Figure D; *p<0.05, **p<0.01;

[0025] Figure 8 The effects of COS on long-term neurobehavior and body weight of SD rats after HI injury, where A is the trajectory of the Y-maze experiment; B is the statistics of the spontaneous alternation rate in the Y-maze; C is the weight change of rats in each group on different days after birth; D is the crossing time of rats in each group in the balance beam experiment; E is the number of foot slips of rats in each group in the balance beam experiment; *p<0.05, **p<0.01; DETAILED DESCRIPTION

[0026] The invention provides the use of costunolide in preparing a medicine for treating neonatal brain damage, wherein the neonatal brain damage is hypoxic-ischemic brain damage.

[0027] Costusolide (COS) is a natural bioactive sesquiterpene lactone extracted from the root of Costus sinensis, a plant of the Asteraceae family.

[0028] In the present invention, the costunolide reduces the cerebral infarction area and improves cerebral edema in neonatal hypoxic-ischemic brain damage. Adequate cerebral perfusion can transmit glucose and oxygen, helping the fetal brain tissue to maintain energy and metabolic homeostasis. During perinatal asphyxia, cerebral blood flow is reduced or even interrupted, leading to cascade death of neurons, as well as significant cerebral edema and infarction. COS (10 mg / kg and 20 mg / kg) treatment can reduce edema and infarction in the brain tissue of newborn SD mice.

[0029] In the present invention, the costunolide promotes the recovery of neuronal morphology in neonates with hypoxic-ischemic brain damage, increases the neuronal density in the CA1, CA3, DG and cortical regions of the hippocampus; and promotes myelination and the development of neuronal dendrites.

[0030] In the present invention, the costunolide activates the PI3K / AKT signaling pathway to reduce inflammation-induced neuronal dysfunction; the costunolide inhibits hypoxia-induced neuronal damage by regulating the PI3K / AKT / NF-κB pathway.

[0031] PI3K / AKT signaling plays a dominant role in neuronal survival, polarity, axonal specification, and synaptic plasticity, thereby affecting brain development and function, and is of great significance in a variety of neurological impairments. In newborn SD rats after HI injury, there is dysregulation of the PI3K / AKT signaling network, characterized by histological destruction, neuronal loss, and decreased p-PI3K and p-AKT activity. NF-κB is a cellular inflammatory sensor, and when exposed to inflammation or stress, such as in the case of acute brain injury, NF-κB activity is dysregulated. The present invention first discovered that costunolide reduces inflammation-induced neuronal dysfunction by activating the PI3K / AKT signaling pathway while inhibiting the NF-κB pathway.

[0032] In the present invention, the costunolide inhibits neuronal inflammation, and preferably the costunolide promotes the reduction of TNF-α, IL-1β, IL-6 and IL18 proinflammatory cytokines, as well as the reduction of microglia and astrocyte activation.

[0033] In the present invention, the costunolide inhibits PC12 cells from being damaged by oxygen-glucose deprivation (OGD). After OGD, the survival rate of PC12 cells significantly decreased, and COS can significantly reduce the damage of OGD to PC12 cells.

[0034] In the present invention, the active ingredient of the drug includes costunolide. Preferably, the content of costunolide in the drug of the present invention is 0.1-100wt%.

[0035] Costinol (COS) used in the specific examples of the present invention was provided by Aladdin Chemical (C139779, Shanghai, China) with a purity greater than 97%.

[0036] In the specific embodiment of the present invention, statistical analysis was performed using graph Pad Prism 9.0 (graph Pad Software Inc., San Diego, CA, USA). All results are expressed as mean ± standard deviation (mean ± SEM). Unpaired two-tailed t-test was used to evaluate the comparison of two experimental groups, and one-way analysis of variance (ANOVA) and Turkey's multiple comparison test were used to analyze the differences between multiple groups. Two-tailed P values ​​< 0.05 were considered statistically significant.

[0037] The technical solutions provided by the present invention are described in detail below in conjunction with the embodiments, but they should not be construed as limiting the protection scope of the present invention.

[0038] Example 1

[0039] Effect of 1COS on alleviating HI brain damage in neonatal rats

[0040] 1.1 Experimental animals and animal model construction

[0041] Sprague-Dawley (SD) rats weighing 200-250 g were purchased from Zhejiang Weitong Lihua Experimental Animal Technology Co., Ltd. Rats were housed in a controlled environment in an animal facility (12 h light / dark cycle, 22 ± 2 °C, 60 ± 5% humidity) and had free access to tap water and food. All animal welfare and animal protocols strictly complied with the regulations of the Animal Care and Use Committee of Wenzhou Medical University, China. SD rats were anesthetized with isoflurane and killed at the end of the experiment.

[0042] According to the modified Rice method, a neonatal HIBD model was established in rats 7 days after birth. The specific steps are as follows:

[0043] 7 days after birth, SD rats were induced with isoflurane anesthesia and maintained with 1-2% isoflurane. The left common carotid artery was then isolated, ligated at both ends, and cut in the middle of the ligation. Each surgical ligation was performed within 5 minutes. After the SD rats were returned to their mothers to rest for 1-2 hours, they were placed in a hypoxic incubator (37°C, 8% O2, 92% N2) for 2 hours of hypoxia.

[0044] In the sham operation group, the rats were anesthetized and the carotid artery was isolated but not ligated or subjected to hypoxia.

[0045] In the constructed neonatal rat HIBD model, SD rats with moderate injuries were selected according to clinical grading, and SD rats with severe injuries such as asphyxia, convulsions, and respiratory failure were excluded. 24 hours after modeling, SD rats were anesthetized with isoflurane, the skull skin was separated along the midline, and cerebral blood flow was detected using the RFLSIPro+ laser speckle imaging system (RWD Life Sciences Co., Ltd.). Blood flow images were recorded and used to identify regions of interest (ROIs). The average blood flow index was evaluated in real time within these ROIs.

[0046] Subsequent experiments were all conducted using SD mice with clinical classification of moderate brain damage.

[0047] COS was dissolved in 0.1% DMSO and administered intraperitoneally to the above SD mice immediately after hypoxia treatment at three doses of 5 mg / kg ip, 10 mg / kg ip and 20 mg / kg ip for 7 consecutive days with an interval of 24 hours. The optimal concentration was determined to be 10 mg / kg ip.

[0048] The SD mice were randomly divided into Sham group, HI group, HI+COS group and HI+COS+LY294002 group.

[0049] HI+COS group: Immediately after the model was established, the model group SD mice were intraperitoneally administered with a dose of 10 mg / kg ip for 7 consecutive days, with an interval of 24 h between each administration;

[0050] HI+COS+LY group: 30 minutes before model construction, PI3K inhibitor LY294002 (Selleck, S1105) dissolved in 0.1% DMSO was injected into the lateral ventricle (icv) of young mice. The dosage of LY294002 was 50 nmol / kg. Immediately after model construction, COS was intraperitoneally administered to young SD mice in the constructed model group at a dosage of 10 mg / kg ip. This was used for 7 consecutive days, with an interval of 24 hours between each administration.

[0051] Sham group: SD only underwent isolation of the left common carotid artery without ligation or hypoxia, and was given 0.1% DMSO placebo treatment according to the same schedule as the HI+COS group;

[0052] HI group: received 0.1% DMSO placebo treatment on the same schedule as the HI+COS group.

[0053] 1.2 Assessment of cerebral infarction volume

[0054] A 1% 2,3,5-triphenyltetrazolium chloride (TTC, T8170, Solarbio, Beijing, China) solution in phosphate buffered saline (PBS) was prepared. SD rats were deeply anesthetized and perfused with saline 24 hours after HI injury. Immediately after perfusion, the brain was frozen at -80°C for 5 minutes and cut into coronal sections of approximately 2 mm thickness. Then, the coronal sections were immersed in 1% TTC for 30 min at 37°C and fixed overnight in 4% paraformaldehyde solution. The infarct volume was collected and calculated using ImageJ software (National Institutes of Health, Bethesda, Maryland).

[0055] 1.3 Assessment of cerebral edema

[0056] The brain edema status was measured by calculating the wet-dry ratio of the injured left brain. 24 hours after HI injury in SD rats, the brain was quickly separated and the wet weight of the left cerebral hemisphere was recorded. Subsequently, the brain tissue of SD rats was dried in an 80°C oven for 24 hours and the dry weight was re-weighed. The formula for calculating brain edema is: brain edema = [(wet weight - dry weight) / wet weight] × 100%.

[0057] 1.4 Results

[0058] like Figure 1As shown in A and B in Figure 1, laser Doppler imaging was used to detect cerebral blood flow 24 hours after injury, confirming that the HIBD model was successfully established. Since the left common carotid artery was ligated in the HI group, the left cerebral blood flow in the HI group was significantly reduced compared with the SD rats in the Sham group.

[0059] like Figure 1 As shown in Figures C and D, SD mice were treated intraperitoneally (ip) with COS (5 mg / kg, 10 mg / kg, and 20 mg / kg) immediately after HI, and TTC staining was performed 24 h after injury to assess the infarct volume. Figure 1 As shown in C, COS treatment significantly improved the left cerebral infarction volume of HI-injured SD rats, and there was no significant difference between 20 mg / kg and 10 mg / kg ( Figure 1 D in the figure). Therefore, 10 mg / kg COS was selected as the most effective dose for subsequent experiments. The beneficial effects of COS were further verified in the brain water content test ( Figure 1 F in the figure). Meanwhile, COS treatment significantly improved brain edema ( Figure 1 E).

[0060] 2. COS alleviates neuronal damage through PI3K / AKT-mediated NF-κB inhibition

[0061] The experimental animals, animal model construction, animal grouping and treatment were the same as 1.1.

[0062] 2.1 RNA sequencing

[0063] The left cerebral tissues of SD rats in the sham and HI groups were isolated and frozen and sent to Beijing Genomics Institute (BGI, China) for transcriptome sequencing (repeated 3 samples). To gain insight into the key pathways involved in HIBD, Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis was performed on the annotated differentially expressed genes based on hypergeometric analysis using Phyper (https: / / en.wikipedia.org / wiki / Hypergeometric_distribution). Significant pathways and genes were identified at the p-value threshold (p<0.05).

[0064] 2.2 Western blotting

[0065] The left brain tissue or PC12 cells from SD rats were collected and homogenized in RIPA buffer for standard western blot analysis.

[0066] Equal amounts of protein from each group were separated by SDS-PAGE gel, electrotransferred to polyvinylidene fluoride membrane at 300 mA for 1.5 h, blocked with 5% skim milk at room temperature for 2 h, and incubated with appropriate primary antibodies (see Table 1) at 4 ° C overnight. The next day, HRP-goat-anti-mouse (proteintech, SA00001-1) or HRP-goat-anti-rabbit (proteintech, SA00001-2) secondary antibodies were used for 2 hours at room temperature. All immunoreactive bands were detected by ChemiDoc XRS imaging system (Bio-Rad) and calculated using ImageJ software. The expression of β-Actin and Lamin B1 was used as internal reference.

[0067] Table 1 Antibody information

[0068]

[0069] Note: ND = not detected; WB = Western blot; IF = immunofluorescence.

[0070] 2.3 Cell culture and treatment

[0071] Highly differentiated PC12 cells were purchased from the Chinese Academy of Sciences (Shanghai, China) and routinely cultured in Dulbecco's modified Eagle's medium (DMEM Gibco, USA) containing 1% penicillin-streptomycin and 10% FBS (Gibco, USA). Before the experiment, the cells were divided into 4 groups: control group, OGD group, OGD+COS (4M COS), and OGD+COS+LY (4M COS, 10M Ly294002) group.

[0072] OGD+COS group: The mice received COS pretreatment 2 h before OGD injury, then the culture medium was removed and replaced with DMEM (Gibco, USA) medium without glucose, and cultured for 18 h under 1% O2 and 5% CO2 conditions to simulate the hypoxic-ischemic environment;

[0073] OGD+COS+LY group: The mice were pretreated with COS and PI3K inhibitor LY294002 (Selleck, S1105) 2 h before OGD stimulation. Then, the culture medium was removed and replaced with DMEM (Gibco, USA) medium without glucose, and cultured for 18 h under 1% O2 and 5% CO2 to simulate the hypoxic-ischemic environment;

[0074] OGD group: the conventional culture medium was replaced with DMEM (Gibco, USA) medium without glucose, and the cells were cultured for 18 h under 1% O2 and 5% CO2 conditions to simulate the hypoxic-ischemic environment;

[0075] Control group: Conventional culture: Cultured in a conventional cell culture incubator at 37°C containing 5% carbon dioxide.

[0076] 2.4 Cell viability determination

[0077] The cell viability of PC12 cells was determined using a cell counting kit-8 (40203ES88, Yeasen Biotechnology, Shanghai, China). First, PC12 cells were cultured at 1×10 4 Cells were seeded into 96-well plates at a density of 100 cells / well. After 24 hours, different concentrations of COS were added to the wells. After 24 hours, the conventional culture medium was replaced with DMEM (Gibco, USA) medium without glucose and cultured for 18 hours under 1% O2 and 5% CO2 conditions. Then, 10% volume of CCK-8 solution was added to each well and stored at 37°C in the dark for 30 minutes. Finally, the absorbance was measured at an optical density value of 450nm.

[0078] 2.5 Results

[0079] To explore the potential mechanism of COS in treating HIBD, Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis was performed, and 221 KEGG pathways showed statistical significance between the Sham group and the HI group. Figure 2 As shown in Figure A, among the 20 major signaling pathways, including the PI3K / AKT signaling pathway and the NF-κB signaling pathway, 2 were selected as mechanisms associated with the potential effects of COS. In addition, the present invention also collected 227 differentially expressed genes (DEGs) in the PI3K / AKT signaling pathway and 70 differentially expressed genes (DEGs) in the NF-κB signaling pathway. Figure 2 As shown in Figure 2B, the present invention identified 40 DEGs of the PI3K / AKT signaling pathway and 41 DEGs of the NF-κB signaling pathway, among which the absolute value of log2(HI / Sham) was greater than 1 ( Figure 2 C).

[0080] To illustrate the potential mechanism of COS in HIBD, Western blotting was used to detect whether COS regulates the PI3K / AKT signaling pathway. Figure 2 D and Figure 2 Figures E and B are the results of Western blot analysis of the left brain tissue of SD rats. Figure 2 As shown in D, in the HI group, the phosphorylation of PI3K and AKT was severely inhibited, and COS administration significantly upregulated their phosphorylation expression. The effect of COS could be reversed by using a selective PI3K antagonist (LY294002) 30 minutes before HI.

[0081] like Figure 2 As shown in Figure F, COS upregulated the expression of p-PI3K and p-AKT, and the effect of COS was completely reversed by LY294002. To further prove that NF-κB is downstream of PI3K / AKT, the levels of NF-κB in the nucleus and cytoplasm were determined by Western blotting. The activation of NF-κB is usually regulated by its nuclear translocation. Figure 2 As shown in E and G, Western blot results showed that NF-κB nuclear translocation increased in the HI group, while COS treatment led to the redistribution of NF-κB to the cytoplasm. LY294002 partially inhibited the protective effect of COS.

[0082] To determine the above in vivo mechanisms, we established an in vitro cell model by subjecting PC12 cells to OGD injury to simulate hypoxic-ischemic conditions. Figure 3 As shown in A, CCK8 analysis showed that compared with the control group, the cell survival rate of PC12 cells under OGD intervention at different times decreased in a time-dependent manner. After 18 hours of OGD exposure, the cell survival rate dropped to 53.82±0.29%, so OGD exposure for 18 hours was selected for subsequent experiments.

[0083] The drug toxicity experiment of COS was evaluated by CCK-8 analysis, and no obvious toxic effects of COS treatment were observed in the COS concentration range of 0-15μM ( Figure 3 B). Before OGD, PC12 cells were treated with COS at different concentrations (0-15 μM) for 2 h, and the cell survival rate increased in a dose-dependent manner, reaching a peak of 59.37±0.61% ( Figure 3 C).

[0084] To demonstrate that COS regulates the PI3K / AKT / NF-κB pathway, western blotting was performed after OGD. Figure 3 The results of Western blot analysis were similar to those of in vivo experiments ( Figure 3 In addition, we used immunofluorescence to analyze the nuclear translocation of NF-κB in PC12 cells. In PC12 cells exposed to OGD, the nuclear translocation of NF-κB was significantly increased, but after COS administration, the nuclear translocation of NF-κB was significantly reduced, and the cytoplasmic expression was increased. The inhibition of PI3K signaling by LY294002 significantly counteracted the COS-mediated cytoplasmic NF-κB translocation ( Figure 3 H in ). Therefore, COS inhibited OGD-induced neuronal injury by regulating the PI3K / Akt / NF-κB pathway in vitro.

[0085] 3COS reduced the occurrence of inflammatory processes in both in vivo and in vitro models.

[0086] The experimental animals, animal model construction, animal grouping and treatment were the same as in 1.1. Cell culture and treatment were the same as in 2.3.

[0087] 3.1 Real-time quantitative PCR detection

[0088] Total RNA was extracted from brain tissue and PC12 cells using TRIzol reagent (Invitrogen, Carlsbad, USA). Total RNA was then reverse transcribed into cDNA using prime script RTMasterMix (Takara, RR036A) according to the study protocol. Real-time quantitative PCR was performed using TB Green Premix Ex Taq II (Takara, RR820A). mRNA levels were normalized according to the mRNA levels of β-Actin. The primer sequences used for qRT-PCR are listed in Table 2.

[0089] Table 2 Primer information for real-time quantitative PCR

[0090] Gene Forward primer (5'-3') Reverse primer (3'-5') TNF-α GAGGTCAACCTGCCCAAGTA(SEQ ID NO.1) GCTGGGTAGAGAACGGATGA(SEQ ID NO.2) IL-6 CCAGTTGCCTTCTTGGGACT(SEQ ID NO.3) TCTGACAGTGCATCATCGCT(SEQ ID NO.4) IL-18 CGAACAGCCAACGAATCCCAGAC(SEQ ID NO.5) TCACAGATAGGGTCACAGCCAGTC(SEQ ID NO.6) IL-1β AATCTCACAGCAGCATCTCGACAAG(SEQ ID NO.7) TCCACGGGCAAGACATAGGTAGC(SEQ ID NO.8) β-Actin AAGTCCCTCACCCTCCCAAAAG(SEQ ID NO.9) AAGCAATGCTGTCACCTTCCC(SEQ ID NO.10)

[0091] TNF-α: tumor necrosis factor α; IL-6: interleukin 6; IL-18: interleukin 18; IL-1β: interleukin 1β; β-Actin: β-actin.

[0092] 3.2 Western blotting

[0093] The proteins from SD rat brain tissue or PC12 cells were subjected to standard western blot analysis using the method described in 2.2.

[0094] 3.3 Immunofluorescence staining of brain tissue

[0095] For in vivo studies, brain tissues were collected at 24 h and 7 d after HI injury. 5 μm paraffin sections were dried at 65 °C for 2 h, followed by xylene dewaxing, ethanol hydration, and antigen retrieval. For in vitro model analysis, PC12 cells were collected and fixed with 4% paraformaldehyde for 15 min. Then, they were perforated with 0.3% Triton X-100 for 20 min and blocked with 3% BSA at 37 °C for 1.5 h. After washing, the sections were incubated with anti-GFAP (Proteintech, 16825-1-AP), anti-IBA1 (Abcam, ab178846), anti-MAP2 (Abcam, ab254264), anti-MBP (Abcam, ab218011), anti-IL6 (Affinity, DF6087), and anti-NFκB (CellSignaling Technology, 8242) antibodies at 4 °C overnight. The next day, they were incubated with Alexa fluor 647 or 488-conjugated IgG secondary antibodies at room temperature for 2 h. Finally, digital images were acquired using a fluorescence microscope (Nikon, Japan).

[0096] 3.4 Results

[0097] The present invention explores downstream inflammatory signals mediated by the PI3K / AKT / NF-κB signaling pathway. Figure 4 A in the figure is the Western blot result of the left brain tissue of SD rats. 24h after HI injury, the mRNA and protein levels of TNF-α, IL-6, IL-18, and IL-1β in the brain tissue of SD rats were significantly upregulated compared with those in the Sham group. However, the mRNA and protein levels of TNF-α, IL-6, IL-18, and IL-1β downregulated by COS were greatly activated by LY294002 ( Figure 4 AC in).

[0098] 18 hours after OGD, the in vitro experiments on PC12 cells also obtained similar results to those in the animal experiments ( Figure 5 AC in Figure 1). IL-6 immunofluorescence staining showed that COS treatment significantly reduced the fluorescence positive rate of IL6 positive cells ( Figure 5 LY294002 partially reversed this protective effect ( Figure 5 E).

[0099] Several studies have shown that microglia and astrocytes are key regulators of inflammatory responses in the central nervous system. They respond to inflammatory signals and can promote inflammation, making them important players in neurological diseases. Therefore, the present invention performed immunofluorescence staining of IBA-1 (a marker of microglia) and GFAP (a marker of astrocytes) to explore whether COS can reduce the activation of glial cells in the hippocampus ( Figure 4F, G), the results showed that in brain tissue, the microglia and astrocytes significantly activated by HI were reversed by COS administration, and this improvement was blocked by LY294002 ( Figure 4 These data suggest that COS can activate the PI3K / AKT signaling pathway, thereby alleviating inflammation-induced neuronal dysfunction.

[0100] 4LY294002 abolished the neuroprotective effect of COS in SD young mice after HI brain injury

[0101] The experimental animals, animal model construction, animal grouping and treatment were the same as 1.1.

[0102] 4.1 Histological staining

[0103] Seven days after HI injury, brain tissues of SD rats were collected and fixed in 4% paraformaldehyde for 24 h. After dehydration with graded ethanol, the samples were embedded in paraffin and cut into coronal sections of approximately 5 μm thick, followed by hematoxylin-eosin (HE) and Nissl (Solabo, Beijing, China) staining according to the reagent instructions. Finally, images were taken using an optical microscope.

[0104] 4.2 Western blotting

[0105] The proteins from SD rat brain tissue or PC12 cells were analyzed by standard western blot using the method described in 2.2.

[0106] 4.3 Immunofluorescence staining of brain tissue

[0107] The method in 3.3 was used for brain tissue MAP-2 and MBP immunofluorescence staining.

[0108] 4.4 Results

[0109] To evaluate neuronal morphology and Nissl body density, HE and Nissl staining were performed on SD rats 7 days after HI injury. Figure 6 As shown in A, the neurons in the sham group are neatly arranged, and the nuclei of cells in each brain region are oval or round and complete. In addition, there are a large number of complete Nissl bodies around the nuclei ( Figure 6 In contrast, damaged neurons increased significantly after HI, showing nucleus shrinkage, disorder, and irregular arrangement. In addition, a small number of residual Nissl bodies were observed in the CA1, CA3, DG, and cortical regions of the hippocampus after HI injury. COS treatment significantly promoted neuronal morphological recovery and increased neuronal density in the CA1, CA3, DG, and cortical regions of the hippocampus. However, pretreatment with LY294002 partially reversed the histopathology and neuronal recovery of COS.

[0110] Microtubule-associated protein 2 (MAP2) is present in large quantities in neurons, stabilizing microtubules and maintaining the stability of the cytoarchitecture of neurons. Myelin basic protein (MBP) is a component associated with myelination in the developing brain. MAP2 and MBP are sensitive markers of brain HI injury. Western blotting and immunofluorescence staining of MAP-2 and MBP were performed 7 days after HI injury in newborn SD mice. Figure 7 As shown in Figure 5C, impaired MAP2 immunolabeling was observed in the cortical area, which was reflected in the reduction of neuronal terminals or the appearance of broken dendrites in the HI group. In addition, the MBP immunofluorescence intensity was significantly decreased, indicating a significant loss of axonal fibers ( Figure 7 COS treatment significantly increased MAP2 and MBP levels compared with the HI group, and this improvement was blocked by LY294002 ( Figure 7 EG in). Figure 7 A in Figure 2 is the Western blot analysis result of the left cerebral tissue of SD rats. The trend of the Western blot results of MAP-2 and MBP is the same as that of the immunofluorescence staining results ( Figure 7 The results showed that COS promoted myelination and the development of neuronal dendrites.

[0111] 5COS improved long-term neurobehavioral deficits and weight loss in young SD mice.

[0112] 5.1 Neurobehavioral testing

[0113] The experimental animals, animal model construction, animal grouping and treatment were the same as 1.1.

[0114] Neurobehavioral testing was performed in a double-blind manner 3 weeks after HI injury.

[0115] 5.1 Morris water maze (MWM) test

[0116] MWM test was performed 21 days after HI injury in SD rats. In the MWM test, mice swam freely in a water maze to find a hidden platform underwater. In brief, SD rats swam in a black circular pool (50 cm in height and 160 cm in diameter), which was divided into four equal sectors and located in a room away from light and noise. In addition, a black platform (15 cm in diameter) was located 1 cm below the water surface. On days 1-5, SD rats were trained once a day, starting from four different quadrants to find the hidden platform, swimming for 60 seconds each time. If the platform was not found within 60 seconds, the experimenter guided the SD rats to stand on the platform for 15 seconds. On the 6th day, the platform was removed, and all SD rats were allowed to swim for 60 seconds and the swimming trajectory was recorded. The search trajectory and frequency of crossing the platform were recorded and analyzed by DigBehv (Shanghai Jilang Software Technology Co., Ltd.).

[0117] 5.2 Y-maze test

[0118] The Y-maze test was conducted in black plexiglass, with three arms (50 cm long × 16 cm wide × 32 cm high) designated A, B, and C. SD rats were placed at the distal end of arm A and allowed to freely explore all three arms for a total of 5 min. All footprints were recorded with a camera mounted above the maze. The spontaneous alternation rate (entry into an arm different from the previous two entries) was determined by the following formula: (number of alternations / (total number of arm entries-2))*100.

[0119] 5.3 Balance beam test

[0120] The balance beam test is an experiment that forces SD rat pups to remain upright and walk across a tall, narrow balance beam to the other end of the platform. The balance beam walking device consists of a 1-meter-long wooden bar with a flat width of 12 mm, located 50 cm above the ground. A black box is placed at the end of the wooden bar as the endpoint. The test starts at 9 am every day and is carried out for 3 consecutive days (2 days of training and 1 day of testing). Neurobehavioral function is assessed by measuring the time required to cross the beam and the number of foot slips that occur during the process. The data is recorded by a camera.

[0121] 5.4 Results

[0122] Brain injury can lead to changes in the behavioral function of SD rats. Behavioral experiments were performed 3 weeks after HI injury to evaluate the effect of COS on motor deficits.

[0123] Spontaneous alternation is a measure of spatial working memory and can be calculated using the Y-maze test. Figure 8 As shown in A, compared with the SD pups in the Sham group, the spontaneous alternation rate of the SD pups in the HI group was significantly reduced to 42.8% (p<0.01). The spontaneous alternation percentage of the SD pups in the HI+COS group was significantly increased (p<0.01) compared with that in the SD pups in the HI group, and the protective effect of COS was blocked by LY294002 ( Figure 8 B).

[0124] The balance beam test is an assessment of fine balance and motor coordination and has been validated by previous work. Figure 8 The results shown in D and E in Figure 1 showed that the HI group SD rats had longer crossing time and more foot slips than the Sham group, while COS treatment significantly shortened the crossing time and foot slips, and these beneficial effects were inhibited by LY294002.

[0125] In addition, we also recorded the body weight of SD rats on the 7th day (P7), 14th day (P14), 21st day (P21), and 28th day (P28) after birth. Before HI injury, there was no statistical difference in the body weight of rats in each group (P7). However, on P14 and P28, it was observed that the body weight of SD rats in the HI group was significantly reduced compared with that in the Sham group. COS treatment effectively alleviated the weight loss caused by HI ( Figure 8 C). These findings suggest that COS provides potential neuroprotection to the brain after HI injury.

[0126] The above is only a preferred embodiment of the present invention. It should be pointed out that for ordinary technicians in this technical field, several improvements and modifications can be made without departing from the principle of the present invention. These improvements and modifications should also be regarded as the scope of protection of the present invention.

Claims

1. Application of costunolide in the preparation of drugs for treating neonatal brain damage.

2. The use according to claim 1, characterized in that: The neonatal brain damage is hypoxic-ischemic brain damage.

3. The use according to claim 1, characterized in that: The costusinolide reduces the cerebral infarction area of ​​neonatal hypoxic-ischemic brain damage and improves cerebral edema.

4. The use according to claim 1, characterized in that: The costunolide promotes the recovery of neuronal morphology in neonates with hypoxic-ischemic brain damage and increases the neuronal density in the CA1 region, CA3 region, DG region and cortical region of the hippocampus.

5. The use according to claim 1, characterized in that: The costunolide promotes myelination and the development of neuronal dendrites.

6. The use according to claim 1, characterized in that: The costunolide activates the PI3K / AKT signaling pathway and alleviates inflammation-induced neuronal dysfunction.

7. The use according to claim 1, characterized in that: The costunolide inhibits hypoxia-ischemia-induced neuronal damage by regulating the PI3K / AKT / NF-κB pathway.

8. The use according to claim 1, characterized in that: The costunolide inhibits neuronal inflammation.

9. The use according to claim 1, characterized in that: The costunolide alleviates the oxygen-glucose deprivation damage of PC12 cells.

10. The use according to claim 1, characterized in that: The active ingredient of the drug includes costunolide.

Images