Mortierella chlamydosporia and application thereof

Abstract

The invention relates to the technical field of biological control, and discloses a hyphantria cunea biocontrol bacterium and application thereof, the biocontrol bacterium is classified and named as Entomortierella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella chlamydosporella The hyphantria cunea biocontrol bacterium strain provided by the invention can obviously inhibit the survival activity of hyphantria cunea, the death rate of hyphantria cunea larvae can be increased to 96.7% after 7 days of treatment, and the hyphantria cunea larvae can die in the pupal stage and cannot be subjected to eclosion, so that the hyphantria cunea biocontrol bacterium strain can be used for preventing and treating hyphantria cunea, is typical biological prevention and treatment, can avoid the problems of drug resistance, environmental pollution and the like caused by chemical prevention and treatment, and has broad application prospects. Good application prospects are realized.

Description

Technical Field

[0001] The invention belongs to the technical field of microorganisms and relates to Mortierella chlamydosporium and applications thereof. Background Art

[0002] The gypsy moth (Hyphantria cunea) is native to North America. It spread to Europe and Asia in the late 1940s and became a global plant quarantine pest that seriously harms trees. The gypsy moth has the characteristics of a variety of host plants, great reproductive potential, strong adaptability, wide transmission routes, severe direct harm, and spread that disturbs people. The gypsy moth can harm more than 100 species of trees, fruit trees, and flowers. After eating all the leaves, it can harm a variety of crops and vegetables nearby. At present, the technical system for the comprehensive management of the gypsy moth is still imperfect, and the prevention and control technical means mainly use chemical control. The promotion and application of new sustainable biological control technologies are relatively rare, which is not conducive to pesticide reduction and pest control actions.

[0003] Therefore, it is urgent to find a green control technology with good and lasting prevention effect on the gypsy moth. The microbial control of the gypsy moth mainly uses specific microbial preparations to inhibit or kill pests. Specifically, foliar spraying can be used. The more effective method is to use Beauveria bassiana and Bacillus thuringiensis, while the development and utilization of other gypsy moth biocontrol agents are less. Compared with chemical control, microbial control has the advantages of environmental protection and sustainability, and can reduce pollution to the environment and kill non-target organisms. Therefore, in the prevention and control of the gypsy moth, microbial control is a method worthy of promotion and application, and the development of gypsy moth biocontrol bacteria has broad prospects. Summary of the invention

[0004] The invention aims to provide a Mortierella chlamydospora and application thereof in inhibiting the growth of the gypsy moth.

[0005] Technical solution: In order to enrich the resource library of biocontrol agents for the American white moth, the present invention provides a chlamydospora fungus, the strain number of which is JSAFC 2128, which is deposited in the General Microbiological Center of the China National Microbiological Culture Collection Administration on September 23, 2024, with a deposit number of CGMCC41564, and the microbial classification name is Entomortierella chlamydospora.

[0006] Furthermore, the nucleotide sequence of the ITS gene of the gypsy moth biocontrol bacteria is shown in SEQ ID NO.1.

[0007] The invention also provides a biological control fungus and a biological control fungus agent for the gypsy moth. The active ingredient of the biological control fungus and a biological control fungus agent for the gypsy moth is the above-mentioned Mortierella chlamydospora, its hyphae or conidia.

[0008] The present invention also provides the use of the above-mentioned Mortierella chlamydospora and the gypsy moth biocontrol agent in inhibiting the growth of the gypsy moth.

[0009] Furthermore, the application is specifically to spray the spore suspension of Mortierella chlamydospora on the larvae or pupae of the American white moth.

[0010] Furthermore, the application also includes feeding mulberry leaves soaked in a spore suspension of Mortierella chlamydosporium.

[0011] Furthermore, the preparation method of the spore suspension is as follows: (1) inoculating Entomortierella chlamydospora JSAFC 2128, a biocontrol bacterium of the American white moth, on a PDA medium to prepare a culture; (2) placing the culture prepared in step (1) in a Tween-80 solution (0.01%), filtering out the spores, and preparing a biocontrol agent of the American white moth.

[0012] Furthermore, the culture condition in step (1) is culture at 25° C. in the dark for 5-7 days.

[0013] Further, the spore concentration of the chlamydosporium is 10 7 Pieces / mL.

[0014] Beneficial effects: Compared with the prior art, the present invention has the following outstanding and significant advantages: The present application obtains a species of Entomortierella chlamydospora JSAFC 2128 by isolating and purifying soil from Yandang Mountain, Wenzhou, Zhejiang. The strain can be used as a biocontrol strain, has a high lethality rate against the gypsy moth, is environmentally friendly and non-toxic, can significantly inhibit the survival activity of the gypsy moth, and can increase the mortality rate of the gypsy moth to 96.7% within 7 days, which is of great significance for the future development of biocontrol agents for the prevention and control of the gypsy moth. BRIEF DESCRIPTION OF THE DRAWINGS

[0015] Figure 1 : Colony morphology of Entomortierella chlamydospora JSAFC 2128, a biological control bacterium for American white moth of the present invention;

[0016] Figure 2 :Phylogenetic tree of Entomortierella chlamydospora JSAFC 2128, a biocontrol agent against American white moth;

[0017] Figure 3 : The effect of the biological control bacteria Entomortierella chlamydospora JSAFC 2128 of the present invention on the growth of larvae of the gypsy moth;

[0018] Figure 4 : The effect of the biocontrol bacteria Entomortierella chlamydospora JSAFC 2128 of the present invention on the growth of nymphalid moth pupae. DETAILED DESCRIPTION

[0019] The technical solution of the present invention is further described below in conjunction with the accompanying drawings.

[0020] As described in the present invention, the term "biocontrol bacteria" refers to beneficial microorganisms that can control plant pests, mainly bacteria, fungi, and actinomycetes.

[0021] Example 1: Isolation and identification of Entomortierella chlamydospora JSAFC 2128, a biocontrol bacterium for the American white moth

[0022] 1. Isolation of Entomortierella chlamydospora JSAFC 2128, a biocontrol agent for the American white moth

[0023] JSAFC 2128 was isolated from soil from Yandang Mountain, Wenzhou, Zhejiang. The characteristics of the colony are as follows: When cultured on PDA plate medium, the colony grows rapidly and is cotton-like. The surface color is white and the bottom color is orange-yellow ( Figure 1 ).

[0024] 2. Molecular biological identification of Entomortierella chlamydospora JSAFC 2128, a biocontrol agent for the American white moth

[0025] (1) The genomic DNA of strain JSAFC 2128 was extracted using a kit produced by TIANGEN.

[0026] (2) Amplification of ITS gene from genomic DNA. DNA amplification was performed in a 30 μL reaction volume, including 15 μL 2×EasyTaq PCR SuperMix (+dye), 1 μL (10 μM) of primer pair ITS1 (SEQ ID NO.2: 5'-CTTGGTCATTTAGAGGAAGTAA-3') & ITS4 (SEQ ID NO.3: 5'-TCCTCCGCTTATTGATATGC-3'), 2 μL template DNA and 11 μL ddH2O. The PCR amplification program conditions were as follows: 94°C pre-denaturation for 5 min; 94°C denaturation for 30 s, 54°C annealing for 45 s, 72°C extension for 60 s, for a total of 35 cycles; and finally 72°C extension for 10 min.

[0027] (3) The amplified PCR products were subjected to 1% agarose gel electrophoresis and observed under ultraviolet light. The PCR products with target bands were sent to Nanjing Qingke Biotechnology Co., Ltd. for sequencing. The sequencing results were as follows: the ITS gene sequence of strain JSAFC 2128 was SEQ ID NO. 1 (TGTTTTATGGCACTTTTTTAAAAATCCATATCCACCTTGTGTGCAATGTTTTTAG ATCTCGCCAAAATGATATTTTGGTTAGGTTTTATTATATTACATCAACTCTTATTTAACTTGATTTGTCTGAAAAATATTATGAATTTTTAACTTAATTCAAAATACAACTTTCAACAACGGATCTCTTGGCTCTCGCATCGATGAAGAACGCAGCGAAATGCGATACGTAATGTGAATTGCAGAATTCAGTGAATCATCGAATCTTTGAACGCATATTGCGCTCTCTGGTATTCCGGAGAGCATGCTTGTTTGA GTATCAGTAAACACCCTCAGAGCTTTTTTTTTCTTGATTTTCAAATCTTGGGGCTCTGGATTTGAGTGATCCCAACGGGGTCTTTTTCGAAAGGACATGGCGGGCCACTTGAAATACAGGTGCAGC TGAACTTTCTTCTGAGCTAAAAGCATATTTATTTAGTCCTGTCAGCACATGTGCTGCCGGATTATTACTTCTGCTGCAGCTTACATAAAGGTTGACTGTTCAAATGCTGACTGATACAGAATTTTT).

[0028] (4) Compare the sequence of SEQ ID NO.1 on the NCBI database website and establish a phylogenetic tree, see Figure 2 . The comparison results are shown in Table 1. According to the results in Table 1, it can be inferred that the biocontrol bacteria JSAFC 2128 of the present invention is Entomortierella chlamydospora, and the strain was deposited in the General Microbiological Center of China Microbiological Culture Collection Administration on September 23, 2024, with a deposit number of CGMCC41564, and a classification name of Entomortierella chlamydospora JSAFC 2128. The deposit address is the Institute of Microbiology, Chinese Academy of Sciences, No. 3, Beichen 1st Courtyard, Chaoyang District, Beijing.

[0029] Table 1 Sequence alignment results of SEQ ID NO.1

[0030]

[0031] Example 2: Inhibitory effect of Entomortierella chlamydospora JSAFC 2128 on the growth of the nymphalidae

[0032] 1. Preparation of spore suspension

[0033] (1) JSAFC 2128 was inoculated on PDA medium to prepare a culture, and the culture conditions were: 25°C in the dark for 5-7 days;

[0034] (2) Use an inoculation needle to pick up the bacterial mass in the culture and place it in a Tween-80 solution (0.01%) and shake it thoroughly. After shaking, filter out the spores and adjust the concentration to prepare a gypsy moth biocontrol agent. The spore concentration of the gypsy moth biocontrol agent is 10 7 Pieces / mL.

[0035] 2. Larvae inoculation

[0036] The gypsy moth used in the test was 2-3 instar larvae, purchased from the Institute of Forest Ecology, Environment and Protection, Chinese Academy of Forestry. If it was less than 3 years old, it was raised in an artificial climate box (temperature 25°C, humidity 60-70%, light-dark ratio 14:10) until it was 3 years old, and surface-sterilized mulberry leaves were provided every day.

[0037] The healthy gypsy moth larvae were immersed in the above-prepared gypsy moth biocontrol agent for 30 seconds by dipping. The immersed gypsy moths were transferred to sterile culture boxes (a total of 20 culture boxes, each box contains a treated gypsy moth) and fed with fresh mulberry leaves (the mulberry leaves were also immersed in the spore suspension for 15 seconds). In the experiment, the gypsy moths and mulberry leaves treated with 0.01% Tween-80 solution were used as controls and placed in a constant temperature incubator at 25°C to observe and record the death of gypsy moths within 7 days. The experiment was repeated 3 times in total.

[0038] The experimental results are shown in Table 2.

[0039] Table 2 Mortality of nymphalid moth larvae after inoculation with JSAFC 2128 (%)

[0040]

[0041] As shown in Table 2 and Figure 3As shown, the survival rate of the larvae of the gypsy moth treated with the gypsy moth biocontrol agent for 7 days was significantly lower than that of the control group, the larvae were also covered with hyphae, and they began to be lethal from the first day, and the mortality rate also increased significantly after the second day, and the dead larvae were mostly concentrated in the 3rd to 6th day. The gypsy moth biocontrol agent of the present invention showed strong lethal activity to the larvae of the gypsy moth, and the mortality rate of the gypsy moth was increased to 96.7% after the gypsy moth was treated and cultured for 7 days.

[0042] 3. Pupa inoculation

[0043] The healthy gypsy moth pupae were immersed in the above prepared gypsy moth biocontrol agent for 30 seconds by dipping method. The immersed gypsy moth pupae were transferred to sterile culture boxes (one treated gypsy moth pupa was placed in each box). In the experiment, the gypsy moth pupae treated with 0.01% Tween-80 solution were used as controls and placed in a constant temperature incubator at 25°C to observe and record the growth status of the gypsy moth pupae within 7 days.

[0044] The experimental results are as follows Figure 4 7 days after being treated with the gypsy moth biocontrol agent, the pupae of the gypsy moth turned dark brown, could not develop normally, and the emergence rate was 0.

[0045] The above description is only a preferred embodiment of the present invention and does not limit the present invention in any way. Any simple modification, change and equivalent transformation made to the above embodiment based on the technical essence of the present invention still falls within the protection scope of the technical solution of the present invention.

Claims

1. An Entomortierella chlamydospora, characterized in that: The strain number of the thick-walled spore mold is JSAFC 2128, which is preserved in the General Microbiology Center of the China Microbiological Culture Collection Administration. The preservation time is September 23, 2024, the preservation number is CGMCC41564, and the microbial classification name is Entomortierella chlamydospora.

2. The biological control bacteria of the gypsy moth according to claim 1, characterized in that The nucleotide sequence of the ITS gene of Mortierella chlamydosporium is shown in SEQ ID NO.

1.

3. A biological control fungus agent for the American white moth, characterized in that: The active ingredient of the gypsy moth biocontrol fungus is the Mortierella chlamydosporium, its hyphae or conidia as described in any one of claims 1 to 2.

4. Use of the Mortierella chlamydospora described in any one of claims 1 to 2 and the biological control fungus of the gypsy moth described in claim 3 in inhibiting the growth of the gypsy moth.

5. The use according to claim 4, characterized in that: The application is specifically to spray the spore suspension of Mortierella chlamydospora according to any one of claims 1 to 2 on the larvae or pupae of the American white moth.

6. The use according to claim 5, characterized in that: The application also includes feeding mulberry leaves soaked with spore suspension of Mortierella chlamydosporium.

7. The use according to claim 5, characterized in that: The preparation method of the spore suspension is: (1) inoculating Entomortierella chlamydospora JSAFC 2128, a biocontrol bacterium of the American white moth, on a PDA medium to prepare a culture; (2) placing the culture obtained in step (1) in a Tween-80 solution, filtering out the spores, and preparing a biological control agent for the gypsy moth.

8. The use according to claim 6, characterized in that: The culture conditions described in step (1) are: culture at 25° C. in the dark for 5-7 days.

9. The use according to claim 5, characterized in that: The spore concentration of Mortierella chlamydospora in step (2) is 10 7 Pieces / mL.

Images