Genetically modified cell of Saccharomyces cerevisiae

Abstract

The present invention relates to a genetically modified cell and a method for producing fucosyllactose using the same, and in particular to a genetically modified cell of Saccharomyces cerevisiae and its application, and belongs to the field of biological genetic engineering technology. The present invention provides a genetically modified cell, which comprises a recombinant nucleic acid sequence encoding a polypeptide having α-1,2-fucosyltransferase polypeptide (α-1,2-fucosyltransferase) activity. The α-1,2-fucosyltransferase polypeptide, including but not limited to a polypeptide having an amino acid sequence with at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, 100% identical amino acid sequence to SEQ ID NO: 1-25. The genetically modified cell improves the ability of the starting strain to synthesize fucosyllactose.

Description

Technical Field

[0001] The present invention relates to a gene-modified cell, in particular to a gene-modified cell using saccharomyces cerevisiae as a host, and specifically to a gene-modified cell of saccharomyces cerevisiae and its application, belonging to the field of biological genetic engineering technology. Background Art

[0002] Human milk oligosaccharides (HMOs) are a unique and diverse mixture of oligosaccharides found in human milk. They are the third largest solid component of breast milk, after fat and lactose. Among them, 2'-fucosyllactose (2'-FL) and 3'-fucosyllactose (3'-FL) are key components of HMOs and have been shown to play an important role in the brain, intestinal tract, and growth and development of infants.

[0003] 2'-FL and 3'-FL have been approved as raw materials for infant formula by the U.S. FDA, the European Union, Australia, New Zealand, Canada and other countries and regions, and can be added to infant formula, regular food, dietary supplements and / or medical food.

[0004] Because chemical synthesis of fucosyllactose requires multiple protection and deprotection steps, the product yield is low and the production cost remains high. Therefore, fucosyllactose is often synthesized using enzymatic methods and microbial cell factories. Pure enzymatic methods generally require fucose as a substrate, which is costly. Cell factories, on the other hand, often allow for de novo synthesis, enabling low-cost, large-scale industrial production.

[0005] One feasible method for large-scale synthesis of fucosyllactose is the microbial cell factory method. Existing technologies mostly rely on Escherichia coli to biosynthesize fucosyllactose. Given a carbon source, the genetic pathway within E. coli is used to synthesize the precursor GDP-L-fucose and the acceptor lactose. Exogenous fucosyltransferase is then introduced into the engineered bacteria to combine the two precursors, resulting in industrial synthesis of fucosyllactose.

[0006] Saccharomyces cerevisiae strains are recognized as safe microorganisms, characterized by their non-pyrogenic properties, lack of toxic side effects, high food safety, and reduced subsequent isolation and purification costs. Furthermore, Saccharomyces cerevisiae is widely used in industry, but it cannot utilize lactose or transport it into cells. Although scientists have introduced a lactose transporter into Saccharomyces cerevisiae, the recombinant Saccharomyces cerevisiae produces only 0.5 g / L of 2'-fucosyllactose (Yu et al., Microb Cell Fact, 2018, 17:101. DOI:10.1186 / s12934-018-0947-2), which is difficult to meet the needs of industrial production.

[0007] Chinese patents 202010187309.1 and 202010187632.9 utilize recombinant Saccharomyces cerevisiae to synthesize 2'-FL, which includes GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, and α-1,2-fucose transferase, achieving yields of 2.9 g / L and 3.8 g / L, respectively. Chinese patent 202080061688.8 discloses yeast cells genetically modified to produce one or more human milk oligosaccharides, wherein the yeast cells include GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, and an ABC transporter. Expressing heterologous ABC transporters in genetically modified yeast cells can increase the yield and purity of HMOs.

[0008] International Publication No. WO2023122270(A2) discloses a host cell capable of producing HMOs. The host cell contains one or more heterologous nucleic acids, each encoding a fucosyltransferase, a GDP-fucosyl synthase, a GDP-mannose-4,6-dehydratase, and a lactose permease. Compared to previous technologies, this invention reduces the content of impurities in the product, such as DFL, and improves the yield of 2'-FL.

[0009] With the gradual rise of HMOs in recent years, it is of great significance to optimize the key factors of the fucose synthesis pathway to improve the efficiency of fucose synthesis. Summary of the Invention

[0010] Purpose of the invention: To provide a genetically modified cell and its application in synthesizing fucosyllactose, which has the activity of synthesizing fucosyllactose from scratch and has no undesirable side effects. The fucosyllactose includes 2'-fucosyllactose

[0011] (2'-fucosyllactose,2'-FL).

[0012] The technical solution of the present invention is:

[0013] A genetically modified cell comprises a recombinant nucleic acid sequence encoding a polypeptide having α-1,2-fucosyltransferase activity.

[0014] The α-1,2-fucosyltransferase polypeptide refers to a polypeptide that can catalyze the transfer of a fucose residue from a donor substrate to an acceptor molecule. The donor substrate used to transfer the fucose residue to the acceptor molecule is typically guanosine diphosphate L-fucose (GDP-L-fucose). Suitable acceptor molecules for fucose residues include oligosaccharides, glycopeptides, glycoproteins, and glycolipids. Typically, the fucose residue is transferred to, for example, an N-acetylglucosamine residue, an N-acetylgalactosamine residue, a galactose residue, a fucose residue, a sialic acid residue, or a glucose residue of an oligosaccharide, or a sugar portion of a glycoprotein or glycolipid; further, the α-1,2-fucosyltransferase polypeptide has the activity of catalyzing the synthesis of 2'-FL using GDP-L-fucose and lactose as substrates.

[0015] The genetically modified cells described in the present application are genetically modified cells of Saccharomyces cerevisiae, which include Saccharomyces sp. cells that can produce fucosyllactose after being modified by the technical scheme described in the present invention. The starting strains include but are not limited to Saccharomyces cerevisiae, Saccharomyces paradoxus, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces cariocas, Saccharomyces mikatae and Saccharomyces kudriavzevii.

[0016] The α-1,2-fucosyltransferase polypeptide is derived from Helicobacter pylori, Thermophilic Chlorella, Escherichia coli, Caenorhabditis elegans, Schistosoma mansoni, Bacucilius cereus, Pseudopedobater saltans, Helicobacter mustelae, Bacillus fragilis, Bacteroides vulgatus, Bacteroides fragilis, or Bacillus smithii.

[0017] Preferably, the α-1,2-fucosyltransferase polypeptide is an α-1,2-fucosyltransferase (α-1,2-fucosyltransferase) excavated by the applicant from Bacillus smithii in nature, named BSFut-wt, whose amino acid sequence is shown in SEQ ID NO: 1, and the nucleotide sequence is shown in SEQ ID NO: 26. It has the activity of catalyzing the synthesis of 2'-FL and is accompanied by very low side activity of synthesizing DFL (Difucosyllactose).

[0018] The amino acid sequence of the α-1,2-fucosyltransferase polypeptide is shown in SEQ ID NO: 1. After comparison with the NCBI database, the α-1,2-fucosyltransferase polypeptide with the amino acid sequence shown in SEQ ID NO: 1 is most similar to Bacillus cereus VD107 (GenBank: EJR48924.1), and the amino acid sequences of the two are only 69.31% identical (as of October 20, 2023), indicating that the amino acid sequence similarity between the sequence and the known enzymes is not high; and the α-1,2-fucosyltransferase (α-1,2-fucosyltransferase,) derived from Helicobacter pylori is named

[0019] HPFut-wt, the amino acid sequence is shown in SEQ ID NO: 36, and the nucleotide sequence is shown in SEQ ID NO: 37, with a similarity of 33.57%.

[0020] Further preferably, the α-1,2-fucosyltransferase polypeptide is a polypeptide having an amino acid sequence as shown in SEQ ID NO: 2-25, which is a derivative peptide of the polypeptide having an amino acid sequence as shown in SEQ ID NO: 1, and these polypeptides have no side activities.

[0021] In one embodiment, the α-1,2-fucosyltransferase polypeptide is a polypeptide having an amino acid sequence as shown in SEQ ID NO: 1, SEQ ID NO: 2, SEQ ID NO: 3, SEQ ID NO: 4, SEQ ID NO: 5, SEQ ID NO: 6, SEQ ID NO: 7, SEQ ID NO: 8, SEQ ID NO: 9, SEQ ID NO: 10, SEQ ID NO: 11, SEQ ID NO: 12, SEQ ID NO: 13, SEQ ID NO: 14, SEQ ID NO: 15, SEQ ID NO: 16, SEQ ID NO: 17, SEQ ID NO: 18, SEQ ID NO: 19, SEQ ID NO: 20, SEQ ID NO: 21, SEQ ID NO: 22, SEQ ID NO: 23, SEQ ID NO: 24, and SEQ ID NO: 25. The polypeptides shown in SEQ ID NOs: 2-25 are α-1,2-fucosyltransferase polypeptides formed by replacing one or more amino acid residues and / or fragments in the polypeptide shown in SEQ ID NO: 1. Specifically, the α-1,2-fucosyltransferase polypeptide is selected from the amino acid sequences obtained by any one of the following.

[0022] 1) In the amino acid sequence shown in SEQ ID NO: 1, the amino acid fragment at positions 5-7 is replaced by QVY to GIW, and the amino acid fragment at positions 28-41 is replaced by NDVYLDSSTSYEKY to DDVYLDIETYFEKN / or

[0023] KDVYLDTVTWYEKY, thereby obtaining a polypeptide with an amino acid sequence as shown in SEQ ID NO: 2 or SEQ ID NO: 3;

[0024] 2) In the amino acid sequence shown in SEQ ID NO: 2, the amino acid fragment at positions 55-62 is replaced by HIKPKHAS with HTKPKLAK or PIKPKEAK, thereby obtaining a polypeptide with the amino acid sequence shown in SEQ ID NO: 4 or SEQ ID NO: 5, respectively;

[0025] 3) In the amino acid sequence shown in SEQ ID NO: 5, the amino acid fragment at positions 68-74 is replaced by NLSDLDE with KLSDIDE or ELGSFDD, thereby obtaining a polypeptide with the amino acid sequence shown in SEQ ID NO: 6 or SEQ ID NO: 7, respectively;

[0026] 4) In the amino acid sequence shown in SEQ ID NO: 7, the amino acid fragment at positions 87-93 is replaced by KKSTYVE with KKDTVIV / or EKKTMIK, thereby obtaining a polypeptide with the amino acid sequence shown in SEQ ID NO: 8 / or SEQ ID NO: 9, respectively;

[0027] 5) In the amino acid sequence of SEQ ID NO: 9, the amino acid fragment at positions 110-117 is replaced by TYFKGYY with SFLYGYW or AYLEGYW, thereby obtaining a polypeptide with the amino acid sequence of SEQ ID NO: 10 or SEQ ID NO: 11, respectively;

[0028] 6) In the amino acid sequence shown in SEQ ID NO: 10, the amino acid residue at position 122 is replaced by W to Y, and the amino acid fragment at positions 126-136 is replaced by EEDLLKDYQFT to KEDLLKDYQFL or LEDLKKAFQFK, thereby obtaining a polypeptide with the amino acid sequence shown in SEQ ID NO: 12 or SEQ ID NO: 13, respectively;

[0029] 7) In the amino acid sequence of SEQ ID NO: 12, the amino acid fragment at positions 166-173 is replaced by WLNKEYRD with YLNKEYEE or YLNKEYEE, thereby obtaining polypeptides with amino acid sequences as shown in SEQ ID NO: 14 and SEQ ID NO: 15, respectively;

[0030] 8) In the amino acid sequence of SEQ ID NO: 14, the amino acid fragment at positions 181-194 is replaced by LEWYLKAIAYVEKR with EEYYLKAIAYVEER or VDYYLKAINYVLEK, thereby obtaining a polypeptide with the amino acid sequence of SEQ ID NO: 16 or SEQ ID NO: 17, respectively;

[0031] 9) In the amino acid sequence shown in SEQ ID NO: 16, the amino acid fragment at positions 201-205 is replaced by EIFSY with YIFSD, thereby obtaining a polypeptide with the amino acid sequence shown in SEQ ID NO: 18;

[0032] 10) In the amino acid sequence of SEQ ID NO: 18, the amino acid residue at position 211 is substituted from Q to K, and the amino acid residue at position 224 is substituted from D to S, thereby obtaining a polypeptide with the amino acid sequence of SEQ ID NO: 19;

[0033] 11) In the amino acid sequence of SEQ ID NO: 19, the amino acid fragment at positions 259-264 is replaced by NKWKDK with NKYKDK or CEDEDA, thereby obtaining a polypeptide with the amino acid sequence of SEQ ID NO: 20 or SEQ ID NO: 21, respectively;

[0034] 12) In the amino acid sequence of SEQ ID NO: 21, the amino acid residue at position 282 is replaced by E with D or Y, thereby obtaining a polypeptide with the amino acid sequence of SEQ ID NO: 22 or SEQ ID NO: 23;

[0035] 13) In the amino acid sequence shown in SEQ ID NO: 22, the amino acid residue at position 286 is substituted from K to D, thereby obtaining a polypeptide with the amino acid sequence shown in SEQ ID NO: 24;

[0036] 14) In the amino acid sequence shown in SEQ ID NO: 24, the amino acid fragment at positions 289-291 is replaced by IQL to LLLEKEEIEE, thereby obtaining the amino acid sequence shown in SEQ ID NO: 25.

[0037] In certain embodiments, the amino acid sequence of the α-1,2-fucosyltransferase polypeptide includes, but is not limited to, an amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NOs: 1-25, and comprises an amino acid substitution mutation that is functionally equivalent to the above schemes 1)-14). In certain embodiments, the substitution mutation comprises a mutation to a charged residue; in certain embodiments, the substitution mutation comprises a mutation to a basic residue. In certain embodiments, the substitution mutation comprises a mutation homologous to the amino acid sequence of the above schemes 1)-14).

[0038] In certain embodiments, the α-1,2-fucosyltransferase polypeptide includes but is not limited to a polypeptide having an amino acid sequence and an amino acid sequence as set forth in any one of SEQ ID NOs: 1 to 25. In certain embodiments, the α-1,2-fucosyltransferase polypeptide includes but is not limited to a polypeptide having an amino acid sequence and an amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to SEQ ID NOs: 1 to 25, as well as a polypeptide comprising an amino acid sequence that is functionally equivalent to the amino acid sequence set forth in SEQ ID NOs: 1 to 25.

[0039] The method for producing the α-1,2-fucosyltransferase polypeptide as described above comprises:

[0040] (1) culturing the transformed host cell under conditions suitable for expressing the polypeptide;

[0041] Preferably, the host cell is a genetically engineered Escherichia coli BL21 (DE3) or a genetically modified yeast cell;

[0042] (2) Recovering the polypeptide.

[0043] In a specific embodiment, the step (1) comprises: firstly introducing a nucleic acid construct or a recombinant expression vector encoding the above-mentioned α-1,2-fucosyltransferase polypeptide into a host cell to construct an engineered host cell expressing the polypeptide; then, culturing the engineered host cell and inducing it to express the polypeptide.

[0044] In a specific embodiment, the step (2) includes the steps of isolating and purifying the polypeptide from the culture.

[0045] Can use methods known in the art, in the nutrient medium that is suitable for producing polypeptide, cultivate host cell.For example, can pass through shake flask culture, or in applicable substratum and under the condition of allowing polypeptide expression and / or separation, carry out small-scale or large-scale fermentation (comprising continuous fermentation, batch fermentation, batch-fed fermentation or solid-state fermentation) in laboratory or industrial fermentor tank and cultivate cell.Cultivation is to use program known in the art, occurs in applicable nutrient medium, and described substratum comprises carbon and nitrogen source and inorganic salt.Suitable substratum can be purchased through commercial channels, or according to disclosed composition preparation.

[0046] In some embodiments, the preferred host cell is Escherichia coli, or other transformable host cells. Further preferably, the host cell is a genetically modified E. coli BL21 (DE3) cell or a genetically modified yeast cell.

[0047] The yeast genetically modified cells in the above-mentioned method for producing α-1,2-fucosyltransferase polypeptides include Saccharomyces sp. cells, and their starting strains include but are not limited to Saccharomyces cerevisiae, Sae. paradoxus, Saccharomyces bayanus, Sae. pastorianus, Saccharomyces cariocas, Saccharomyces mikatae and Saccharomyces kudriavzevii.

[0048] The genetically modified cells include, but are not limited to, polypeptides having an amino acid sequence that is at least 60%, 65%, 70%, 75%, 80%, 85%, 90%, 95%, 99%, or 100% identical to an amino acid sequence such as SEQ ID NOs: 1-25 or to a polypeptide as shown in SEQ ID NOs: 1-25.

[0049] Furthermore, in some embodiments, the genetically modified Saccharomyces cerevisiae cell further comprises, in addition to the heterologous nucleic acids encoding the aforementioned enzymes, one or more heterologous nucleic acids encoding GDP-mannose-4,6-dehydratase (e.g., from, but not limited to, E. coli) or GDP-L-fucose synthase (e.g., from, but not limited to, E. coli). The genetically modified yeast cell is capable of synthesizing 2'-fucosyllactose de novo using lactose and glucose, or glycerol, or sucrose as carbon sources.

[0050] The heterologous GDP-mannose-4,6-dehydratase (gmd) gene is from Escherichia coli. Other suitable sources of GDP-mannose-4,6-dehydratase include, but are not limited to, Caenorhabditis elegans, Homo sapiens, Arabidopsis thaliana, Dictyostelium discoideum, Mus musculus, Drosophila melanogaster, Sinorhizobium fredii, Pandoraea vervacti, Caenorhabditis briggsae, Candidatus Curtiss bacteria, Pseudomonas sp., Clostridium sp., Cricetulus griseus), Arthrobacter iccitolerans or Paraburkholderia piptadeniae, etc.

[0051] The heterologous GDP-L-fucose synthase (wcag) gene is from Escherichia coli. Other suitable sources of GDP-L-fucose synthase include, for example, but are not limited to, Mus musculus, Homo sapiens, Marinobacter salarius, Sinorhizobium fischeri NGR234, Citrobacter rodentium, Pongoabelii, Caenorhabditis elegans, Candidatus Staskawiczbacteria bacterium, Azorhizobium caulinodans, or Candictus Nitrospiranitrificans.

[0052] In some embodiments, the Saccharomyces cerevisiae cell further comprises a heterologous nucleic acid encoding a lactose permease. The lactose permease is a lactose transporter responsible for transferring lactose from the extracellular space to the intracellular space. In some embodiments, the lactose permease source includes but is not limited to Neurospora crassa, Neofusicoccum parvum, Scheffersomyces stipitis, Aspergillus lentulus, Emericella nid ulans, Microdochium bolleyi, Beauveria bassiana, Metarhizium robertsii, Phialocephala, Botryosphaeria parva, Moniliophthora aroreri, Cordyceps fumosorosea, Diplodiaseriata, Hypocrea jecorina, Kluyveromyces lactis, Kluyveromyces marxianus, marxianus), Helicobacter pylori, Magnaporthe oryzae, Phialophora attae, Rhizobium meliloti, Zymomonas mobilis, or Escherichia coli, etc.

[0053] In some embodiments, the genetically modified Saccharomyces cerevisiae cell further comprises a heterologous nucleic acid encoding a transporter polypeptide that exports 2'-fucosyllactose, wherein the heterologous nucleic acid encoding the transporter polypeptide is integrated into the genome of the yeast cell.

[0054] In some embodiments, the sources of the 2'-fucosyllactose exporting transporter polypeptide include but are not limited to Escherichia coli, Kluyveromyces marxianus, Kluyveromyces lactis, Neurospora crassa, etc.

[0055] In some embodiments, a heterologous nucleic acid encoding the 2'-fucosyllactose exporting transporter polypeptide is integrated into the genome of the yeast cell, and / or one or more heterologous nucleic acids each independently encoding at least one enzyme of the 2'-fucosyllactose biosynthetic pathway.

[0056] In some embodiments, the heterologous nucleic acid encoding the 2'-fucosyllactose exporting transporter polypeptide and / or one or more heterologous nucleic acids each independently encoding at least one enzyme of the 2'-fucosyllactose biosynthetic pathway are, for example, encoded episomally by one or more plasmids. For example, the enzyme encoded by the one or more heterologous nucleic acids independently encoding at least one enzyme of the 2'-fucosyllactose biosynthetic pathway may include one or more of GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, α-1,2-fucosyltransferase, lactose permease, and a 2'-fucosyllactose exporting transporter.

[0057] Any gene encoding the above enzymes, or any other enzymes mentioned herein, can be optimized by genetic or protein engineering techniques, such as directed evolution or rational mutagenesis, which are known to those of ordinary skill in the art. This allows those of ordinary skill in the art to optimize enzyme expression and increase activity in yeast.

[0058] In one embodiment, a preferred technical solution is: the starting strain of the genetically modified Saccharomyces cerevisiae cell is Saccharomyces cerevisiae CCTCC NO: M20231127 (Saccharomyces cerevisiae SctgtP8), and the starting strain of Saccharomyces cerevisiae can be easily purchased through commercial channels or culture collection centers.

[0059] The genetically modified Saccharomyces cerevisiae cell has been genetically engineered to contain increased intracellular GDP-L-fucose and 2'-FL production capacity compared to the starting strain. Preferably, the genetically modified cell has been genetically engineered to:

[0060] 1) expressing a gene encoding a bifunctional fucokinase / L-fucose-1-phosphate-guanosyltransferase, which catalyzes the formation of GDP-fucose from L-fucose; or

[0061] 2) Overexpression of at least one of the genes encoding GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, a transporter polypeptide for exporting 2'-fucosyllactose, and lactose permease.

[0062] 3) Expressing a gene encoding an α-1,2-fucosyltransferase polypeptide.

[0063] Optionally, the GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, 2'-fucosyllactose exporting transporter polypeptide, and lactose permease may be genetically modified enzymes or wild-type enzymes.

[0064] The present invention also provides a genetically modified cell containing a molecular marker. The molecularly marked genetically modified cell comprises a nucleotide sequence as shown in SEQ ID NO: 29. The present invention also provides a method for preparing a genetically modified cell, wherein the method uses Saccharomyces cerevisiae CCTCC NO: M20231127 as a starting strain, and integrates a heterologous α-1,2-fucosyltransferase gene, a heterologous GDP-L-fucose synthase gene (wcaG), a heterologous GDP-mannitol-4,6-dehydratase gene (gmd), a heterologous lactose permease (lac12), and a heterologous 2'-fucosyllactose exporting transporter polypeptide (CDT2) into the Saccharomyces cerevisiae genome.

[0065] Preferably, the α-1,2-fucosyltransferase gene includes but is not limited to polypeptides having amino acid sequences as shown in SEQ ID NOs: 1-25.

[0066] Preferably, the genetically modified cells in the preparation method are genetically modified cells of Saccharomyces cerevisiae; further preferably, they are genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127.

[0067] Preferably, the method for preparing the genetically modified Saccharomyces cerevisiae cells specifically comprises the following steps:

[0068] (1) Cultivating Saccharomyces cerevisiae cells;

[0069] Preferably, the Saccharomyces cerevisiae cell is CCTCC NO: M20231127;

[0070] (2) constructing an expression cassette and introducing a heterologous α-1,2-fucosyltransferase gene into Saccharomyces cerevisiae cells;

[0071] (3) constructing an expression cassette and introducing a heterologous GDP-L-fucose synthase gene (wcag) into Saccharomyces cerevisiae cells; and / or

[0072] (4) constructing an expression cassette to introduce the heterologous GDP-mannitol-4,6-dehydratase (gmd) gene into Saccharomyces cerevisiae cells;

[0073] (5) constructing an expression cassette to introduce a 2'-fucosyllactose exporting transporter polypeptide (CDT2) into Saccharomyces cerevisiae cells;

[0074] (6) Construct an expression cassette to introduce heterologous lactose permease into Saccharomyces cerevisiae cells.

[0075] Preferably, the recombinant construction technology of the genetically engineered yeast Saccharomyces cerevisiae also includes:

[0076] (7) Construct a molecular marker expression cassette and introduce the marker gene into Saccharomyces cerevisiae cells.

[0077] Preferably, the method further comprises the step of (8) recovering the genetically engineered Saccharomyces cerevisiae.

[0078] Preferably, in the above method for preparing genetically modified cells of Saccharomyces cerevisiae, the steps are not ordered in any particular order.

[0079] In another aspect, provided herein is a method of genetically modifying a yeast cell to produce one or more HMOs, the method comprising:

[0080] (a)(i) introducing a heterologous nucleic acid encoding a heterologous α-1,2-fucosyltransferase; and / or

[0081] (ii) introducing into the yeast cell one or more heterologous nucleic acids each independently encoding at least one enzyme of the 2'-fucosyllactose biosynthetic pathway; and / or

[0082] (b) introducing a heterologous nucleic acid encoding a lactose permease into the yeast cell; and / or

[0083] (c) introducing a heterologous nucleic acid encoding a 2'-fucosyllactose exporting transporter polypeptide into the yeast cell;

[0084] wherein the yeast cell comprises one or more heterologous nucleic acids each independently encoding at least one enzyme of the 2'-fucosyllactose biosynthetic pathway.

[0085] Preferably, the one or more heterologous nucleic acids encoding at least one enzyme of the 2'-fucosyllactose biosynthetic pathway include a heterologous GDP-L-fucose synthase (wcag), or a GDP-mannitol-4,6-dehydratase (gmd) nucleic acid, or a transporter polypeptide nucleic acid that exports 2'-fucosyllactose (CDT2), or a lactose permease nucleic acid (lac12).

[0086] In some embodiments of the present invention, the use of the genetically modified Saccharomyces cerevisiae cells in synthesizing 2'-fucosyllactose (2'-FL) is described.

[0087] Preferably, the genetically modified Saccharomyces cerevisiae cells are genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127.

[0088] In some embodiments, the carbon source in the culture medium comprises lactose and sucrose, or glycerol, or glucose.

[0089] In some embodiments, the culture medium can be any medium capable of maintaining the growth and viability of the genetically modified cells that produce fucoidan. In some embodiments, the culture medium can also include appropriate salts, minerals, metals, or other nutrients. In some embodiments, a carbon source and nutrients necessary for cell growth are added to the culture medium in an incremental or continuous manner.

[0090] The application of the genetically modified yeast cell for synthesizing 2'-FL uses lactose and sucrose, or glycerol, or glucose as carbon sources.

[0091] In some embodiments, the culture medium does not contain fucose. In some embodiments, the method further comprises adjusting the mass ratio of the carbon source (such as sucrose) to lactose to adjust the yield of 2'-fucosyllactose.

[0092] The fermentation method described herein can be carried out in conventional culture modes, including but not limited to batch, fed-batch, cell recirculation, continuous, and semi-continuous. In some embodiments, fermentation is carried out in fed-batch mode. In this case, some components of the culture medium are depleted during the culture period, for example, during the production phase of the fermentation. In some embodiments, the culture can be supplemented with relatively high concentrations of such components at the beginning of the production phase, for example, to support growth and / or 2'-fucosyllactose production for a period of time before addition is needed. The preferred range of these components can be maintained by addition during the entire culture process as levels are depleted by the culture. The levels of components in the culture medium can be monitored by, for example, regularly sampling the culture medium and determining the concentrations. Alternatively, once a standard culture procedure is developed, additions can be made at specific times throughout the culture process at time intervals corresponding to known levels. As will be appreciated by those of ordinary skill in the art, the rate of nutrient consumption increases during the culture process as the cell density of the culture medium increases. In addition, to avoid introducing foreign microorganisms into the culture medium, aseptic addition methods known in the art can be used for addition. In addition, a small amount of defoaming agent can be added during the culture process.

[0093] This application also provides a method for recovering 2'-fucoylactose from a fermentation composition. In some embodiments, the fermentation product is any of the fermentation compositions disclosed herein and described above. The method comprises separating at least a portion of the yeast cell population from the culture medium. In some embodiments, the separation comprises centrifugation. In some embodiments, the separation comprises filtering, rinsing the separated cells with a wash solution, and then collecting the wash solution.

[0094] The term "heterologous" when used in reference to a polynucleotide, gene, nucleic acid, polypeptide or enzyme refers to a polynucleotide, gene, nucleic acid, polypeptide or enzyme that is from or derived from a source other than the host organism's species.

[0095] The term "host cell" is defined as a cell that has been transformed or transfected, or is capable of being transformed or transfected, with an exogenous polynucleotide sequence, thereby comprising at least one non-naturally occurring sequence in the host cell.

[0096] The term "molecular marker" refers to a specific DNA fragment that can reflect certain differences in the genome between biological individuals or populations.

[0097] Beneficial effects

[0098] The present invention provides a genetically modified cell of Saccharomyces cerevisiae, including but not limited to the nucleotide sequence of the transferase polypeptide represented by the amino acid sequence of SEQ ID NO: 1-25, and its beneficial effects are embodied in:

[0099] (1) Compared with the original strain, the genetically modified Saccharomyces cerevisiae cells produced the activity of synthesizing 2'-FL and had no side activities (such as the side activity of producing DFL).

[0100] (2) Compared with 2'-FL produced by Escherichia coli or Escherichia coli genetically modified cells, 2'-FL products synthesized by recombinant yeast genetically modified cells do not contain endotoxins and other allergens, are safe for consumption, and are more suitable for applications in food, health products, infant food and other fields.

[0101] (3) The process for fermenting and synthesizing 2'-FL by using the genetically modified cells of Saccharomyces cerevisiae of the present invention is simple and easy, thereby improving production efficiency and reducing production costs. BRIEF DESCRIPTION OF THE DRAWINGS

[0102] Figure 1 .Lactose HPLC spectrum.

[0103] Figure 2 .HPLC spectrum of 2'-FL standard.

[0104] Figure 3 .HPLC spectrum of DFL standard.

[0105] Figure 4 .HPLC profile of fermentation broth of Saccharomyces cerevisiae CCTCC NO:M20231127 gene-modified cells SC-M20.

[0106] Figure 5 .Mass spectrometry analysis of 2'-FL standard.

[0107] Figure 6 . Figure 4 The HPLC spectrum shown is an LC-MS analysis spectrum of a substance having an rt of approximately 15.06 min. DETAILED DESCRIPTION

[0108] The experimental methods used in the following examples are conventional methods unless otherwise specified; all materials, reagents, etc., are commercially available unless otherwise specified.

[0109] The present invention is further described in detail below through examples. It should be understood that the specific embodiments described herein are only used to explain the present invention and are not used to limit the present invention. Modifications or replacements to the details and forms of the technical solution without departing from the structural ideas and scope of use of the present invention fall within the scope of protection of the present invention.

[0110] Unless otherwise defined, all technical and scientific terms used in this specification have the same meanings as those commonly understood by those skilled in the art. In general, the nomenclature used in this specification and the experimental methods described below are well known and commonly used in the art.

[0111] It should be understood that the scope of protection of the present invention is not limited to the specific embodiments described below; it should also be understood that the terms used in the examples of the present invention are intended to describe specific embodiments and are not intended to limit the scope of protection of the present invention. In the following embodiments, if no specific experimental conditions are specified, the experimental methods are generally based on conventional molecular biology methods and conditions within the skill of the art, which are fully explained in the literature. See, for example, the techniques and conditions described in Sambrook et al., Molecular Cloning: A Laboratory Manual, or follow the conditions recommended by the manufacturer.

[0112] In the following specific embodiments, if the experimental methods for specific conditions are not specified, they are generally based on conventional methods and conditions of molecular biology within the art, and such techniques and conditions are fully explained in the literature; all materials, reagents, etc., unless otherwise specified, can be obtained from commercial channels.

[0113] The fermentation product of the yeast gene-modified cells of the present invention can be purified by centrifugation, filtration, decolorization, nanofiltration, chromatography purification and crystallization to obtain a reaction solution or solid with high purity; it can also be made into a powder by spray drying or freeze drying technology.

[0114] Explanation of abbreviations in the examples: gmd: GDP-4,6-mannitol dehydratase; wcaG: GDP-L-fucose synthase; futC: α-1,2 fucosyltransferase polypeptide; lac12: lactose permease; CDT2: transporter polypeptide that exports 2'-fucosyllactose.

[0115] Also provided herein is a method for producing fucosyllactose. The method includes providing a genetically modified yeast cell capable of producing fucosyllactose. The yeast cell includes a gene for an α-1,2-fucosyltransferase polypeptide as described herein. In some embodiments, the method further includes providing a culture medium and culturing the yeast cell in the culture medium under conditions suitable for the yeast cell to produce fucosyllactose.

[0116] Cultivation can be carried out in suitable container, includes but not limited to carrying out in suitable culture medium in cell culture plate, blisters or fermentation tank.Any suitable fermentation tank can be used, includes but not limited to stirred fermentor, airlift fermentor, bubble fermentor or its any combination.In utilizing saccharomyces cerevisiae CCTCC NO:M20231127 as the particular embodiment of host cell, bacterial strain can be grown in fermentation tank.In addition, described method can be carried out with the fermentation of any scale known in the art, to support the industrial production of microbial products.Maintain or grow the material and method that is used for cell culture and is known to the technician in microbiology or fermentation field.

[0117] In some embodiments, the culture medium comprises lactose and sucrose, or glucose. In some embodiments, the carbon source in the culture medium consists essentially of lactose and sucrose, or glucose. Preferably, in some embodiments, the carbon source in the culture medium consists of lactose and sucrose.

[0118] In the following examples, the starting strain is Saccharomyces cerevisiae CCTCC NO: M20231127 (Saccharomyces cerevisiae SctgtP8):

[0119] GDP-mannitol-4,6-dehydratase (Gmd) is derived from Escherichia coli, and its nucleotide sequence is shown in SEQ ID NO:27.

[0120] GDP-L-fucose synthase (WcaG) is derived from Escherichia coli, and its nucleotide sequence is shown in SEQ ID NO: 28.

[0121] The amino acid sequences of the α-1,2-fucosyltransferase polypeptide (futC) are shown in SEQ ID NOs: 1-25, respectively.

[0122] The amino acid sequence of the α-1,2-fucosyltransferase polypeptide from Helicobacter pylori is shown in SEQ ID NO: 36, and the nucleotide sequence thereof is shown in SEQ ID NO: 37, and is represented by HPFut-wt.

[0123] The amino acid sequence of the α-1,2-fucosyltransferase polypeptide from Escherichia coli is shown in SEQ ID NO: 38, and the nucleotide sequence thereof is shown in SEQ ID NO: 39, and is represented by ECFut-wt.

[0124] The amino acid sequence of the α-1,2-fucosyltransferase polypeptide from Bacillus cereus is shown in SEQ ID NO: 40, and the nucleotide sequence thereof is shown in SEQ ID NO: 41, and is represented by BCFut-wt.

[0125] The amino acid sequence of the α-1,2-fucosyltransferase polypeptide from Bacteroides fragilis is shown in SEQ ID NO:42, and the nucleotide sequence thereof is shown in SEQ ID NO:43, and is represented by BFFut-wt.

[0126] Lactose permease (lac12) is derived from Kluyveromyces lactis, and its amino acid sequence is shown in SEQ ID NO: 44, and its nucleotide sequence is shown in SEQ ID NO: 45.

[0127] The 2'-fucosyllactose exporting transporter polypeptide (CDT2) is derived from Neurospora crassa, and its amino acid sequence is shown in SEQ ID NO: 46, and its nucleotide sequence is shown in SEQ ID NO: 47.

[0128] Those skilled in the art will recognize that due to the degenerate nature of the genetic code, a variety of DNA molecules with different nucleotide sequences can be used to encode a given heterologous polypeptide of the present application. The native DNA sequences encoding the above-mentioned biosynthetic enzymes are herein and solely for the purpose of illustrating embodiments of the present disclosure, and the present disclosure includes DNA molecules of any sequence encoding the amino acid sequences of the polypeptides and proteins of the enzymes used in the methods of the present disclosure. In a similar manner, polypeptides can generally tolerate one or more amino acid substitutions, deletions, and insertions in their amino acid sequences without loss or significant loss of the desired activity. The present disclosure includes such polypeptides having amino acid sequences that differ from the specific proteins described herein, as long as the modified or variant polypeptides have the enzymatic anabolic or catabolic activity of the reference polypeptide. In addition, the amino acid sequences encoded by the DNA sequences shown herein are merely illustrative of embodiments of the present disclosure.

[0129] Example 1. Expression of polypeptides shown in SEQ ID NOs: 1-25 in Escherichia coli.

[0130] 1. Using the amino acid sequence of the polypeptide shown in SEQ ID NO: 1 (nucleotide sequence shown in SEQ ID NO: 26) as a template, the polypeptide shown in SEQ ID NO: 1 was synthesized and finally constructed into the PET32a vector to obtain the PET32a-wt plasmid. Yeast codon-optimized synthesis was performed based on the amino acid sequences HPFut-wt, ECFut-wt, BCFut-wt, and BFFut-wt, respectively, and finally constructed into the PET32a vector and named PET32a-HPFut-wt, PET32a-ECFut-wt, PET32a-BCFut-wt, and PET32a-BFFut-wt, respectively.

[0131] 2. Different mutation sites were obtained by computer-assisted rational design. According to the method of the Molecular Cloning Experiment Guide, the nucleotide sequence of PET32a-wt (SEQ ID NO: 26) was used to perform Primer-BLAST ( Primer designing tool (nih.gov) ) mutant primers were designed and a recombinant plasmid series (pET32a-M1-M25) was constructed using a point mutagenesis kit (Fast Mutagenesis Kit).

[0132] 3. Transform the above recombinant plasmids into Escherichia coli BL21 (DE3) according to the following steps:

[0133] Take the prepared Escherichia coli BL21 (DE3) competent cells, place them on ice for 30 minutes to thaw, take 100 μL of competent cells and 10 μL of pET32a-M1-M25 recombinant plasmid (concentration 50 ng / μL), respectively, mix them, place them in a 42°C water bath for 45 seconds, then immediately cool them in an ice bath for 2 minutes, add 1 mL of fresh LB medium (LB medium: 1.0% peptone, 0.5% yeast extract, 1.0% NaCl, and 1.5% agar powder on the plate), and resuscitate and culture at 37°C and 100 rpm for 1 hour. Then, take 100 μL of the bacterial solution and spread it on an LB plate containing ampicillin (100 μg / mL). After culturing in a 37°C constant temperature incubator for 12 hours, pick a single colony for colony PCR to screen for positive transformants.

[0134] 4. Culture the positive transformants, extract their plasmids, and use double enzyme digestion and gene sequencing to verify whether the pET32a-M1-M25 recombinant plasmid has been successfully introduced into E. coli.

[0135] 5. The correct transformants were inoculated into LB liquid medium and cultured on a shaker at 37°C at 200 rpm for 12 h to obtain seed liquid. The seed liquid was then inoculated into fresh LB medium at a 1% (v / v) inoculum and cultured at 37°C with shaking to an OD600 of 0.8. The cells were then induced with isopropyl-β-D-thiogalactopyranoside (IPTG) at a final concentration of 0.1 mmol / L and incubated at 16°C at 200 rpm for 12 h. After induction, the fermentation broth was centrifuged at 5000 rpm for 30 min at 4°C to collect the cells. The cells were resuspended in 20 mM PBS buffer, pH 7.4, and disrupted by sonication at a rate of plus on 5s / off 5s for 30 min. The disrupted liquid was centrifuged at 13,000 × g at 4°C for 30 min to remove cell debris, and the supernatant was collected.

[0136] 6. The soluble polypeptide sequence was purified using nickel column affinity chromatography. The process was as follows: deionized water was added to the top of the nickel column. After natural elution, it was eluted with 5 volumes of Binding buffer. The crude enzyme solution filtered through a 0.45 μm filter membrane was then loaded onto the column. The sample was fully bound to the nickel column at a flow rate of 1.5 mL / min. After the sample was dried, it was continuously eluted with 5 column volumes of Washing buffer to remove impurities. Finally, the target protein was eluted with 5 times the volume of Elution buffer and the eluate was collected. Then, the expression of the target protein was analyzed by SDS-PAGE.

[0137] The SDS-PAGE results showed that the genetically engineered bacteria had obvious specific expression bands after induction, and the molecular weight of the bands was basically consistent with the expected molecular weight of 35.3 kDa. Therefore, it can be seen that the polypeptides shown in SEQ ID NO: 1-25 were obtained. For detailed information, please see Table 1.

[0138] Table 1. Corresponding relationship between transferase polypeptides and their amino acid sequence numbers

[0139]

[0140]

[0141] Example 2. Construction of genetically modified Saccharomyces cerevisiae cells.

[0142] (1) Construction of SC-ΔARO3::GMD-WCAG expression cassette

[0143] The upstream and downstream homology arm sequences aro3-up and aro3-do, the promoter sequence TDH3p and the terminator sequence PGK1t, the promoter sequence TFF1p and the terminator sequence GPMt were amplified using the Saccharomyces cerevisiae genome as a template; the GMD target gene sequence was amplified using the synthetic gmd sequence as a template; the wcaG target gene sequence was amplified using the synthetic wcaG as a template; referring to the applicant's prior patent: 202211453172.5, the invention name: Recombinant yeast and its application, The KL-ΔLAC4 knockout cassette was used as a template to amplify the G418+loxp sequence. Aro3-up, TDH3p, GMD, PGK1t, TEF1p, WCAG, ADH1t, G418+loxp and aro3-do were fused by successive fusion PCR of two fragments. Finally, primers ARO3-F and ARO3-R were used as primers and the fusion PCR system was used as a template to obtain the GMD+WCAG expression cassette SC-ΔARO3::GMD-WCAG by PCR amplification.

[0144] Table 2. Plasmids and primers

[0145]

[0146] (2) Construction of SC-ΔTRP3::CDT2-LAC12 expression cassette

[0147] Using the Saccharomyces cerevisiae genome as a template, the upstream and downstream homology arm sequences trp3-up and trp3-do of the TRP3 coding region, the promoter sequence TFF1p and the terminator sequence CYC1t, the terminator sequence GPMt and the promoter sequence TPILp were amplified respectively; using the synthesized CDT2 sequence as a template, the CDT2 target gene sequence was amplified; using the Kluyveromyces lactis genome as a template, the lac12 gene was amplified; using SC-ΔARO3::GMD-WCAG as a template, the G418+loxp sequence was amplified, and trp3-up, TFF1p, CDT2, CYC1t, GPMt, lac12, TPILp, G418+loxp and trp3-do were fused by successive fusion PCR of two fragments. Finally, using primers TRP3-F and TRP3-R as primers and the fusion PCR system as a template, the expression cassette SC-ΔTRP3::CDT2-LAC12 was amplified by PCR.

[0148] Table 3. Plasmids and primers

[0149] plasmids Primers Primer sequence number TRP3-F CAATCACATGAATACAAGATCATAG SEQ ID NO:32 TRP3-R TTCCCGATAGAGCAATTAGAAGAA SEQ ID NO:33

[0150] (3) Construction of expression cassettes of SC-ΔGK::BSfutC-wt, SC-ΔGK::BSfutC-M1 to SC-ΔGK::BSfutC-M24, SC-ΔGK::HPFut-wt, SC-ΔGK::ECFut-wt, SC-ΔGK::BCFut-wt, and SC-ΔGK::BFFut-wt.

[0151] Using Saccharomyces cerevisiae genomic DNA as a template, PCR amplification was performed to obtain the upstream and downstream homology arms gk-up and gk-down, the promoter sequence CUP1p and the terminator sequence GPMt; using the SC-ΔTRP3::CDT2-LAC12 expression cassette as a template, a resistance screening marker containing G418 resistance and loxp sites was amplified; using PET32a-WT, PET32a-M1 to PET32a-M24, PET32a-HPFut-wt, PET32a-ECFut-wt, PET32a-BCFut-wt, and PET32a-BFFut-wt as templates, PCR amplification was performed to obtain BSFut-wt and mutant sequences, as well as HPFut-wt, ECFut-wt, BCFut-wt and BFFut-wt gene sequences; The two fragments were fused PCR successively to fuse gk-up, CUP1p, BSFut-wt and mutant sequence / HPFut-wt / ECFut-wt / BCFut-wt / BFFut-wt gene sequences, GPMt, G418+loxp and gk-do. Finally, primers GK-F and GK-R were used as primers, and the fusion PCR system was used as a template to amplify the expression cassettes SC-ΔGK::BSfutC-wt, SC-ΔGK::BSfutC-M1 to SC-ΔGK::BSfutC-M24, SC-ΔGK::HPFut-wt, SC-ΔGK::ECFut-wt, SC-ΔGK::BCFut-wt, SC-ΔGK::BFFut-wt for the next step of constructing the recombinant strain.

[0152] Primers for constructing expression cassettes for SC-ΔGK::BSfutC-wt, SC-ΔGK::BSfutC-M1 to SC-ΔGK::BSfutC-M24, SC-ΔGK::HPFut-wt, SC-ΔGK::ECFut-wt, SC-ΔGK::BCFut-wt, and SC-ΔGK::BFFut-wt.

[0153] Table 4. Plasmids and primers

[0154] plasmids Primers Primer sequence number GK-F CGGTCACACAAATCAACCTCAT SEQ ID NO:34 GK-R AAGTTGGCGAGAGTTCAATCT SEQ ID NO:35

[0155] (2) Transformation of the recombinant expression cassette and verification of the recombinant strain.

[0156] The expression cassettes constructed in (1) above were respectively transferred into the starting strain Saccharomyces cerevisiae CCTCC NO: M20231127 cells.

[0157] The specific method is:

[0158] 1) Prepare competent yeast cells: Take a small amount of frozen yeast strain and streak it on a solid culture medium plate, invert and culture at 30℃ for 2 days. Pick a single yeast colony in 50mL liquid culture medium and culture at 30℃, 220rpm until OD 600 The nitric oxide concentration (DNA saturation) should be between 0.8 and 1.5. Collect the cells, wash with 25 mL of sterile water, centrifuge at 1500 × g for 10 min at room temperature, and discard the supernatant. Add 1 mL of 100 mM lithium chloride buffer, resuspend the pellet, centrifuge at 12,000 rpm for 30 s, and discard the supernatant. Add 400 μL of 100 mM lithium chloride buffer again, resuspend the pellet, and obtain competent yeast cells. Aliquot 50 μL / tube for transformation.

[0159] Meanwhile, boil 1 mL of salmon sperm DNA for 5 min and quickly place on ice to prepare single-stranded DNA.

[0160] 2) Transformation: Centrifuge the competent yeast prepared above and remove any residual lithium chloride solution with a tip. For each transformation, add the following solution in the following order: 50% PEG3350 (240 μL); 1 M LiCl (36 μL); 2 mg / mL single-stranded Salmon sperm DNA (25 μL); and 50 μL of 5-10 μg / 50 μL plasmid DNA in water. Vortex vigorously until the precipitated yeast cells are completely distributed. Incubate in a 30°C waterbath for 30 min. Heat shock the cells in a 42°C waterbath for 20-25 min. Centrifuge at 8000 rpm for 10 min and harvest the yeast cells. Resuspend the yeast in 500 μL of liquid culture medium and incubate on a shaker at 30°C. After 1-4 h, spread 25-100 μL of the culture medium onto selective culture plates and incubate them upside down at 30°C.

[0161] 3) Verification: The correspondence between the recombinant strains and their genotypes is shown in Table 5. To verify the correctness of the above strains, we extracted the genomes of the transformants and the original strains and performed PCR amplification using primers corresponding to the knockout or expression cassette. If a single band was obtained after PCR amplification and the size was consistent with the knockout or expression cassette, the strain was considered correct; otherwise, the strain was considered a false positive.

[0162] Table 5. Saccharomyces cerevisiae engineered strains and their genotypes (α-1,2-fucosyltransferase gene)

[0163]

[0164]

[0165] Example 3. Construction of genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127 carrying a marker gene and identification of the marker gene.

[0166] (1) The artificial amino acid sequence containing the encryption tag was sent for synthesis (Shanghai Sangon Biotechnology Co., Ltd.), and the artificial sequence containing the encryption tag was randomly inserted into the genome of Saccharomyces cerevisiae CCTCCNO: M20231127 in the same manner as in Example 2.

[0167] The artificial amino acid sequence containing the encrypted tag is as follows:

[0168] The correspondence between the tagged recombinant strains and their genotypes is shown in Table 6.

[0169] Table 6

[0170]

[0171]

[0172] (3) Verification.

[0173] To verify the correctness of the above strains, we extracted the genomes of the transformants and the original strain and performed PCR amplification using primers corresponding to the knockout or expression cassette. If a single band with the same size as the knockout or expression cassette was obtained after PCR amplification, the strain was considered correct; otherwise, the strain was considered a false positive. For tag verification, PCR amplification using primers was performed and further verified by sequencing; otherwise, the strain was considered a false positive.

[0174] Example 4. Fermentation synthesis of 2'-FL by genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127

[0175] Yeast was cultured with glucose as the carbon source. The genetically modified cells obtained in Examples 2-3 were taken respectively, and the genetically modified cells of Saccharomyces cerevisiae were grown rapidly until the growth entered the late logarithmic phase or the stable phase. The strains were streaked and cultured in solid culture media such as YDP, and after culturing at 30°C for 2-3 days, single colonies were picked and inoculated into 1.5mL YPD liquid culture medium, and cultured at 30°C and 200rpm overnight. Subsequently, the strains were inoculated into 50mL liquid culture medium shake flasks at a 2% inoculation rate, and cultured at 30°C and 200rpm until the OD 600 = 1, lactose, 3% (w / v) sucrose, and 0.1 mM CuSO4 were added to a final concentration of 10 g / L, and the culture was shaken at 30°C and 200 rpm for a total fermentation time of 72 h. After 72 h of fermentation, samples were taken and boiled for 10 minutes. The final yeast fermentation product was obtained by centrifugation, and the 2'-FL content in the supernatant was measured.

[0176] HPLC detection method: Detection conditions: chromatographic column model: Shodex Asahipak NH2P-50 4E, mobile phase: 65% acetonitrile in water, flow rate: 0.5 ml / min, column temperature: 35°C, injection volume: 10 μL, evaporative light detector, evaporation temperature 75°C, and nebulization temperature 45°C.

[0177] LC-MS analysis conditions are as follows:

[0178] Chromatographic column model: Shodex Asahipak NH2P-50 4E, detector: UV detector (Hitachi Chromaster), detection wavelength: 210 nm, injection volume: 10 μL, flow rate: 0.5 mL / min, column temperature: 35°C, mobile phase: acetonitrile:water = 65:35; ESI-MS mode, molecular weight scan range: 100-800.

[0179] The standard product and the reaction solution were tested according to the above analytical method. The HPLC analysis results showed:

[0180] (1) The peak time rt of 2'-FL standard is 15.06min( Figure 2 ); HPLC analysis of DFL standard ( Figure 3 )rt is 17.7min.

[0181] (2) The fermentation broths of the genetically modified cells SC-M1 to SC-M24, SC-M1-1 to SC-M24-1, etc. obtained in Example 2-3 all showed a strong absorption peak around 15.06 min (see Appendix Figure 4 ), which is consistent with the peak time of the 2'-FL standard, indicating that 2'-FL was produced in the fermentation broth of the genetically modified cells obtained in Example 2-3.

[0182] (3) The fermentation broth of the genetically modified cells obtained in Example 2-3 had no absorption peak near 17.7 min, indicating that no DFL was generated in the fermentation broth of the genetically modified cells obtained in Example 2-3.

[0183] (4) No 2'-FL and DFL were produced in the fermentation broth of the starting strain.

[0184] The LC-MS analysis conditions are shown above, and the analysis results show:

[0185] The product of the reaction solution HPLC chromatogram peak near rt = 15.06min was analyzed by LC-MS, and its spectrum is shown in the attached Figure 6 The MH value of the fermentation broth was 487.17, which was consistent with the Figure 5 The mass spectrum of the 2'-FL standard is consistent with the theoretical molecular weight of 2'-FL, which is 488.44, and is within the allowable error range. This proves that the fermentation process of the genetically modified cells obtained in Example 2-3 successfully synthesized 2'-FL, and there was no byproduct DFL in the product.

[0186] The yields of 2'-FL and DFL in the fermentation broth were detected by the above-mentioned HPLC analysis method, and the results are recorded in Tables 7-8.

[0187] Table 7. Study on 2'-FL synthesis by genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127 obtained in Example 2

[0188]

[0189]

[0190] Table 8. Study on 2'-FL synthesis by genetically modified cells of Saccharomyces cerevisiae CCTCC NO: M20231127 obtained in Example 3

[0191]

[0192]

[0193] Table 7-8 Data Description:

[0194] (1) The starting strain of Saccharomyces cerevisiae and the genetically modified cells SC-1 and SC-2 were unable to synthesize 2'-FL; however, SC-3-1 was able to produce 2'-FL. This indicated that Saccharomyces cerevisiae cells themselves did not have the ability to synthesize 2'-FL, and even after the introduction of Gmd (GDP-mannose-4,6-dehydratase) and WcaG (GDP-L-fucose synthase), 2'-FL synthesis could not be achieved. The introduction of BSFut-wt successfully detected the production of 2'-FL, thus proving that BSFut-wt had α-1,2 fucosyltransferase activity, but the activity was low.

[0195] (2) The genetically modified Saccharomyces cerevisiae cells of the present invention have the activity of synthesizing 2'-FL, and no DFL is detected in the fermentation broth.

[0196] Example 5. Saccharomyces cerevisiae SC-M24, SC-M1-1, SC-M24-1, and SC-6-1 were streaked onto solid media such as YDP. After culturing at 30°C for 2-3 days, single colonies were picked and inoculated into 1.5 mL YPD liquid medium and cultured overnight at 30°C and 200 rpm. Subsequently, 2% of the inoculum was inoculated into 50 mL liquid medium shake flasks and cultured at 30°C and 200 rpm until the OD 600 =1, and were inoculated at a 2% inoculum into 1 L of YPD medium (10 g / L yeast extract, 20 g / L peptone, and 20 g / L glucose) (3 L fermentor). After 6-7 h of culture, CuSO4 was added to control the final Cu ion concentration to approximately 0.1 mM. Sucrose (50% mother liquor concentration) was then added at a rate of 8 mL / h. Lactose (40% mother liquor concentration) was also added to maintain a final lactose concentration of 15 g / L. The total fermentation time was 72 h. After 72 h of fermentation, the fermentation broth was centrifuged, and the supernatant and precipitate were collected separately. The precipitate was disrupted using a high-pressure homogenizer, boiled, and centrifuged to remove protein. The supernatants were combined to obtain the final yeast fermentation product. The 2'-FL and DFL contents in the supernatants were measured, and the results are recorded in Table 9.

[0197] Table 9

[0198] Genetically modified cells 2'-FL yield, g / L DFL yield, g / L SC-M1-1 20.6 Not detected SC-M24-1 35.2 Not detected SC-6-1 15.8 Not detected SC-M24 34.7 Not detected

[0199] Although the present invention has been described in considerable detail by way of illustration and example for purposes of clarity of understanding, it will be apparent to those skilled in the art that any equivalent aspects or modifications may be implemented. Therefore, the present description and examples should not be construed as limiting the scope of the invention.

Claims

1. A genetically modified cell, characterized in that The invention also comprises a heterologous nucleic acid sequence encoding an α-1,2-fucosyltransferase polypeptide, wherein the α-1,2-fucosyltransferase polypeptide is selected from the amino acid sequence of SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23 or SEQ ID NO:

24. One of the polypeptides shown in NO:24, the genetically modified cell is selected from a genetically modified cell of Saccharomyces cerevisiae, and the genetically modified cell further comprises one or more heterologous nucleic acids encoding GDP-mannose-4,6-dehydratase, GDP-L-fucose synthase, lactose permease and a transporter for exporting 2'-fucosyllactose.

2. The genetically modified cell according to claim 1, wherein It also includes a molecular marker gene, the nucleotide sequence of which is shown in SEQ ID NO:

29.

3. The method for preparing genetically modified cells according to claim 1, wherein: The steps include: (1) Cultivate the starting strain; (2) constructing an expression cassette and introducing an α-1,2-fucosyltransferase gene into the starting strain, wherein the α-1,2-fucosyltransferase polypeptide is selected from the group consisting of the polypeptides having an amino acid sequence as shown in SEQ ID NO:4, SEQ ID NO:5, SEQ ID NO:6, SEQ ID NO:7, SEQ ID NO:8, SEQ ID NO:9, SEQ ID NO:10, SEQ ID NO:11, SEQ ID NO:12, SEQ ID NO:13, SEQ ID NO:14, SEQ ID NO:15, SEQ ID NO:16, SEQ ID NO:17, SEQ ID NO:18, SEQ ID NO:19, SEQ ID NO:20, SEQ ID NO:21, SEQ ID NO:22, SEQ ID NO:23, or SEQ ID NO:24; (3) Construct an expression cassette and introduce the heterologous GDP-L-fucose synthase gene into the starting strain; (4) Constructing an expression cassette and introducing the heterologous GDP-mannitol 4,6 dehydratase gene into the starting strain; (5) Constructing an expression cassette to introduce a 2'-fucosyllactose transporter polypeptide into the starting strain; (6) Construct an expression cassette and introduce lactose permease into the starting strain. As described above, the steps of the method for preparing genetically modified cells of Saccharomyces cerevisiae are not prioritized.

4. The method for preparing genetically modified cells according to claim 3, wherein: Also includes: (7) Construct a molecular marker expression cassette and introduce the marker gene into the starting strain.

5. The method for preparing genetically modified cells according to claim 4, wherein: Also includes: (8) A step of recovering the genetically modified cells.

6. Use of the genetically modified cell according to any one of claims 1 to 2 in synthesizing 2'-fucoylactose.

7. The use according to claim 6, characterized in that The carbon source in the culture medium comprises lactose and one of sucrose, glycerol or glucose.

8. The use according to claim 6, characterized in that The culture medium may also contain metal salts, minerals or other nutrients.

9. The use according to claim 6, characterized in that The culture medium does not contain fucose.

Images