Method for preventing and treating citrus canker pathogen by using antibacterial peptide
By fusing the antibacterial peptides into exocrine signal peptides and using CLBV virus infectious cloning as a biological expression vector of antibacterial peptides, the prevention and treatment problems of citrus Huanglong disease and ulcer disease are solved, and the long-term existence and efficient prevention of antibacterial peptides in citrus tissues are achieved.
Patent Information
- Application Number
- CN202411653870.9
- Authority / Receiving Office
- CN · China
- Patent Type
- Applications(China)
- Current Assignee / Owner
- Filing Date
- 2024-11-19
- Publication Date
- 2025-03-14
AI Technical Summary
The existing technology is difficult to effectively prevent and treat citrus Huanglong disease and ulcer disease, and the screening system for citrus bacteria prevention and control drugs is imperfect, resulting in unstable drug effects.
Antibacterial peptides are used as a prevention and treatment method, and the antibacterial peptide is fused to the exocrine signal peptide, and cloned CLBV viruses into biological expression vectors for antibacterial peptides to achieve overexpression of antibacterial peptides and systematic infection of citrus.
It effectively overcomes the impact of conventional transgenic methods on the physiological phenotype of citrus, reduces the potential toxicity of antimicrobial peptides on citrus cells, realizes the long-term existence of antimicrobial peptides in citrus tissues and multiple inoculation analysis, and improves the rigor of the prevention and efficacy evaluation results.
Smart Images
Figure CN119614610A_ABST
Abstract
Description
Technical Field
[0001] The invention belongs to the field of biotechnology, and in particular relates to a method for preventing and controlling citrus canker pathogens by utilizing antimicrobial peptides. Background Art
[0002] Citrus is the world's largest fruit category, with a global citrus planting area of over 9 million hectares and an annual output of over
[0003] 140 million tons. Citrus Huanglongbing and ulcer are the most serious bacterial diseases currently faced by citrus production. They can harm different parts of citrus tissues, resulting in a significant reduction in citrus quality and yield, and causing huge economic losses. The above two diseases are distributed worldwide and are difficult to control when they break out. As a result, many high-quality citrus germplasms in my country have been eliminated due to these diseases, which is an important problem facing the citrus industry. It is worth mentioning that there are currently no effective agents for the prevention and control of citrus Huanglongbing on the market. An important reason for the above problems is that the existing screening system for drugs for the prevention and control of citrus pathogens is still imperfect. For example, citrus Huanglongbing bacteria are phloem-limited living nutritional pathogens, which are difficult to culture in vitro, and conventional spraying methods make it difficult for drugs to effectively act on the phloem, resulting in conventional in vitro drug screening methods that are not suitable for this pathogen and the results of conventional spraying drug screening are unstable; citrus canker is due to its rapid onset and is difficult to control in the later stages of the disease, so inoculation experiments are rarely carried out outdoors.
[0004] Therefore, it is urgent to establish a new and efficient antibacterial drug screening system to provide technical support for the scientific prevention and control of such diseases. Summary of the invention
[0005] Based on the above technical problems, the present invention provides a method for preventing and controlling citrus canker bacteria using antimicrobial peptides, which solves at least one technical problem raised by the background technology. The specific scheme of the present invention is as follows:
[0006] On the one hand, a method for controlling citrus canker bacteria using an antimicrobial peptide is provided, wherein the antimicrobial peptide is fused with an exocrine signal peptide.
[0007] Preferably, the antimicrobial peptide is fused to the N-terminus with a Pr1a signal peptide.
[0008] Preferably, the antimicrobial peptide is Paneth cell-specific α-defensin 1 or Acipensin 2.
[0009] Preferably, CLBV is selected as the antimicrobial peptide expression vector, the antimicrobial peptide encoding gene is cloned into the CLBV specific site, and CLBV is inoculated into citrus branches by the Agrobacterium rhizogenes infiltration method; the citrus branches are cut into vermiculite and cultured for 5-8 months to obtain complete plants and CLBV is systemically infected.
[0010] On the other hand, a method for preventing and controlling citrus canker bacteria using antimicrobial peptides is provided, the method comprising the following steps:
[0011] Construction of CLBV vector for overexpression of antimicrobial peptides: CLBV was selected as the antimicrobial peptide expression vector, and the antimicrobial peptide encoding gene was cloned into the specific site of CLBV;
[0012] CLBV inoculation: CLBV was inoculated into citrus branches by the Agrobacterium rhizogenes infiltration method; the citrus branches were cut into vermiculite and cultured for 5-8 months to obtain complete plants, and CLBV was systemically infected.
[0013] Preferably, the antimicrobial peptide overexpression CLBV vector is constructed as follows:
[0014] The antimicrobial peptide coding sequence was synthesized and constructed into the BamHI restriction site of the CLBV vector. After the constructed vector was sequenced and confirmed to be correct, it was transformed into K599 Agrobacterium rhizogenes by electroporation.
[0015] Preferably, the concentration of the Agrobacterium solution used in the Agrobacterium infiltration method is OD600=0.8-1.0, and the solution needs to be left standing at room temperature in the dark for 3-6 hours before infiltration, and the vacuum treatment time is 30 minutes.
[0016] Preferably, the culture conditions for citrus branch cuttings are: the vermiculite has a diameter of 2-3 mm and is sterilized with high-pressure steam before use, and is cultured at 26°C, 16 h of light and 8 h of darkness for 2-6 weeks until the branches take root, and the rooted complete plants are moved to a climate chamber or outdoors for culture.
[0017] Preferably, the antimicrobial peptide is Paneth cell-specific α-defensin 1 or Acipensin 2.
[0018] The beneficial effects of the present invention are:
[0019] The embodiment of the present invention provides a method for preventing and controlling citrus canker pathogen using antimicrobial peptides. By using the CLBV infectious clone that does not affect the physiological state of citrus as a biological expression vector of the antimicrobial peptide, the influence of conventional transgenic methods on the physiological phenotype of citrus can be effectively overcome; by fusing the antimicrobial peptide with an exocrine signal peptide, the expressed antimicrobial peptide is secreted outside the cell, which can reduce the potential toxicity of the antimicrobial peptide to citrus cells; by utilizing the characteristics that CLBV can systemically infect citrus and exist stably for a long time, multiple inoculation analyses of the treatment group can be achieved, thereby ensuring the rigor of the antimicrobial peptide prevention efficacy evaluation results. BRIEF DESCRIPTION OF THE DRAWINGS
[0020] Figure 1 This is a detailed flow chart of the screening method for antimicrobial peptides for the prevention and control of citrus pathogens mediated by CLBV;
[0021] Figure 2Comparative analysis of leaf phenotypes of control citrus and CLBV-infected citrus;
[0022] Figure 3 It is a schematic diagram of the structure of the infectious clone of CLBV virus;
[0023] Figure 4 Schematic diagram of the strategy for constructing the Pr1a signal peptide and target protein;
[0024] Figure 5 To verify the efficiency of Pr1a-mediated target protein exocytosis;
[0025] Figure 6 For the three-dimensional structural analysis of antimicrobial peptides;
[0026] Figure 7 Signal peptide splicing prediction for Pr1a signal peptide-antimicrobial peptide fusion protein;
[0027] Figure 8 Strategies for constructing CLBV vectors for overexpression of antimicrobial peptides;
[0028] Fig. 9 To detect the content of antimicrobial peptides in leaves of citrus system inoculated with overexpressed CLBV;
[0029] Fig.10 Sequencing results of antimicrobial peptide overexpressing CLBV in inoculated citrus leaves;
[0030] Fig.11 Comparative analysis of leaf phenotypes of citrus in the control group and citrus infected with antimicrobial peptide-overexpressing CLBV;
[0031] Fig.12 For the activation culture of citrus canker bacteria;
[0032] Fig.13 The inoculation method for citrus canker bacteria;
[0033] Fig.14 To analyze the inhibitory efficiency of antimicrobial peptides against citrus canker bacteria;
[0034] Fig.15 To detect the source of Huanglongbing bacteria inoculation;
[0035] Fig.16 The inoculation method of Huanglongbing bacteria;
[0036] Fig.17 Detection of CLas content in citrus system leaves inoculated with Huanglongbing bacteria;
[0037] Fig.18 To analyze the inhibitory efficiency of antimicrobial peptides against citrus Huanglongbing disease. DETAILED DESCRIPTION
[0038] The technical solution of the present invention is described in detail below through specific embodiments. It is clearly stated here that these embodiments are only used for illustration and are not to be construed as limiting the scope of the present invention.
[0039] Antimicrobial peptides are a class of small molecule polypeptides (2-7kDa) with a length of about 10 to 60 amino acids that are widely found in insects, animals, plants and microorganisms, and are an important part of biological innate immunity. Antimicrobial peptides have high thermal stability (100°C, 15min) and strong alkali resistance (8.9-10.7), and have a wide range of inhibitory effects on fungi, bacteria, viruses, tumor cells and parasites. Many antimicrobial peptides have a strong inhibitory effect on plant pathogenic bacteria and are chemically stable. Antimicrobial peptides are a class of small molecule polypeptides (2-7kDa) with a length of about 10 to 60 amino acids that are widely found in insects, animals, plants and microorganisms, and are an important part of biological innate immunity. Antimicrobial peptides have high thermal stability (100°C, 15min) and strong alkali resistance (8.9-10.7), and have a wide range of inhibitory effects on fungi, bacteria, viruses, tumor cells and parasites. Many antimicrobial peptides have a strong inhibitory effect on plant pathogenic bacteria and are chemically stable. In view of the increasingly serious problems of pesticide residues in food and environmental pollution, antimicrobial peptides, as environmentally friendly substances with good protective effects against plant pathogens, are increasingly attracting the attention of plant pathology researchers. However, the production cost of antimicrobial peptides is extremely high, and it is difficult to carry out batch screening of antimicrobial peptides for the prevention and control of citrus pathogens through exogenous application methods. In addition, although transgenic citrus materials that overexpress antimicrobial peptides can be obtained, this method is complex and relies on tissue culture. Not only is the cost high, but it is also difficult to graft and inoculate transgenic citrus with Huanglongbing bacteria within 1 year.
[0040] In view of the defects of high cost and low throughput in the current screening methods for antimicrobial peptides for the prevention and control of citrus pathogens, it is necessary to improve the screening methods for antimicrobial peptides and invent a drug screening method that meets the characteristics of high efficiency, accuracy, low cost, easy operation, and repeatable verification. This technology can solve the problem of high cost of synthesizing antimicrobial peptides and realize batch screening of antimicrobial peptides; it can overcome the problem of complex operation of citrus genetic transformation methods, and can also solve the problem of large error fluctuations in traditional citrus canker pathogen content detection methods. At the same time, it can also ensure the long-term existence of antimicrobial peptides in citrus tissues, which is conducive to the conduct of multiple independent inoculation and repeated experiments, improve the accuracy of antimicrobial peptide prevention effect evaluation results, and provide technical support for the screening of antibacterial drugs for citrus pathogens.
[0041] The embodiment of the present invention provides a method for preventing and controlling citrus canker pathogen using antimicrobial peptides. By using the CLBV infectious clone that does not affect the physiological state of citrus as a biological expression vector of the antimicrobial peptide, the influence of conventional transgenic methods on the physiological phenotype of citrus can be effectively overcome; by fusing the antimicrobial peptide with an exocrine signal peptide, the expressed antimicrobial peptide is secreted outside the cell, which can reduce the potential toxicity of the antimicrobial peptide to citrus cells; by utilizing the characteristics that CLBV can systemically infect citrus and exist stably for a long time, multiple inoculation analyses of the treatment group can be achieved, thereby ensuring the rigor of the antimicrobial peptide prevention efficacy evaluation results.
[0042] Specifically: CLBV is selected as the antimicrobial peptide expression vector, the antimicrobial peptide encoding gene is cloned into the specific site of CLBV, and CLBV is inoculated into citrus branches through the root-generating Agrobacterium infiltration method; the citrus branches are cut into vermiculite and cultured for 5-8 months to obtain complete plants and CLBV is systemically infected.
[0043] The CLBV is a virus-infectious clone that can be used to express foreign genes and is modified from the Citrus Leaf Blotch Virus that cannot cause symptoms in most citrus species.
[0044] Specifically, the N-terminus of the antimicrobial peptide is fused with a Pr1a signal peptide; and Pr1a can induce the target protein connected thereto to be secreted outside the cell.
[0045] Specifically, the CLBV inoculation method is to complete the CLBV inoculation using K599 Agrobacterium infiltration solution through vacuum infiltration method.
[0046] Specifically, the concentration of the Agrobacterium bacterial solution used for infiltration is OD600=0.8-1.0, and the solution needs to be left standing at room temperature in the dark for 3-6 hours before infiltration, and the vacuum treatment time is 30 minutes.
[0047] Specifically, the cutting branch culture conditions are: the vermiculite has a diameter of 2-3 mm and is sterilized with high-pressure steam (121° C., 20 min) before use, and is cultured at 26° C., 16h / 8h (light / dark) for 2-6 weeks until the branches take root. After taking root, the complete plant can be moved to a climate chamber or outdoors for normal culture.
[0048] The following is a detailed description in conjunction with specific embodiments:
[0049] Embodiment 1:
[0050] This embodiment uses an antimicrobial peptide to prevent and treat citrus canker bacteria. The method includes constructing an antimicrobial peptide overexpressing CLBV vector, inoculating citrus with CLBV, and analyzing the inoculation of citrus canker bacteria. The process is as follows: Figure 1As shown, the strain is K599 root-inducing Agrobacterium containing a specific CLBV vector. After the strain is activated, the CLBV vector is inoculated into citrus by vacuum infiltration. The infiltrated branches are cultured by cuttings in sterilized vermiculite. The branches take root and are propagated after systemic leaves are tested for CLBV.
[0051] The specific steps are as follows:
[0052] (1) Construction of CLBV vector for overexpression of antimicrobial peptides: The antimicrobial peptide coding sequence was synthesized and constructed into the BamHI restriction site of the CLBV vector. After the constructed vector was sequenced and confirmed to be correct, it was transformed into K599 Agrobacterium rhizogenes by electroporation.
[0053] (2) CLBV inoculation: Agrobacterium containing an antimicrobial peptide overexpressing CLBV vector was cultured in LB medium at 26°C and 200 rpm in the dark until OD600 = 0.8-1.0; the bacterial solution was collected in a 50 ml centrifuge tube, centrifuged at 5000 rpm for 10 minutes, and the supernatant was discarded to collect the bacteria; the bacteria were resuspended in MES infiltration solution and centrifuged at 5000 rpm for 10 minutes to collect the bacteria, and the bacteria were resuspended in MES infiltration solution again to obtain the infiltration solution, and CLBV was inoculated on citrus branches by the rhizogenes Agrobacterium infiltration method; the branches after infiltration and inoculation were cultured in vermiculite.
[0054] (3) CLBV detection: RNA was extracted from citrus leaves 5-8 months after inoculation and reverse transcribed into cDNA. The cDNA was verified by RT-qPCR and conventional PCR using primers that specifically bind to CLBV. When the Ct of RT-qPCR was <30 and conventional PCR could amplify a specific bright band of the required length, the corresponding citrus was determined to be successfully inoculated with CLBV.
[0055] (4) Inoculation of GFP-overexpressing X. citri canker (Xcc-GFP): After activation culture of Xcc-GFP, the bacterial solution was collected and the concentration was adjusted to OD600 = 0.8-1.0. Xcc-GFP was inoculated on the back of the leaves by needle inoculation and kept moisturizing at 26°C in the dark for 1-3 days.
[0056] (5) Evaluation of the antibacterial effect of citrus canker bacteria: Using wild-type citrus and citrus carrying CLBV without the antimicrobial peptide encoding gene as the control group, the changes in the content of citrus canker bacteria at the inoculation site of the treatment group and the control group were compared to complete the efficacy evaluation of the tested antimicrobial peptides.
[0057] The CLBV vector used in step (1) above cannot cause disease in most citrus species, such as Figure 2 As shown, the 5' end of the BamHI restriction site of the CLBV vector contains the Pr1a signal peptide coding sequence, such as Figure 3 As shown; and Pr1a can induce the C-terminus-linked target protein to be secreted outside the cell, such as Figure 4 and Figure 5 As shown; the antimicrobial peptide selected in the embodiment of the present invention is Paneth cell-specific α-defensin 1 (P4 for short) or Acipensin 2 (204 for short), and the three-dimensional structure of the selected antimicrobial peptide is as shown Figure 6 As shown, the signal peptide splicing prediction of the 'Pr1a signal peptide-antimicrobial peptide' fusion protein is as follows Figure 7 As shown in Figure 2, the construction strategy of antimicrobial peptide overexpression CLBV vector is as follows Figure 8 shown.
[0058] The infiltration method of root-generating Agrobacterium in the above step (2) is as follows: the concentration of the Agrobacterium infiltration solution is OD600=0.8-1.0, and the solution needs to be left to stand at room temperature in the dark for 3-6 hours before infiltration, and the wound at the base of the citron branch with a length of 5-10 cm is immersed in the solution, and the material is vacuum-treated for 30 minutes using a vacuum pump; the branch cuttings after infiltration and inoculation are cultured in vermiculite, wherein the vermiculite has a diameter of 2-3 mm and is sterilized with high-pressure steam (121° C., 20 minutes) before use, and cultured at 26° C., 16h / 8h (light / dark) conditions for 2-6 weeks until the branches take root, and the complete plants after taking root can be moved to a climate chamber or outdoors for normal culture.
[0059] The RT-qPCR primers used for CLBV detection in step (3) above are CLBV-RT-F:AAAGTG
[0060] AGTGTCGGTAGC, and CLBV-RT-R: ATTTGTTGGTGGGAGTG; the conventional P
[0061] The CR primers were CLBV-F: ATGCAGCAATTCCAACTGAAGC, and CLBV-R: CAGATC
[0062] GCGGTATCCCCTTTAG, amplification length is 600-900bp.
[0063] The culture conditions of Xcc-GFP in the above step (4) are as follows: take the Xcc-GFP strain stored in a -80°C refrigerator, use an inoculation loop to pick up a small amount of bacterial liquid and streak continuously on LB solid culture medium, and culture in the dark at 26°C for 2 days to obtain a single Xcc-GFP colony; collect the Xcc-GFP bacteria in a centrifuge tube, suspend the bacteria in clean water, and centrifuge at 5000 rpm for 10 min, and discard the supernatant; suspend the bacteria in clean water again and adjust the bacterial concentration to OD600=0.8-1.0.
[0064] The Xcc-GFP inoculation method in the above step (4) is as follows: select mature citrus leaves, use an inoculation needle to dip the Xcc-GFP bacterial solution, and inoculate the back of the leaves with a needle prick point. The inoculated leaves are placed in an inoculation box moisturized with a wet paper towel, and the inoculation box is placed in a 26°C incubator for 1-3 days.
[0065] The antibacterial effect evaluation method in the above step (5) is as follows: the inoculation site is cut off with a scalpel, placed on a glass slide and water is added, and after covering with a coverslip, the inoculation site is observed with a laser confocal microscope, with an excitation wavelength of 488nm and an emission wavelength of 505-550nm. The GFP fluorescence of the inoculation site tissue is scanned in layer scanning mode and the multiple layers of photos are merged into one; the antibacterial effect of the antimicrobial peptide on Xcc-GFP is analyzed by comparing the changes in the fluorescence content of the inoculation sites of the control group and the treatment group.
[0066] The CLBV vector used in this example cannot cause disease in most citrus species, such as Figure 2 As shown, CK is a healthy citron leaf, and CLBV is a citron leaf infected by CLBV. This ensures that CLBV does not affect the antibacterial effect of antimicrobial peptides during the antimicrobial peptide screening process; the 5' end of the BamHI restriction site of the CLBV vector contains a Pr1a signal peptide coding sequence, such as Figure 3 As shown, it should be noted that the infectious clone of the virus used in this example is CLBV, which is isolated from field plants. And Pr1a can induce the secretion of the C-terminally linked target protein to the extracellular space, such as Figure 4 and Figure 5 As shown, Figure 4 The schematic diagram shows the construction of the GFP coding gene fused with the Pr1a sequence into the BamHI restriction site of the CLBV infectious clone; the GFP sequence inserted into the BamHI restriction site of the CLBV infectious clone in the control group does not contain the Pr1a signal peptide. The Pr1a sequence is ATGGGATTTGTTCTCTTTTCACAATTGCCTTCATTTC TTCTTGTCTCTACACTTCTCTTATTCCTAGTAA. Figure 5The diagram shows the construction of Pr1a-GFP into the CLBV infectious cloning vector to verify the exocrine activity of Pr1a. The constructed CLBV-B-Pr1a-GFP and CLBV-B-GFP were transferred into GV3101 Agrobacterium tumefaciens, and the bacteria were shaken for tobacco injection. After 20 days, tobacco leaves were taken to make slices and observed under a confocal microscope. The results showed that the GFP green fluorescent protein in the tobacco leaves injected with CLBV-B-Pr1a-GFP was secreted outside the cells and merged into the leaf veins, while GFP was not secreted outside the cells in the control, indicating that the function of the Pr1a signal peptide is consistent with the predicted results and has the function of guiding the secretion of the fusion protein outside the cells. This indicates that antimicrobial peptides can also be secreted outside the cell in this way to reduce the effect of antimicrobial peptides on cytotoxicity; because citrus canker bacteria are Gram-negative bacteria, antimicrobial peptides with high inhibitory effects on other Gram-negative bacteria are preferred as research objects to improve the screening efficiency of antimicrobial peptides with good protective effects against citrus canker bacteria; the three-dimensional structure of the selected antimicrobial peptides is shown in Figure 6 As shown in Figure A and Figure B are the three-dimensional structures of antimicrobial peptides 204 and P4, respectively. Antimicrobial peptides whose three-dimensional structures conform to the classical antimicrobial peptide structure (such as α helix, β fold, cyclic peptide or random coil, etc.) are preferred; the signal peptide splicing prediction of the 'Pr1a signal peptide-antimicrobial peptide' fusion protein is as follows Figure 7 As shown in the figure, Signal-5.0 was used to predict the cleavage site of the antimicrobial peptide sequence connected to the Pr1a signal peptide, proving that the antimicrobial peptide after fusion with Pr1a has exocrine function and can be precisely cleaved at the specified site (the red part on the left is the signal peptide, the yellow part on the right is the antimicrobial peptide, and the cross part in the middle is the cleavage site). It proves that the antimicrobial peptide secreted outside the cell does not contain a signal peptide to avoid the effect of the Pr1a signal peptide on the antibacterial activity of the antimicrobial peptide; the construction strategy of the antimicrobial peptide overexpression CLBV vector is as follows Figure 8 As shown in Figure 2, the insertion site of the antimicrobial peptide has been shown to be able to effectively overexpress foreign proteins; RT-qPCR and sequencing results proved that the tested CLBV was successfully inoculated into citrus and spread systemically in citrus, such as Fig. 9 and Fig.10 As shown, Fig. 9 and Fig.10 They are the fluorescence quantitative content detection of antimicrobial peptide overexpressing CLBV in the inoculated citrus system leaves and the sequencing results of antimicrobial peptides in citrus system leaves. Fig.10 The sequence in the above and below is the "signal peptide + full length of antimicrobial peptide". The physiological phenotypes of wild-type citrus leaves and citrus leaves infected with antimicrobial peptide overexpressing CLBV are consistent, such as Fig.11As shown, the leaves are from the current year citron leaves (6 months old), and the petioles are kept as much as possible when they are taken. It is proved that the expression of antimicrobial peptides has no significant effect on the phenotype of citrus leaves; Xcc-GFP was cultured in LB medium at 26℃ in the dark for 2 days, and the cells were collected, as shown in Fig.12 As shown, the resistance of the canker bacteria liquid is gentamicin, and the plate is Luria-Bertani solid medium. The canker bacteria liquid with GFP fluorescence is activated by scratching the plate, and the bacteria on the plate are scraped into a 50ml centrifuge tube containing clean water with a spoon. The bacterial liquid is resuspended after centrifugation and the concentration of the bacterial liquid is adjusted to 0.3; avoid piercing the leaves when inoculating Xcc-GFP with needles, such as Fig.13 As shown in the figure, the leaf is the back of a citron leaf, and the needle is a common disposable needle. To reduce the impact of wounds on leaf tissue; studies have shown that the antimicrobial peptide Paneth cell-specific alpha-defensin 1 (P4) can effectively inhibit the proliferation of Xcc-GFP in citrus leaf tissue, such as Fig.14 As shown, Figure A and Figure B are the leaves of wild-type citron on the second day and the sixth day respectively, and the leaves of citron verified to contain P4 after infiltration with Agrobacterium, and the canker bacteria are injected into the leaves by puncturing. Therefore, this example proves that the above method is effective.
[0067] Example 2
[0068] This example uses the method of Example 1 and the screened effective antimicrobial peptides to carry out an analysis of the protective effect against other citrus pathogens:
[0069] The specific method is: inoculate the same healthy citrus with citrus Huanglongbing bacteria and the CLBV in Example 1 by grafting, and begin to detect the CLBV content and citrus Huanglongbing bacteria content in the citrus system leaves 6 months after inoculation, and analyze the inhibitory effect of antimicrobial peptides on Huanglongbing bacteria based on the dynamic changes in the contents of CLBV and Huanglongbing bacteria in the system leaves.
[0070] Fig.15The inoculation source of Huanglongbing bacteria is detected, where A.1-8 is branches 1 to 8, and each branch comes from a different citrus plant. The red dotted line represents a CT value of 25. The scions for grafting Huanglongbing are taken from these 8 branches. B. The detection site of the branches used for inoculation is the veins of the system leaves. The content of Huanglongbing bacteria in the Huanglongbing scions is detected by the fluorescent quantitative probe method, and the Ct detection value must be less than 30. Huanglongbing bacteria detection method: Use the CTAB method to extract DNA from healthy and diseased scions; 2μL of DNA to be tested, 1μL of 10×PCRbuffer (TAKARA), 0.4μL of upstream and downstream primers (10μM), 0.4μL of probe (10μM), 1μL of dNTP (2.5mM), 0.08μL of HS Taq (TAKARA), and 4.72μL of DEPC water. Reaction procedure: pre-denaturation at 95°C for 5 min; denaturation at 95°C for 15 s, annealing and extension at 55°C for 50 s, for a total of 45 cycles.
[0071] Upstream primer sequence (5'-3'): AGTGTTGCGCAAATTAAAGATCT; downstream primer sequence (5'-3'): AGACAATTAGAGACTGCCCAACG; probe primer sequence (purification method:
[0072] HPLC; 5' modification: 6-FAM; 3' modification: BHQ1): CGGAAAAAGATGCGGGAAGCTG.
[0073] Fig.16 This is the inoculation method of Huanglongbing bacteria, where Figure A is a macroscopic picture of the test plant, and Figure B is a detailed observation of the grafting. When grafting, the branches below the part to be grafted should be removed to ensure that the scion has enough nutrients to grow. At the same time, removing some leaves at the top can inhibit the apical dominance of the plant and allow the sparse main trunk to sprout more side branches. The bud grafting method is used. After grafting, the scion must survive for more than 6 months and sprout normally.
[0074] Fig.17 The detection of the pathogen content in the systemic leaves of citrus inoculated with Huanglongbing bacteria proved that the citrus Huanglongbing bacteria was successfully colonized in the systemic leaves 4-6 months after inoculation with HLB diseased ears.
[0075] Fig.18Analysis of the inhibitory efficiency of antimicrobial peptides on citrus Huanglongbing fungus: By comparing the difference in the Ct value of citrus Huanglongbing fungus in the system leaves of the control group (CLBV-CK) and the treatment group (CLBV-204), combined with the content of CLBV in the corresponding system leaves, the control effect of antimicrobial peptides on Huanglongbing fungus was analyzed, where the dotted line represents the Ct value of Huanglongbing detection of 35, below 35 means infected with Huanglongbing, and above 35 means no Huanglongbing. No Huanglongbing fungus was detected in the navel orange grafted with antimicrobial peptide 204 scion, indicating that antimicrobial peptide 204 has a significant inhibitory effect on Huanglongbing fungus.
[0076] The above description is only a preferred specific implementation manner of the present invention, but the protection scope of the present invention is not limited thereto. Any technician familiar with the technical field can make equivalent replacements or changes according to the technical scheme and inventive concept of the present invention within the technical scope disclosed by the present invention, which should be covered by the protection scope of the present invention.
Claims
1. An application of an antimicrobial peptide in preventing and treating citrus canker pathogens, characterized in that: The antimicrobial peptide is fused with an exocrine signal peptide.
2. The use of the antimicrobial peptide according to claim 1 in preventing and treating citrus canker bacteria, characterized in that: The antimicrobial peptide is fused with a Pr1a signal peptide at the N-terminus.
3. The use of the antimicrobial peptide according to any one of claims 1 or 2 in preventing and treating citrus canker bacteria, characterized in that: The antimicrobial peptide is Paneth cell-specific α-defensin 1 or Acipensin 2.
4. The use of the antimicrobial peptide according to any one of claims 1 or 2 in preventing and treating citrus canker bacteria, characterized in that: CLBV was selected as the antimicrobial peptide expression vector, the antimicrobial peptide encoding gene was cloned into the specific site of CLBV, and CLBV was inoculated into citrus branches by the Agrobacterium rhizogenes infiltration method; the citrus branches were cut into vermiculite and cultured for 5-8 months to obtain complete plants and CLBV was systemically infected.
5. A method for preventing and controlling citrus canker bacteria using antimicrobial peptides, characterized in that: The method steps include: Construction of CLBV vector for overexpression of antimicrobial peptides: CLBV was selected as the antimicrobial peptide expression vector, and the antimicrobial peptide encoding gene was cloned into the specific site of CLBV; CLBV inoculation: CLBV was inoculated into citrus branches by the Agrobacterium rhizogenes infiltration method; the citrus branches were cut into vermiculite and cultured for 5-8 months to obtain complete plants, and CLBV was systemically infected.
6. The method for controlling citrus canker bacteria using antimicrobial peptides as claimed in claim 5, characterized in that: The antimicrobial peptide overexpression CLBV vector is constructed specifically as follows: The antimicrobial peptide coding sequence was synthesized and constructed into the BamHI restriction site of the CLBV vector. After the constructed vector was sequenced and confirmed to be correct, it was transformed into K599 Agrobacterium rhizogenes by electroporation.
7. The method for controlling citrus canker bacteria using antimicrobial peptides as claimed in claim 5, characterized in that: The concentration of Agrobacterium solution used in the Agrobacterium infiltration method is OD 600 =0.8-1.0, the culture medium needs to be left in the dark at room temperature for 3-6 hours before bacterial infiltration, and the vacuum treatment time is 30 minutes.
8. The method for controlling citrus canker bacteria using antimicrobial peptides as claimed in claim 5, characterized in that: The culture conditions for citrus branch cuttings are as follows: the vermiculite is 2-3 mm in diameter and is sterilized with high-pressure steam before use. It is cultured at 26°C, 16 h of light and 8 h of darkness for 2-6 weeks until the branches take root. After taking root, the complete plants are moved to a climate chamber or outdoors for culture.
9. The method for controlling citrus canker bacteria using antimicrobial peptides according to any one of claims 5 to 8, characterized in that: The antimicrobial peptide is Paneth cell-specific α-defensin 1 or Acipensin 2.