Digital nucleic acid detection platform based on SERS (Surface Enhanced Raman Scattering) as well as preparation method and application thereof

Abstract

The invention discloses a digital nucleic acid detection platform based on SERS (Surface Enhanced Raman Scattering) as well as a preparation method and application thereof, and relates to the technical field of nucleic acid detection. Comprising a micro-fluidic chip, an SERS probe, Cas12a, crRNA and a Raman signal detector, the SERS probe is formed by Au (at) DNA (Deoxyribose Nucleic Acid) and MB (at) Biotin DNA through base pairing; a liquid drop generation area, a liquid drop electrode fusion area, a liquid storage tank, a magnetic separation area and a detection tank which are sequentially distributed and communicated with one another are arranged on the micro-fluidic chip; the liquid drop generation area is used for dividing a sample to be detected into a plurality of liquid drops; and a channel for adding the SERS probe, Cas12a and crRNA is arranged at the liquid drop electrode fusion region. The detection limit of the digital nucleic acid detection platform provided by the invention can be as low as 10fM; the sample treatment process is reduced, and the sample detection efficiency is improved; the method can be directly operated at room temperature without complex operation environment, and is convenient to use.

Description

Technical Field

[0001] The present invention relates to the technical field of nucleic acid detection, and in particular to a SERS-based digital nucleic acid detection platform and applications thereof. Background Art

[0002] Acute kidney injury (AKI) is a common complication of critical illness, with rapid onset, rapid progression and high mortality. Currently, urine volume (UV) and serum creatinine (sCr) levels are the gold standard diagnostic criteria for monitoring AKI. However, UV and sCr are limited in the assessment of AKI because they are easily affected by muscle mass, age, gender and diet. In contrast, increasing evidence shows that the cytochrome c oxidase subunit III (COX III) gene in urine is a powerful biomarker for AKI, which can sensitively, specifically and non-invasively reflect the process of kidney injury and recovery. Therefore, the expression level of the COX III gene is of great significance for the early diagnosis and clinical treatment evaluation of AKI. At present, the main methods for detecting the COX III gene are polymerase chain reaction, microarray, Southern blotting, etc. These methods provide strong support for DNA detection, but there are still disadvantages such as long time consumption of thermal cyclers, limited sensitivity and cumbersome operation. It is urgent to develop a simple method for rapid, sensitive and reliable COX III gene detection. Summary of the invention

[0003] In view of this, the main purpose of the present invention is to provide a digital nucleic acid detection platform based on SERS. The detection platform provided by the present invention can be used to achieve absolute quantitative analysis of target genes. By using CRISPR / Cas12a technology, the detection limit of COX III gene reaches 10fM.

[0004] To achieve the above object, the technical solution of the present invention is as follows:

[0005] A SERS-based digital nucleic acid detection platform, comprising a microfluidic chip, a SERS probe, Cas12a, crRNA and a Raman signal detector;

[0006] The SERS probe is formed by Au@DNA and MB@BiotinDNA through base pairing;

[0007] The microfluidic chip is provided with a droplet generation area, a droplet electrode fusion area, a liquid storage tank, a magnetic separation area and a detection tank which are distributed in sequence and interconnected with each other. The droplet generation area is used to divide the sample to be tested into a plurality of droplets. If the sample to be tested contains target DNA, some or all of the droplets contain target DNA; the droplet electrode fusion area is provided with a channel for adding the SERS probe, Cas12a and crRNA, and the outlet end of the channel is a fusion port, at which the SERS probe, Cas12a and crRNA are fused with the droplet; the Cas12a can form a binary complex with the crRNA to capture the target DNA in the droplet, and form a ternary complex to cut the SERS probe, and cut and separate the Au@DNA and the MB@BiotinDNA;

[0008] The magnetic separation zone is used to separate the MB@BiotinDNA after cleavage and the SERS probe that has not been cleaved from the droplet;

[0009] The detection pool is used to place the separated droplets;

[0010] The Raman signal detector is used to detect the Raman signal of each droplet in the detection pool.

[0011] Furthermore, the cutout size of the droplet generation area is 20-30 μm, preferably 25 μm.

[0012] Furthermore, the fusion opening size of the droplet electrode fusion zone is 40-60 μm, preferably 40 μm.

[0013] Furthermore, two empty PDMS channels are arranged next to the droplet electrode fusion zone, and the PDMS channels are filled with saturated sodium chloride solution to form two electrodes to provide an electric field for the droplet electrode fusion zone.

[0014] Furthermore, the outlet end of the liquid storage tank is tapered.

[0015] Furthermore, in the SERS probe, there are at least 10 bases complementary pairing between the Au@DNA and the MB@BiotinDNA.

[0016] A second object of the present invention is to provide a method for preparing any of the above-mentioned nucleic acid detection platforms, comprising the following steps:

[0017] (A) Construction of SERS probe

[0018] 1) Synthesis of AuNPs: Add sodium citrate solution to a container, stir and heat until boiling, add HAuCl4 solution, cool to 80°C to 95°C after the reaction is completed; add sodium citrate solution and HAuCl4 solution in sequence, and repeat several times; after all the solutions are added, continue to maintain 80°C to 95°C for 20 to 40 minutes, then cool to room temperature to obtain a gold nanoparticle solution, i.e., AuNPs, which is stored for later use;

[0019] 2) Synthesis of Au@MGITC: The obtained gold nanoparticle solution was mixed with the Raman reporter molecule MGITC, stirred, centrifuged, and the supernatant was discarded and resuspended to prepare AuNPs@MGITC;

[0020] 3) Construction of Au@DNA: AuNPs@MGITC was mixed with DNA probe 1, microwave-treated, washed, centrifuged, and the supernatant was discarded and resuspended to obtain Au@DNA bound to Raman reporter molecules, which was stored for later use;

[0021] 4) Construction of MB@BiotinDNA: Magnetic beads modified with streptavidin on the surface were mixed with DNA probe 2, oscillated for suspension, incubated at room temperature, centrifuged, and the supernatant was removed to obtain MB@BiotinDNA;

[0022] 5) Construction of SERS probe: The obtained Au@DNA and MB@BiotinDNA were mixed, stirred, centrifuged to remove the supernatant, and washed to obtain a SERS probe, in which the DNA probe 1 and the DNA probe 2 were base paired;

[0023] (B) Preparation of microfluidic chip

[0024] 1) Printing a mask: Printing a designed mask pattern to obtain a mask; the mask pattern is provided with a droplet generation area, a droplet electrode fusion area, a liquid storage tank, a magnetic separation area and a detection tank;

[0025] 2) Photolithography of silicon wafer: After the silicon wafer is pre-treated, coated and baked, the printed mask is placed on the photolithography machine, the mask and silicon wafer are adsorbed, and photolithography is started. The pattern is transferred to the photoresist through the mask pattern; then the mask and silicon wafer are separated, the silicon wafer is further baked, and then developed, cleaned and dried to obtain a silicon wafer with photolithography patterns;

[0026] 3) PDMS chip production: PDMS is mixed with a curing agent, dried and degassed until there are no bubbles, and degassed PDMS is obtained; a silicon wafer with a photolithographic pattern is placed flat on a clean vacuum plate, and the degassed PDMS is poured on it, and it is degassed and cured again; after cooling, the PDMS is peeled off from the silicon wafer, and the PDMS is cut and punched to form a droplet generation area, a droplet electrode fusion area, a liquid storage tank, a magnetic separation area and a detection tank that are connected in sequence, and the droplet generation area is provided with a sample injection hole and an oil inlet hole, and the droplet electrode fusion area is provided with a probe hole; the PDMS and the glass slide are washed, dried, cooled, and placed in a plasma cleaning machine for treatment; then the PDMS is bonded to the glass slide and baked to solidify to obtain a microfluidic chip;

[0027] (C) The sample inlet, oil inlet and probe hole of the obtained microfluidic chip are respectively connected to the corresponding injection pumps through connecting tubes or hoses, wherein the SERS probe is transported to the droplet electrode fusion area through the probe hole.

[0028] Furthermore, in step (A) 3), the microwave treatment is heated for 3 min, the microwave input power is 1150 W, and the microwave output power is 700 W.

[0029] Furthermore, the purpose of the present invention is to provide an application of any of the above-mentioned nucleic acid detection platforms in detecting the concentration of target DNA in a sample.

[0030] The purpose of the present invention is also to provide the use of any of the above-mentioned nucleic acid detection platforms in detecting early diagnostic biomarkers for acute kidney injury.

[0031] Furthermore, the biomarker includes the COX III gene; the sequence of the crRNA is shown in SEQ ID NO.1; the sequence of the DNA in the Au@DNA is shown in SEQ ID NO.2, and the sequence of the DNA in the MB@BiotinDNA is shown in SEQ ID NO.3.

[0032] Furthermore, during detection, the voltage of the electric field is 500 mV, the oil hole pressure is 1.8 uL / min, the sample hole (injection hole) pressure is 0.2 uL / min, and the probe hole pressure is 0.1 uL / min.

[0033] Furthermore, during the detection, the method further includes adding magnesium ions with a final concentration of 10-15 mM, preferably 13 mM, to the sample to be tested.

[0034] The beneficial effects of the present invention include at least:

[0035] The SERS-based digital nucleic acid detection platform provided by the present invention represents a promising multifunctional platform for accurate diagnosis of acute kidney injury (AKI). The innovative integration of the fully integrated microfluidic chip and the digital SERS-CRISPR / Cas12a technology provides excellent sensitivity, specificity, a wide detection range and ease of operation, with a detection limit as low as 10fM; it reduces the sample processing process and improves the detection efficiency of the sample; it can be operated directly at room temperature without a complex operating environment, and is easy to use.

[0036] Compared with traditional qRT-PCR technology, digital SERS-CRISPR / Cas12a is more cost-effective because it simplifies the process and minimizes the use of expensive reagents. In addition, it combines the advantages of microfluidic chips and has significant advantages in ease of operation, making it highly efficient even in resource-limited settings.

[0037] The clinical feasibility of this method has been verified in cell experiments, clinical urine samples, and artificial urine samples, demonstrating its potential in actual clinical applications. Detection of the target COX III gene using digital SERS-CRISPR / Cas12a droplet biosensor technology can significantly improve the sensitivity and specificity of identifying AKI patients. By using digital SERS-CRISPR / Cas12a sensors to monitor COX III gene levels in real time, clinicians can conduct risk assessments for AKI patients and adjust treatment plans accordingly. These findings demonstrate the potential of digital SERS-CRISPR / Cas12a sensors as a complementary diagnostic tool for AKI risk assessment, providing clinicians with more accurate and comprehensive information and improving patient treatment outcomes. Digital SERS-CRISPR / Cas12a droplet biosensors showed high specificity in COX III gene detection, which is crucial for the early diagnosis of diseases such as acute kidney injury. In addition, their application is also of great significance in the targeted detection of specific cancer biomarkers. These features make the digital SERS-CRISPR / Cas12a platform a reliable and versatile tool suitable for rapid and accurate diagnosis of various diseases, highlighting its potential in various diagnostic scenarios. BRIEF DESCRIPTION OF THE DRAWINGS

[0038] Figure 1This is the PAGE diagram of the DNA enzyme activity of Cas12a, channel 1: Cas12a; channel 2: crRNA; channel 3: Target; channel 4: ssDNA; channel 5: ssDNA+crRNA+Target channel 6: Cas12a+Target+ssDNA; channel 7: Cas12a+crRNA+ssDNA; channel 8: Cas12a+crRNA+Target; channel 9: Cas12a+crRNA+Target+ssDNA.

[0039] Figure 2 PAGE profile of single-base mismatch detection experiment of Cas12a platform for COX III gene detection.

[0040] Figure 3 Characterization results of AuNPs: A) TEM characterization image, B) UV absorption spectrum.

[0041] Figure 4 Raman characterization results of AuNPs@MGITC.

[0042] Figure 5 This is an intuitive picture of AuNPs, AuNPs+DNA, and AuNPs+SH-DNA before and after microwave heating.

[0043] Figure 6 Characterization results of Au@DNA: A) PAGE spectrum; B) Raman spectrum; C) Zeta potential; D) DLA characterization.

[0044] Figure 7 is the Zeta potential of MB@DNA.

[0045] Figure 8 Characterization results of different groups of probes. A) Visual image of different groups of probes before magnetic separation; B) Visual image of different groups of probes after magnetic separation; C) Raman characterization results of different groups of probes; D) Different groups of probes at 1614cm -1 Raman intensity; E) UV absorption characterization results of different groups of probes; F) 530nm UV absorption intensity of different groups of probes.

[0046] Fig. 9 The results of characterization of the cutting activity of different groups of probes. A) Visual pictures of different groups of probe activity tests before and after magnetic separation; B) Raman characterization results of different groups of probe activity test samples; C) Raman intensity of different groups of probe activity test samples at 1614cm-1; D) UV absorption characterization results of different groups of probe activity test samples; E) UV absorption intensity of different groups of probe activity test samples at 530nm; F) Activity test of probes of different concentrations at 1614cm -1 The Raman intensity.

[0047] Fig.10 TEM characterization images of SERS probes. A) TEM characterization image of SERS probe-Au@DNA-MB@BiotinDNA; B) TEM characterization image of SERS probe after being cut by Cas12a system

[0048] Fig.11 Characterization of the base number optimization experiment. A) Raman characterization of cleavage activity of different base numbers; B) Raman characterization of samples with different base numbers cleavage activity at 1614 cm -1 of Ramandu.

[0049] Fig.12 Schematic diagram of Cas12a system + SERS probe.

[0050] Fig.13 Schematic diagram of the microfluidic system

[0051] Fig.14 Partitioning of microfluidic systems for imaging with an inverted fluorescence microscope.

[0052] Fig.15 Inverted fluorescence microscopy imaging of droplet formation in droplet generation areas with different cutouts.

[0053] Fig.16 Inverted fluorescence microscopy imaging of the fusion area of ​​droplet electrodes with different cuts.

[0054] Fig.17 Diagrams of droplet diameters before and after droplet injection in the reservoir. A) Intuitive image before droplet injection; B) Particle size distribution before droplet injection; C) Intuitive image after droplet injection; D) Particle size distribution after droplet injection.

[0055] Fig.18 Inverted fluorescence microscopy imaging before and after reservoir optimization.

[0056] Fig.19 Inverted fluorescence microscope imaging of droplets before and after optimization of the detection pool. A) The chip channel depth is 80 μm; B) The chip channel depth is 60 μm.

[0057] Fig. 20 The results of the comparative test of the fusion port of the droplet electrode with and without power supply. A) Non-power supply state; B) Power supply state.

[0058] Fig.21 Schematic diagram of droplets under different magnifications and Raman characterization images. A) Schematic diagram of droplets under different magnifications; B) Raman characterization images of droplets under different magnifications; C) Droplets under different magnifications at 1614 cm -1 The Raman intensity at .

[0059] Fig. 22 The calculation process of the threshold.

[0060] Fig.23 Positive droplets of DNA with different concentrations were imaged among 500 droplets under a 5x field of view.

[0061] Fig.24 The standard curve of DNA is shown in Figure 1. A) 100fM~1nM standard curve; B) 10fM-10nM detection line diagram.

[0062] Fig.25 Imaging of different types of disease markers on the Digital-SERS microfluidic platform.

[0063] Fig.26 The Raman characterization results of different types of disease markers. A) Raman spectra of different types of disease markers; B) Raman spectra of different types of disease markers at 1614 cm -1 Raman intensity.

[0064] Fig. 27 The SERS probe at 1614 cm for 0, 10, 20, and 30 days -1 The Raman intensity.

[0065] Fig.28 JC-1 staining images at different times of cell modeling.

[0066] Fig.29 Cell morphology at different times of cell modeling.

[0067] Fig.30 The expression levels of intracellular proinflammatory factors after HK2 human renal tubular epithelial cell modeling. A) TNF-@; B) IL-6.

[0068] Fig.31 Results of qPCR detection of intracellular and extracellular COX III. A) CT values ​​of samples with different known concentrations; B) COX III standard curve; C) CT values ​​of intracellular COX III qPCR experiments after different time periods of cell modeling; D) Intracellular COX III concentrations after different time periods of cell modeling.

[0069] Fig.32 Digital-SERS microfluidic platform was used to detect imaging after different time periods of cell modeling.

[0070] Fig.33 A standard curve of intracellular COX III concentration at different time points was constructed for the cells.

[0071] Fig.34 The detection limits at two magnesium ion concentrations are shown in Figure 2. A) Shear rate at two magnesium ion concentrations; B) Detection limits at two magnesium ion concentrations.

[0072] Fig.35Results of qPCR detection of COX III in urine. A) CT values ​​of samples with different concentrations; B) COX III standard curve; C) CT values ​​of COX III qPCR experiments in urine of different patients; D) COX III concentrations in urine of different patients.

[0073] Fig.36 Color Doppler ultrasound images of the kidneys of different patients and imaging of COX III in urine using the Digital-SERS microfluidic platform.

[0074] Fig.37 This is a COX III in vitro standard curve.

[0075] Fig.38 The results and standard curve of artificial urine with different concentrations of COX III using qPCR and Digital-SERS microfluidic platform. A) Detection results using qPCR and Digital-SERS microfluidic platform; B) Standard curve of Digital-SERS microfluidic platform detection. DETAILED DESCRIPTION

[0076] The technical solutions in the embodiments of the present invention are described clearly and completely below. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0077] The materials and equipment used in the present invention are as follows:

[0078] 1. Materials

[0079] (2-Carboxyethyl)phosphine hydrochloride (TCEP) was provided by Beijing Inno Chemical Technology Co., Ltd. (Beijing, China). Malachite green isothiocyanate (MGITC) was purchased from Thermo Fisher Scientific Inc. Chloroauric acid was purchased from Shanghai Bojing Chemical Co., Ltd. (Shanghai, China). Trisodium citrate dihydrate was purchased from Xilong Science Co., Ltd. (Shanghai, China). Streptavidin magnetic beads were from Leimeng Technology Co., Ltd. (Beijing, China). Microfluidic oil phase (HFE-7500) was purchased from 3M Company (St. Paul, MN, USA). PDMS substrate and curing agent (Dow Corning 184) were purchased from Dow Corning (Midland, MI, USA). PAGE was purchased from Shanghai Shenggong Biotechnology Co., Ltd. (Shanghai, China). Photoresist (SU-82025) was purchased from JCST (Shanghai, China). SYBRGreen I type nucleic acid stain was purchased from MCE Biotechnology Co., Ltd. Cas12a (Cpf1) protein was purchased from Jinan Protein Technology Co., Ltd. Fluorescence quantitative PCR kit (dye method), DNA chain, RNA chain, PAGE, DEPC water, TE buffer, TBE buffer and PBS buffer were purchased from Shanghai Qingke Biotechnology Co., Ltd. (Shanghai, China). Mitochondrial membrane potential detection kit-JC-1 was purchased from MacLean Reagent Co., Ltd.

[0080] 2. Equipment

[0081] All glassware was immersed in chromic acid for 24 h and then rinsed with ultrapure water at least five times. The ultraviolet-visible (UV-Vis) absorption spectra of the nanoparticles were obtained using a microplate reader (BioTek, USA), providing valuable information on the optical properties and sample concentration. The morphology and structure of the nanoparticles and SERS probes were investigated using an HT7800 transmission electron microscope (TEM) (HITACHI, Tokyo, Japan). Operating at an accelerating voltage of 120 kV, the TEM allows for high-resolution imaging. Dynamic light scattering (DLS) measurements were performed using a Zetasizer Nano (DMNI, Nano Brook) to determine the size distribution and hydrodynamic diameter of the nanoparticles.

[0082] The solution proposed by the present invention is specifically described below through specific embodiments:

[0083] Example 1 Feasibility study of Cas12a-mediated cleavage

[0084] (1) Feasibility study of PAGE for Cas12a-mediated cleavage

[0085] In order to verify the DNA enzyme activity of Cas12a, PAGE was performed in this example. The steps of polyacrylamide gel electrophoresis (PAGE) are as follows:

[0086] Refer to the PAGE gel recipe table to prepare 20% gel: 30% polyacrylamide, 5×TBE buffer, 10% APS, TEMED and ultrapure water are added to a 50mL centrifuge tube and mixed thoroughly. Use a pipette to absorb the mixture, make sure to choose a pipette of appropriate volume when using it, and avoid introducing bubbles. Slowly and evenly drip the mixture from the pipette into the corresponding position of the gel plate. Try to avoid liquid splashing or bubble formation. Place the mixture on a rubber plate and let it stand until the gel solidifies. Subsequently, transfer it to the electrophoresis tank and add 1×TBE buffer to ensure sealing. Remove the tooth comb, then mix 10μL of the reaction product with 2μL of 6×DNALoading buffer thoroughly, and then add it to the loading well of the 20% PAGE gel. Start electrophoresis at a constant voltage of 80V at room temperature and maintain for 2 hours. Stain the gel with SYBR Green I nucleic acid dye and place it on a platform containing 1×TBE buffer for half an hour. Finally, use a gel imager for imaging.

[0087] Channel 1: Cas12a; Channel 2: crRNA; Channel 3: Target; Channel 4: ssDNA; Channel 5: ssDNA+crRNA+TargetChannel 6: Cas12a+Target+ssDNA; Channel 7: Cas12a+crRNA+ssDNA; Channel 8: Cas12a+crRNA+Target; Channel 9: Cas12a+crRNA+Target+ssDNA. Incubation time: 15 minutes. [Cas12a]: 100nM, [crRNA]: 200nM, [Target]: 20nM, [Substrate]: 1μM, Loading volume: 10μL, run at 80V for 120 minutes. The resulting gel was stained with SYBR Green I type nucleic acid stain and displayed on a gel imaging system.

[0088] The results are as follows Figure 1 As shown, the electrophoresis position of each component in the Cas12a / crRNA / target triplet and ssDNA is marked (lanes 1-4). Lanes 5-7 show that without the formation of the Cas12a / crRNA / target triplet structure, the nuclease ability of Cas12a cannot be activated. Then, lane 8 shows that the Cas12a / crRNA double complex can specifically identify and degrade target DNA (DNA band darkens). Lane 9 shows that Cas12a, crRNA and target DNA can form a triplet to degrade ssDNA (lane 9), which shows that the nuclease activity of Cas12a can be fully activated by integrating Cas12a / crRNA / target triplet.

[0089] (2) PAGE for single base mismatch detection experiment of Cas12a platform for COX III gene detection

[0090] In order to verify the specific recognition of Cas12a for single-base mutations, gel running was performed to verify the sequences of normal crRNA and crRNA (1), normal without mismatch (COX III-TS and COX III-NTS) and single-base mismatches at different positions (COX III-TS and COX III-NTS) (mismatched bases are marked in green). Normal crRNA and crRNA (1) were used to detect the trans-cleavage ability of normal without mismatch (COX III-TS and COX III-NTS) and single-base mismatches at different positions (COX III-TS and COX III-NTS). Samples containing different substrates were directly uploaded to a 20% polyacrylamide gel and electrophoresed at 80V for 120min in 1×TBE buffer. The resulting gel was stained with SYBR Green I type nucleic acid stain and displayed on a gel imaging system.

[0091] Table 1 Base sequence

[0092]

[0093]

[0094] like Figure 2 As shown, the results show that the Cas12a platform only allows specific recognition of single-base mutations, and setting up a single mismatched base crRNA (1) can establish a highly specific Cas12a recognition platform.

[0095] Example 2 Construction of SERS probe

[0096] (1) Detection method

[0097] DLS characterization: Dynamic light scattering (DLS) is a common technique for determining particle size distribution and zeta potential. In the DLS experiment, AuNPs, AuNPs-functionalized SERS probe nanocomposite samples must be appropriately diluted and evenly dispersed in a transparent liquid, and then ultrasonicated for 30 minutes. The DLS instrument must be selected and configured to measure the sample, including the measurement angle (90°) and temperature (25°C). During the measurement, 3 ml of the sample to be measured should be injected into the four-sided transparent measurement cell, and then the DLS measurement program should be started. To measure the zeta potential, a DLS instrument equipped with a Zeta measurement module is required, and the sample is placed in the designated electrochemical cell. To ensure the accuracy and reliability of the results, each sample should be measured three times and the data recorded.

[0098] TEM characterization: Place the CSCI ultra-thin copper mesh on the front side, use a pipette to draw 10μL Au@DNA-MB@BiotinDNA or SERS probe suspension based on non-specific cleavage of CRISPR-Cas12a and drop it on the copper mesh to form water droplets, let it stand for 10 minutes, use filter paper to absorb excess liquid, and then put the copper mesh in a desiccator overnight for TEM microscope observation. However, the sample may contain impurities or residual substances, which will affect the quality of the TEM image, so it needs to be cleaned. Usually, deionized water or solvents such as ethanol can be used for cleaning.

[0099] SERS measurement: using the 520 cm -1 After calibrating the Raman spectrometer with the Raman peak, the excitation wavelength of 633 nm was used to collect the 600-1800 cm -1 Raman spectra within a certain range. The laser power for off-chip measurements was 5mW, and a 20× objective was used. For on-chip measurements, a 2s accumulation time and a 5× objective were used instead. In order to generate a standard curve, a series of target solutions with known concentrations were prepared, and Raman Mapping spectral analysis was performed for each concentration. The number of Raman signal positive droplets was recorded, and the relationship between the measured results and the corresponding target concentration was plotted into a standard curve. The relationship equation was obtained by data fitting. Raman spectral analysis was performed on the experimental and control group samples, and the Raman Mapping data of each sample was recorded. The Raman Mapping of the experimental and control group samples was then substituted into the relationship equation obtained from the standard curve to calculate the corresponding concentration of each sample.

[0100] (2) Synthesis of AuNPs

[0101] The classic gold seed growth method was used. First, a 250mL three-necked round-bottom flask was prepared, and the prepared 2.2mM, 75mL sodium citrate solution was poured into it. Stirring was performed on a magnetic stirrer at an appropriate speed and heated to boiling (the condenser system was used to prevent the solution from evaporating during the whole process). Immediately, 25mM, 0.5mL HAuCl4 solution was added, and the temperature was cooled and maintained at 90°C after boiling and stirring for 15min. 60mM, 0.5mL sodium citrate solution, 25mM, 0.5mL HAuCl4 solution were added in sequence, with a time interval of 2min, for a total of 12 rounds. After all the solutions were added, 90°C was maintained for 30min, then cooled to room temperature, placed in a glass bottle treated with aqua regia, and stored at 4°C for later use.

[0102] Firstly, the gold nano-substrate was characterized, and the TEM images ( Figure 3 A) shows that AuNPs are uniformly distributed and have a circular structure of about 50 nm. UV spectrum ( Figure 3 B) shows that the ultraviolet absorption peak of AuNPs itself is around 530nm.

[0103] (3) Synthesis of Au@MGITC

[0104] Take an appropriate amount of gold nanoparticle solution, add 0.1mM Raman reporter molecule MGITC at room temperature, stir for 0.5h, centrifuge at 7500rpm, discard the supernatant and resuspend, a total of three times to prepare AuNPs@MGITC. SERS results ( Figure 4 ) showed that AuNPs@MGITC at 1614cm -1 There is a stronger signal.

[0105] (4) Construction of Au@DNA

[0106] A total of 400 μL of AuNPs@MGITC (1 nM) solution was mixed with 20 μL of 100 μm SH-DNA or DNA (DNA probe 1, P1, sequence as shown in Table 2 below) in a 5 mL glass bottle. Then, the glass bottle was placed in a household microwave oven (microwave input power 1150 W, microwave output power 700 W) and heated in high-fire mode for 3 min, and resuspended with PBS phosphate buffer (0.1 M NaCl, pH 7.4). Afterwards, the particles were washed with 0.01 M phosphate buffer (0.3 M NaCl, pH 7.4) and centrifuged (7500 rpm) at 15 ° C for 20 minutes. Finally, the precipitate was resuspended in PBS buffer, and the resulting DNA-AuNP conjugate was stored at 4 ° C in the dark or used for subsequent experiments.

[0107] Table 2: P1 sequences

[0108] P1 ATATATATCACAACACGTATCAT(SEQ ID NO.2)

[0109] like Figure 5 As shown, after the AuNPs+SH-DNA group was microwave-heated and resuspended in PBS, it showed the color of AuNPs and no aggregation occurred, indicating that Au@DNA was successfully prepared.

[0110] In order to verify the successful preparation of Au@DNA, PAGE was selected for characterization. The specific experimental steps refer to Example 1. Channel 1: AuNPs; Channel 2: AuNPs@DNAP1; Channel 3: DNAP1. Electrophoresis results ( Figure 6 A) shows that the DNA chain in lane 2 cannot migrate after being connected to the gold nanoparticles, while lane 3 proves that the DNA chain has been successfully connected to the gold nanoparticles.

[0111] At the same time, further Raman verification experiments were conducted on single crystal silicon at 520 cm -1 The Raman spectrometer was calibrated at the Raman peak wavelength, using an excitation wavelength of 633 nm (laser power 5 mW), an accumulation time of 1 s, a 20× objective lens, and a range of 600-1800 cm-1 Raman spectral signals are collected within the range. SERS results ( Figure 6 B) shows that pure AuNPs have a -1 There is no obvious signal at 1614 cm -1 There is a strong signal at the place where the Raman signal intensity is strong. There is no significant difference between the AuNPs@MGITC and AuNPs@MGITC@DNA (i.e., Au@DNA) groups, but the Raman signals of the two groups are significantly higher than those of the pure AuNPs group. This proves that the DNA chain is successfully modified onto the gold nanoparticles and is stable.

[0112] The Zeta potential was tested using a ZETA electrical analyzer. Figure 6 C) It was found that AuNPs themselves showed a negative charge (-8mV) due to the presence of sodium citrate solution; MGITC itself was positively charged, and after adsorbing AuNPs, it showed a positive charge as a whole (2mV); after AuNPs@MGITC was connected to DNA, it was observed that the overall solution showed a negative charge, and the absolute value was around 22mV, proving that the DNA chain was successfully modified onto the gold nanoparticles and was stable.

[0113] DLS Characterization Figure 6 D): The diameter of AuNPs@MGITC group is 46.1nm, and that of AuNPs@MGITC@DNA (Au@DNA) group is 65.6nm, which proves that the DNA chain is successfully modified onto the gold nanoparticles and is stable.

[0114] (5) Construction of MB@BiotinDNA

[0115] Use a pipette to gently blow to fully resuspend the streptavidin magnetic beads, take 20μL and place it in a 1.5mL centrifuge tube for later use. Place it on a magnetic stand for separation for 1min and remove the supernatant. Add 1×TBS to a final volume of about 0.5mL, and use a pipette to gently blow to resuspend the streptavidin magnetic beads. Place it on a magnetic stand for separation for 10s, remove the supernatant, and complete a washing step. Then follow the above washing steps and wash twice. Finally, remove the supernatant and resuspend the magnetic beads with Binding&Washing Buffer I (2X) with a volume twice that of the original magnetic beads. Add an equal volume of biotin-labeled nucleic acid sample (biotin-modified BiotinP1DNA chain), vortex thoroughly to suspend, and incubate at room temperature for 1 hour. Place the centrifuge tube on a magnetic stand for separation for 1 min and remove the supernatant. Take 1 mLBinding&Washing Buffer I (1X) and add it to the separated magnetic beads, and vortex thoroughly to resuspend the magnetic beads. This is how the magnetic ball @BiotinP1DNA chain (MB@BiotinDNA) was made.

[0116] Table 3 DNABiotin-P1 sequence

[0117] BiotinP1 (DNA probe 2) ATGATGTTCGTTGTG (SEQ ID NO. 3)

[0118] Zeta Potential Figure 7 ) The test also found that MB itself showed a negative charge (-8 mV) due to the presence of PBS buffer; MGITC itself was positively charged, and after adsorbing AuNPs, it showed a negative charge as a whole (-2 mV); after MB was linked to DNA, it was observed that the overall solution showed a negative charge, and the absolute value was around 22 mV, proving that the DNA chain was successfully modified onto the streptavidin magnetic beads and was stable.

[0119] (6) Construction of SERS probe (Au@DNA-MB@BiotinDNA)

[0120] Au@DNA and MB@BiotinDNA were mixed at room temperature for 1 h, placed on a magnetic rack, the supernatant was removed and washed three times with PBS before being dispersed in PBS buffer solution.

[0121] Divided into 4 groups: 1. Au+MB; 2. Au@DNAP1+MB; 3. Au+MB@BiotinP1; 4. Au@DNAP1+MB@BiotinP1; respectively mixed and added to EP tubes, mixed at room temperature for 1 h, placed on a magnetic rack, removed the supernatant and washed three times with PBS before dispersing into PBS buffer solution. The EP tube was placed on a magnetic rack and subjected to colorimetric experiments after magnetic separation for 5 min. The results are shown in Figure 8 A and Figure 8 B, No. 4 successfully prepared Au@DNA-MB@BiotinDNA probe, and the color changed to colorless and transparent. Then, 100 ul of the supernatant was pipetted for UV analysis and SERS detection. The experimental results (8C, 8D, 8E, 8F) showed that the UV absorption peak of the supernatant of groups 1-3 was around 530 nm, and the SERS intensity was around 1614 cm -1 There is a strong Raman signal at 1614 cm -1 There is no obvious Raman signal at the surface, which proves the successful construction of the SERS probe Au@DNA-MB@BiotinDNA.

[0122] (7) Research on detection capability of SERS probe

[0123] The detection ability of SERS probe was investigated in 4 groups: 1: SERS probe + Cas12a; 2: SERS probe + Cas12a + crRNA; 3: SERS probe + Cas12a + Target; 4: SERS probe + Cas12a + crRNA + Target. (Cas12a 200 nM, crRNA 200 nM, target DNA: 1 nM), incubated at room temperature for 20 min, placed the EP tube on the magnetic stand, and after magnetic separation for 5 min, 100 ul of the supernatant was aspirated with a pipette for UV analysis and SERS detection. Fig. 9 A, The experimental solution of group 4 has the color of AuNPs compared with groups 1-3, indicating that the SERS probe can detect the target gene.

[0124] like Fig. 9 B-9E, experimental results show that the supernatants of groups 1-3 have no obvious UV absorption peak, and the SERS intensity is at 1614 cm -1 There is no obvious Raman signal at the same time; while the ultraviolet absorption peak of the supernatant of the four groups is around 530nm, and the SERS intensity is around 1614 cm -1 There is a strong Raman signal at the site. This proves that the crRNA and Cas12a enzyme combination can specifically recognize the target DNA and non-specifically cut the SERS probe, which is further separated magnetically, leading to the above experimental results. At the same time, a series of target solutions with known concentrations were prepared, and the above experimental analysis was performed for each concentration. The results showed that there was no obvious fluctuation in the Raman signal under different concentrations in one-pot reaction, and the detection limit was 1 pM ( Fig. 9 F).

[0125] TEM characterization: divided into 4 groups: 1: SERS probe + Cas12a; 2: SERS probe + Cas12a + crRNA; 3: SERS probe + Cas12a + Target; 4: SERS probe + Cas12a + crRNA + Target. (Cas12a 200 nM, crRNA 200 nM, target DNA: 1 nM), incubated at room temperature for 20 min, placed the EP tube on the magnetic stand, and performed a colorimetric experiment after magnetic separation for 5 min; then used a pipette to aspirate 100 ul of the supernatant and observed under a TEM microscope. The results are shown in Fig.10 As shown, it is proved that Cas12a, crRNA and target DNA can form a triplet to non-specifically cut the SERS probe.

[0126] (8) SERS probe base number optimization experiment based on non-specific cleavage of CRISPR-Cas12a

[0127] Design single strands of different lengths for the above nonspecific cutting, SERS probe + Cas12a + crRNA + Target. (Cas12a 200nM, crRNA 200nM, target DNA: 1nM), incubate at room temperature for 20min, place the EP tube on the magnetic stand, and after magnetic separation for 5min, use a pipette to draw 100ul of the supernatant for SERS detection. Fig.11 As shown, the experimental results show that due to the steric effect, the Cas12a enzyme only begins to have significant side cutting activity when the number of single-stranded bases reaches 10bp or more.

[0128] Example 3 Construction of Digital-SERS Microfluidic Platform

[0129] (1) Design and CAD drawings of microfluidic system

[0130] CAD drawings; such as Fig.13 As shown in the figure, the following areas are designed: droplet generation area 1, where the sample forms droplets in the form of oil-in-water; droplet electrode fusion area 2, where the droplets fuse; liquid reservoir 3, for droplet reaction; magnetic separation area 4, for magnetic adsorption of magnetic bead complex Au@DNA-MB@BiotinDNA; detection pool 5, for SERS detection of the supernatant. The CAD drawing is masked using a film printer.

[0131] (2) Photolithography of silicon wafers

[0132] First, when entering the laboratory, blow off the dust on your body through the air shower room, wear protective clothing, and make sure that your body hair is completely covered to reduce the impact of dust and hair on the experiment. The steps for photolithography of silicon wafers are as follows:

[0133] 1) Take out the silicon wafer, wipe it with anhydrous ethanol, and place it on a preheated wafer drying machine for drying. Set the parameters to 75°C for 10 minutes. After drying, cool it to room temperature.

[0134] 2) Turn on the photoresist machine and set the three-stage parameters: ①500rpm, 20s; ②800rpm, 20s; ③2000rpm, 45s. Place the room temperature silicon wafer on the photoresist machine and pour an appropriate amount of photoresist to evenly spread the photoresist on the silicon wafer.

[0135] 3) After the glue is evenly applied, remove the silicon wafer and bake it on a wafer baking machine in two stages: ① 75℃, 10min; ② 115℃, 30min. After baking, cool to room temperature.

[0136] 4) Turn on N2 and the photolithography machine in turn, and preheat for 10 minutes. Use a calibrator to calibrate the photolithography machine. After wiping the printed mask clean, place it on the photolithography machine, adsorb the mask and silicon wafer, adjust the distance and fit them tightly, and start photolithography. The principle of the photolithography machine is to use a high-energy light source such as ultraviolet light or X-rays to transfer the pattern to the photoresist through the mask pattern.

[0137] 5) After the photolithography is completed, the mask and the silicon wafer are separated, and the silicon wafer is removed and placed on a wafer baking machine for baking in two stages: ① 75℃, 5min; ② 115℃, 5min. After baking, cool to room temperature.

[0138] 6) Place the cooled silicon wafer in a glass dish, add an appropriate amount of developer and develop for 10 minutes. For positive photoresist, the exposed area can be dissolved to form a channel structure; for negative photoresist, the unexposed area can be dissolved, leaving the exposed area to form a channel structure. Pour out the developer, add acetone to clean, and then rinse with pure water. Repeat the cleaning three times, clean the remaining photoresist with isopropanol, and rinse the remaining isopropanol on the silicon wafer with pure water again. After rinsing, dry it in a cool and ventilated place.

[0139] (3) PDMS chip fabrication

[0140] PDMS and curing agent were added to a disposable plastic bowl in a weight ratio of 10:1 and placed on a windproof balance. The mixture was stirred with a disposable spoon and then degassed in a vacuum dryer until there were no bubbles. The photolithographically patterned silicon wafer was placed flat on a clean vacuum tray and the degassed PDMS mixture was poured on it. The wafer was then degassed again to eliminate all bubbles and then heated at 80°C for 3 hours on a temperature-controlled platform. After cooling to room temperature, the PDMS was carefully peeled off from the silicon wafer. The PDMS layer was covered with tape for precise cutting and punched with a puncher to form a droplet generation area 1, droplet electrode fusion area 2, liquid reservoir 3, magnetic separation area 4 and detection pool 5 that were connected in sequence on the PDMS layer. The droplet generation area 1 was provided with a sample injection hole and an oil inlet hole, and the droplet electrode fusion area 2 was provided with a probe hole. The PDMS layer and the glass slide were washed with detergent solution, deionized water, anhydrous ethanol and isopropanol for 5 minutes in sequence and dried with a hair dryer. After cooling, place the PDMS layer (convex side up) and the glass slide in a plasma cleaner and expose to oxygen plasma for 45 seconds. After plasma treatment, gently bond the PDMS layer to the glass slide (concave side down). The bonded PDMS chip is baked at 80°C for 30 minutes on a temperature-controlled platform and cooled to room temperature. The chip is then inspected under a microscope to ensure that the channels are clear. Prepare the required materials and equipment, including multi-syringe pumps, connecting tubes, hoses, microfluidic chips, liquid samples, and oil phases. The connecting tube is connected to the outlet of the syringe pump to ensure a tight, leak-free connection. The other end of the hose is inserted into the corresponding liquid inlet to facilitate the delivery of liquid to the microfluidic chip during the experiment. According to the experimental requirements, set the appropriate flow rate for each syringe pump to ensure accurate liquid delivery.

[0141] (4) Microfluidic chip experiments

[0142] 1) Prepare the required materials and equipment, including multiple syringe pumps, connecting pipes, hoses, microfluidic chips, and required liquid samples and oil phases.

[0143] 2) Connect the connecting pipes to the outlets of the injection pumps respectively, ensuring that the connection between the pipes and the injection pumps is tight and leak-free.

[0144] 3) Insert the other end of the hose into the corresponding sample inlet and oil inlet to deliver the liquid to the microfluidic chip during the experiment.

[0145] 4) Set the appropriate flow rate for each syringe pump according to the experimental requirements. Make sure the flow rate of the syringe pump can meet the experimental requirements so that the liquid can be accurately delivered during the experiment.

[0146] 5) Turn on the syringe pump to deliver the liquid sample and the oil phase to the sample inlet and oil inlet of the microfluidic chip respectively.

[0147] 6) Under the continuous action of the oil phase, the liquid sample is divided into several tiny droplets in the microfluidic chip. Each droplet can be regarded as an independent micro-reaction system.

[0148] 7) As the droplets flow through the channels of the microfluidic chip, the liquid in the droplets is quickly mixed and evenly mixed. By controlling the flow rate of the syringe pump and the pressure of the oil phase, the size and shape of the droplets can be adjusted to achieve different experimental purposes. Observe and record the experimental results. As needed, the experimental parameters can be adjusted to optimize the droplet generation and mixing process.

[0149] Specifically, in the droplet generation area 1, the immiscible carrier oil helps the droplet segmentation. Fig.14 , Fig.15 ) concluded that the droplet formation was better with a 25 μm incision, considering that the viscous force exerted by the continuous phase and the sudden reduction in channel width promoted the droplet decomposition, resulting in rapid and monodisperse droplet formation.

[0150] After entering the droplet electrode fusion zone 2, the present invention designs a microfluidic device including a fusion port to actively introduce CRISPR / Cas12a reagents and SERS probes into the droplet after the droplet is generated. The probe hole consists of a pressurized channel containing the reagents to be added and a positive and negative electrode. When the droplet flows through the fusion, the electric field destabilizes the water-oil interface, allowing the reagents to enter the droplet. Once the droplets leave the vicinity of the electric field, they regain stability. In order to simplify the fabrication of the electrode, two empty PDMS channels are placed near the fusion and filled with saturated sodium chloride solution. The two electrodes of the amplifier are then connected to the two PDMS channels with metal needles. The experimental results of optimizing the electrode fusion port show that ( Fig.16 ) The fusion effect of 50μm electrode is better, and a comparative test of fusion with and without electricity was also conducted ( Fig. 20 ). In the control test where the electrode was not powered, the unpowered droplets did not fuse. The droplets were then introduced into the microfluidic chip, pre-filled with CRISPR / Cas12a reagents (1×NE Buffer 2.1, 200nM Cas12a protein, 600nM gRNA, 2.5μm probe and 0.5U / μL RNase inhibitor) using a pneumatic pump and connected to the picoinjector hole through the inlet hole). By optimizing the electric field (500mV) and the oil hole pressure (1.8uL / min), the sample hole pressure (0.2uL / min) and the probe hole pressure (0.1uL / min), each flowing droplet can be accurately injected with the required reagent. The entire process was imaged using an inverted fluorescence microscope.

[0151] Reservoir 3( Fig.14 ), after the droplet was injected, the droplet diameter increased from 58 μm ( Fig.17 A, 17B) increased to 92μm( Fig.17 C, 17D). Then, the droplets generated by the chip were collected and incubated in the reservoir at room temperature for 10 minutes. In each droplet containing the target, the target DNA was captured by the binary complex of Cas12a / gRNA, activating the trans-cleavage activity of Cas12a and cutting the SERS probe. The reservoir optimization experiment showed that designing a decompression port was not ideal. The droplets flowed out of the decompression port due to pressure changes. After setting the outlet as a triangular cone, the droplets would not be squeezed and deformed. Imaging using an inverted fluorescence microscope ( Fig.18 ).

[0152] In magnetic separation zone 4, the Au@DNA probe complex and the MB@BiotinDNA SERS complex in the droplet are magnetically separated ( Fig.14 ).

[0153] In the detection pool 5 ( Fig.14 ), the Cas12a / gRNA binary complex captures the target DNA, activates the trans-cleavage activity of Cas12a, and cuts the SERS probe. The level of COX III gene target DNA can be digitally quantified. The detection pool optimization experiment and the above microfluidic control experiment show that the 60μm height droplets are more uniform and do not overlap. Using an inverted fluorescence microscope for imaging ( Fig.19 In this embodiment, three detection pools 5 are provided to increase the amount of droplets to be detected, thereby improving the reproducibility and linear range of the detection method.

[0154] By integrating various reactions into a single integrated microfluidic system, the present invention provides an effective solution for target DNA detection. Since the microenvironment within the droplet is controllable, the platform can not only minimize manual operations but also ensure higher repeatability and accuracy.

[0155] This embodiment develops a system ( Fig.12 ), first divide the target DNA molecules into tens of thousands of monodisperse picoliter-sized droplets, actively introduce CRISPR / Cas12a reagents and SERS probes into the droplets after the droplets are generated, and then assemble into a high-density droplet array for in situ incubation and Raman imaging. During the incubation process, the target DNA can be specifically recognized by the programmable crRNA of the Cas12a system. When binding to the target DNA sequence, Cas12a is activated and activates the Cas12a system at an extremely high turnover rate (>10 4) continuously cuts the SERS probe, and then magnetically separates the Au@DNA probe complex from the MB@BiotinDNASERS complex within the droplet. High-throughput Raman signals are confined to an ultra-small volume and can be easily accumulated to illuminate a droplet. At the same time, in the absence of a DNA target, activation of Cas12a, trans-cleavage of the SERS probe, and generation of Raman signals do not occur. If a single DNA target molecule is sufficient to "light up" a droplet in this way, digital counting of single DNA molecules can be achieved by designating each positive and negative droplet as "1" and "0". Therefore, amplification-free and absolute DNA quantification can be achieved. The entire workflow can be implemented using a syringe vacuum-driven microfluidic droplet chip and a standard Raman microscope. After pipetting the Cas12a mixture into the probe hole, highly uniform microdroplets can be stably generated by pulling out the piston of the connected syringe, and then self-assembled into a droplet array. The resulting droplet array can be detected in situ by droplet counting based on Raman Mapping imaging without droplet transfer.

[0156] To address the challenges of manual sample handling and precise control of test conditions, the present invention innovatively conceived an integrated microfluidic system. This streamlined system autonomously coordinates a series of processes, including droplet generation, fusion, reaction, magnetic separation, and SERS detection, ultimately revolutionizing the DNA detection procedure. The microfluidic system of the present invention is installed in a state-of-the-art device consisting of a glass slide carrier and a PDMS layer. This composite layout grants unprecedented control over chip operations and improves the repeatability and accuracy of experiments. Notably, the design of the glass slide carrier takes into account detachability and interchangeability, thereby improving the sustainability and cost-effectiveness of the equipment.

[0157] Example 4 SERS imaging verifies the reliability of the Digital-SERS microfluidic platform

[0158] (1) Single droplet SERS detection under different magnifications

[0159] In-use single crystal silicon 520cm -1 After the Raman spectrometer was calibrated, an excitation wavelength of 633 nm (laser power of 5 mW) was used, the accumulation time was 2 s, and 5× objective lens, 20× objective lens, and 50× objective lens were used respectively in the range of 600-1800 cm -1Raman spectroscopy detection was performed within a range. First, a single point scan of a single droplet was performed, and the center of the droplet was selected for single scanning 50 times under different magnifications. In a single positive droplet, the binary complex of Cas12a / gRNA captured the target DNA, activated the trans-cleavage activity of Cas12a, cut the SERS probe, and then after magnetic separation, the positive droplet was subjected to Raman spectroscopy detection. Origin was then used to analyze the data and draw the Raman spectrum and 1614cm -1 Intensity diagram at . Different areas are designed according to the spot size of different magnification lenses (e.g., 5× objective lens is 6.25μm, each droplet diameter is 40μm, and about 41 areas are designed; 20× objective lens is 3μm, each droplet diameter is 40μm, and about 177 areas are designed; 50× objective lens is 1.5μm, each droplet diameter is 40μm, and about 711 areas are designed;) for single droplet SERS imaging, the Raman signal mainly comes from 1614cm -1 The signal at 1614 cm in the positive droplet is due to the capture of target DNA by the binary complex of Cas12a / gRNA, which activates the trans-cleavage activity of Cas12a and cuts the SERS probe. -1 This provides a more precise analysis ( Fig.21 ).

[0160] (2) Determination of threshold

[0161] To generate a standard curve, a series of target solutions with known concentrations were prepared and Raman mapping spectroscopy was performed for each concentration. -1 The Raman intensity threshold at each point was used to record the number of positive droplets of a specific Raman signal, and the relationship between the measured results and the corresponding target concentration was plotted into a standard curve, and the relationship equation was obtained by data fitting. Next, a known concentration was designed to record the number of positive droplets of a specific Raman signal according to different thresholds, and the above linear equation was substituted into the above linear equation to calculate the concentration corresponding to each sample. The most reasonable threshold was obtained from the results (Table 4, Fig. 22 ).

[0162] Table 4 Standard curves of different concentrations

[0163] f <![CDATA[10 2 ]]> <![CDATA[10 3 ]]> <![CDATA[10 4 ]]> <![CDATA[10 5 ]]> <![CDATA[10 6 ]]> Marking song <![CDATA[R 2 ]]> <![CDATA[10 4.4 (Actual Concentration)]]> Calculate concentration according to the standard curve 100 54.8 73 80.8 96.4 94.4 Y=10.26X+38.84 0.90675 79.6 <![CDATA[10 3.97 ]]> 200 22.6 51.4 65.6 84.6 87.8 Y=16.36X-3.04 0.93804 67.4 <![CDATA[10 4.30 ]]> 300 5.6 29.4 45.8 65 75.8 Y=17.6X-26.08 0.98565 47.8 <![CDATA[10 4.19 ]]> 400 1 15 33 45.2 59.6 Y=14.74X-28.2 0.99696 35.4 <![CDATA[10 4.39 ]]> 500 0.8 8.6 24.4 26.6 43.8 Y=10.4X-20.76 0.96191 23.4 <![CDATA[10 4.24 ]]> 600 0.4 6.2 17.4 15.4 27.6 Y=6.36X-12.04 0.91416 15.4 <![CDATA[10 4.31 ]]> 700 0 4.8 10.8 9.8 17.6 Y=4.02X-7.48 0.91988 9 <![CDATA[10 4.09 ]]> 800 0 3 6.2 6.6 8.6 Y=2.08X-3.44 0.94282 5 <![CDATA[10 4.06 ]]> 900 0 1.8 3.6 4 4.8 Y=1.18X-1.88 0.93374 2.6 <![CDATA[10 3.79 ]]> 1000 0 1.4 2.6 3 2.4 Y=0.64X-0.68 0.70523 1 <![CDATA[10 2.63 ]]> 1100 0 1 1 2.2 0.8 Y=0.28X-0.12 0.31613 0.6 <![CDATA[10 2.57 ]]> 1200 0 1 0.8 1.8 0.8 Y=0.24X-0.08 0.34951 0.2 <![CDATA[10 1.16 ]]>

[0164] (3) SERS imaging

[0165] In order to evaluate the analytical performance of the Digital-SERS microfluidic platform, the present invention uses different target DNA concentrations to add to the platform for detection. As the target DNA concentration increases, the number of positive droplets in 500 droplets under a 5x microscope field of view increases proportionally ( Fig.23 ). After linear regression, the correlation coefficient (R2 )>0.99. The high signal observed by the platform can be attributed to the catalytic trans-cleavage ability of Cas12a protein and the confinement effect after droplet fusion. By using small droplets (diameter: 40μm), even a target DNA concentration of 100fM in the droplets is sufficient to trigger significant trans-cleavage of SERS probes by Cas12a. These results demonstrate that the Digital-SERS microfluidic platform is capable of ultrasensitive and quantitative detection ( Fig.24 ).

[0166] (4) Specificity experiment

[0167] The specificity of the Digital-SERS microfluidic platform was evaluated by detecting markers of different types of diseases.

[0168] like Fig.25 As shown, only COXⅢ gene target DNA (1nM) is at 1614cm -1 The SERS signal generated at 1614 cm -1 There is no obvious SERS signal at 1614 cm -1 The SERS signal generated at the site is similar to that generated by the COXⅢ gene target DNA alone. These results indicate that the designed Digital-SERS microfluidic platform has high specificity and can accurately detect the COXⅢ gene target DNA at the gene level without being affected by interference from other disease markers ( Fig.26 ).

[0169] (5) Recovery rate experiment

[0170] In order to evaluate the accuracy and precision of the analytical method and instrument, the recovery rate of five different concentrations of COX3 gene target DNA was studied. The actual concentration and detected concentration of each sample were recorded. Recovery rate (%) = (detected concentration / actual concentration) × 100%. Based on 1614 cm -1 The SERS intensity and working curves of the measured COX3 gene have a satisfactory recovery rate ranging from 90% to 110% (Table 5). The high recovery rate indicates that the Digital-SERS microfluidic platform can accurately measure the analytes present in the sample without significant loss or change during sample pretreatment. This means that the analysis results have high reliability and accuracy.

[0171] Table 5 Recovery rates at different concentrations

[0172] NO. Added(fM)COX3 Detected(fM)COX3 Recovery(%)COX3 1 <![CDATA[1×10 6 ]]> <![CDATA[9.55×10 6 ]]> 97.4 2 <![CDATA[1×10 5 ]]> <![CDATA[9.33×10 4 ]]> 93.3 3 <![CDATA[1×10 4 ]]> <![CDATA[1.04×10 4 ]]> 104.7 4 <![CDATA[1×10 3 ]]> <![CDATA[1.02×10 3 ]]> 102.3 5 <![CDATA[1×10 2 ]]> <![CDATA[9.77×10 1 ]]> 97.7

[0173] (6) Stability test

[0174] By comparing the probes stored at 4°C for 10, 20, and 30 days with the freshly synthesized probes, the -1 The Raman Mapping spectrum at 400 nm was used to evaluate the stability of the SERS probe. Although the SERS intensity decreased slightly at the same concentration, the change was not significant ( Fig. 27 ). This finding indicates that the SERS probe has good temporal stability.

[0175] Example 5 Reliability of Digital-SERS Microfluidic Platform in Cells

[0176] (1) Construction of cell model

[0177] Cell culture: HK2 human renal tubular epithelial cells were purchased from Wuhan Pronocell Life Science Co., Ltd. Human renal tubular epithelial cells were cultured in a standardized manner in an incubator at 37°C and 5% CO2, using high-glucose DMEM medium supplemented with 1% double antibody and 10% fetal bovine serum to ensure a good growth environment for the cells. When the cells almost fill the entire culture bottle, cell subculture is performed.

[0178] According to the literature, after inflammation occurs in renal tubular epithelial cells, the mitochondria of the cells will be damaged, resulting in the leakage of mitochondrial DNA. Cells were used to simulate the microenvironment after AKI, and the cell supernatant was taken for cell experiments to verify the reliability of the Digital-SERS microfluidic platform. Human renal tubular epithelial cells were standardized in an incubator at 37°C and 5% CO2. High-glucose DMEM medium was used and supplemented with 1% double antibody and 10% fetal bovine serum to ensure a good growth environment for the cells. When the cells almost fill the entire culture bottle, the cells were subcultured. HK-2 cells were cultured in six-well plates, 10ug / ml LPS was used for modeling, and incubated at 37°C. Five groups were designed according to the incubation time, namely 0h, 3h, 6h, 12h, and 24h.

[0179] (2) Characterization of cell models - mitochondrial membrane potential detection experiment

[0180] Mitochondria are not only the place where energy is produced in cells, but they are also closely related to neurodegenerative diseases such as cancer, aging, Alzheimer's disease, Parkinson's disease, etc. Therefore, research on the state of mitochondria is very important, and changes in mitochondrial membrane potential are often detected as one of the important indicators. When mitochondria are normal and the membrane potential difference remains unchanged, JC-1 will aggregate and emit red fluorescence, and when the membrane potential decreases, JC-1 will exist as a monomer and emit green fluorescence. Changes in red and green fluorescence intensity can be used as an indicator to detect the state of mitochondria.

[0181] Mitochondrial membrane potential detection: refer to the instructions to dilute JC-1 powder into working solution and dispense it, DMSO 1mg / ml or other concentrations. HK-2 cells were cultured in six-well plates, 10ug / ml LPS modeling was performed, incubated at 37°C, and 5 groups were designed according to the incubation time, namely 0h, 3h, 6h, 12h, and 24h. After the stimulation, the culture medium was discarded, and the cells were washed with PBS 2-3 times. JC-1 working solution was added to the complete culture medium at a concentration of 10ug / ml, and then 2ml of culture medium was added to the six-well plate. The cells were incubated at 37°C for 30min, washed with PBS 2-3 times, discarded PBS, and 2ml of complete culture medium was added. The control group was not modeled, and the rest was the same. Then the cells were observed under a fluorescence confocal microscope (Green: Ex 488nm / Em 500-550nm; Red: Ex 561nm / Em 560-610nm; scale: 20μm). Figure 28-29 The results showed that as the modeling time prolonged, the mitochondrial damage of renal tubular epithelial cells worsened.

[0182] (3) Study on the expression level of cellular inflammatory factors

[0183] qPCR detection: The detection process first concentrates the urine and takes the urine supernatant after centrifugation. qPCR is performed on the ABI Prism 7900HT system (Applied Biosystems, Foster City, CA, USA) using a DNA fluorescent quantitative PCR kit (staining method). The process includes preparing a qPCR reaction mixture, which includes forward and reverse primers specific to the target mitochondrial DNA, fluorescent dyes, and other necessary reagents. The PCR reaction conditions are then optimized, usually including an initial denaturation step, followed by a series of cycles consisting of denaturation, annealing, and extension steps. Amplification data is collected in real time to quantify the target DNA in the sample. After qPCR is completed, the amplification results are analyzed by relative quantification (ΔCt method) or absolute quantification according to the experimental design.

[0184] HK2 human renal tubular epithelial cells were cultured overnight in a six-well plate. One group of cells was treated with LPS and cultured for 24 hours, while the other group of cells was not treated as a blank group. The cells were collected and placed on ice, and protein lysis buffer was added and pipetted. After the pipetting was completed, the cells were aspirated into a centrifuge tube and centrifuged (12000g, 4℃, 10min). The precipitate was discarded and the supernatant was taken. The protein level was evaluated using an ELISA kit. The results are shown in Fig.30 The results showed that the pro-inflammatory factor IL-1( Fig.30 A) and TNF-α ( Fig.30 B) The expression level was significantly increased compared with the blank group.

[0185] (4) qPCR for detection of COX III

[0186] qPCR was performed on the QuantStudioTM 3 system (Applied Biosystems, Foster City, CA, USA) using a DNA fluorescent quantitative PCR kit (staining method). The process involves preparing a qPCR reaction mixture that includes forward and reverse primers specific for the target DNA, fluorescent dyes, and other necessary reagents. The PCR reaction conditions are then optimized, typically including an initial denaturation step, followed by a series of cycles consisting of denaturation, annealing, and extension steps. A series of target solutions of known concentrations are first prepared, and PCR is performed for each concentration, with amplification data collected in real time to quantify the target DNA in the sample ( Fig.31 A). After qPCR is completed, according to the experimental design, the relative quantitative method (ΔCt method) is used to analyze the amplification results to generate an amplification curve, and a standard curve is drawn according to the CT value ( Fig.31 B), under the same conditions, the corresponding CT values ​​were obtained from the amplification curves of the cell supernatants from 0h to 24h of LPS modeling ( Fig.31 C), and the target DNA concentration of the cell supernatant at each modeling time was obtained by substituting it into the standard curve formula ( Fig.31 D).

[0187] (5) SERS imaging for detection of COX III

[0188] In order to verify the reliability of the prepared biosensor, the present invention compared qPCR with the biosensor in the cell model. The cell supernatant of the cell LPS modeling time from 0h to 24h was added to the platform for detection. As the modeling time increased, the number of positive droplets also increased ( Fig.32 ). After linear regression and qPCR detection, the correlation coefficient (R 2 )>0.99, the relative expression of COX III detected by qPCR was highly consistent with the results of the developed biosensor ( Fig.33 ). These results demonstrate that the Digital-SERS microfluidic platform can be used as an alternative method for COX III detection and has good potential for clinical application.

[0189] Example 6 Clinical Experiment Verification of the Reliability of the Digital-SERS Microfluidic Platform

[0190] (1) Collection of clinical samples

[0191] Urine samples from 1 healthy person and 4 AKI patients were collected from the First Affiliated Hospital of Hainan Medical College. 3-5 ml of urine was collected from each study subject between 7:00 and 8:00 am after a 12-hour fast. Each sample was centrifuged at 3000 rpm for 5 minutes to separate the urine, and the supernatant was collected and stored at -80 °C for use. Informed consent was obtained from all participants. The study protocol, including blood collection procedures and handling of human samples, was reviewed and approved by the Institutional Review Board (IRB) of Hainan Medical University. This study was conducted in accordance with the Declaration of Helsinki and adhered to the highest ethical standards to ensure the protection of the rights and welfare of the participants.

[0192] (2) Optimization of magnesium ion concentration

[0193] To determine the detection limit of the COX III gene using the Digital-SERS microfluidic platform, the present invention added COX III target DNA into synthetic urine and studied how this clinically relevant environment affects the activity of Cas12a.

[0194] Digital-SERS microfluidic platform for detection of COX III target DNA with a detection limit of 13 mM Mg 2+ Concentrations in urine are as low as 10 fM, and at 3 mM Mg 2+ The detection limit was 100 fM ( Fig.34 ). Therefore, by combining the Cas12a trans-cleavage reaction with increased Mg 2+ Combined with the ion concentration, based on the limit of detection calculation, the present invention achieves an approximately 10-fold sensitivity improvement.

[0195] (3) qPCR detection for COX III detection

[0196] The detection process first concentrates the urine, and then collects the urine supernatant after centrifugation. qPCR is performed on the ABIPrism 7900HT system (Applied Biosystems, Foster City, CA, USA) using a DNA fluorescent quantitative PCR kit (staining method). The process includes preparing a qPCR reaction mixture, which includes forward and reverse primers specific to the target COXⅢ gene target DNA, fluorescent dyes, and other necessary reagents. The PCR reaction conditions are then optimized, usually including an initial denaturation step, followed by a series of cycles consisting of denaturation, annealing, and extension steps. First, a series of target solutions of known concentrations were prepared, and PCR was performed on each concentration ( Fig.35 A), collect amplification data in real time to quantify the target DNA in the sample. After qPCR is completed, according to the experimental design, the amplification results are analyzed by relative quantification method (ΔCt method) to generate an amplification curve, and a standard curve is drawn according to the CT value ( Fig.35 B), under the same circumstances, the corresponding CT value is obtained from the amplification curve of each clinical urine sample ( Fig.35 C), and the target DNA concentration of each clinical sample was calculated according to the standard curve formula ( Fig.35 D).

[0197] (4) SERS imaging for detection of COX III

[0198] In order to verify the reliability of the prepared biosensor, the present invention compared qPCR with the biosensor in clinical samples. Urine samples of healthy patients and different AKI patients were added to the platform for detection. With the different conditions of the patients (such as patient 1, no abnormalities were found in the renal color Doppler ultrasound, but according to the international AKI diagnostic criteria (creatinine changes within 48 hours) combined with blood tests, it was diagnosed as AKI; patient 2's renal color Doppler ultrasound showed increased echogenicity of the renal parenchyma, combined with blood tests diagnosed as AKI; patient 3's renal color Doppler ultrasound showed increased echogenicity of the renal parenchyma and bilateral renal cysts, combined with blood tests diagnosed as AKI; patient 4's renal color Doppler ultrasound showed bilateral renal cysts, combined with blood tests diagnosed as AKI), the number of positive droplets also changed. By linear regression, combined with qPCR detection, the correlation coefficient (R 2 )>0.99( Fig.37 ), the relative expression of COX III detected by qPCR was highly consistent with the results of the developed biosensor ( Fig.36 ). These results demonstrate that the Digital-SERS microfluidic platform can be used as an alternative method for COX III detection and has good potential for clinical application.

[0199] (5) Detection of COX III in artificial urine

[0200] In order to evaluate the clinical feasibility of the method proposed in the present invention, different concentrations of urine were artificially prepared (30 groups of different concentrations), and the standard curve established by qPCR was compared with the Digital-SERS microfluidic platform. According to the software analysis, the correlation coefficient (R 2 )>0.99( Fig.38 ). Compared with the PCR method, the Digital-SERS microfluidic platform shows a fairly high reliability in consistency analysis. And compared with the traditional PCR method and other technologies, the constructed biosensor has a faster detection time and simpler operation. These characteristics give the sensor a wide range of application prospects, especially in clinical diagnosis and status monitoring.

Claims

1. A digital nucleic acid detection platform based on SERS, characterized in that: Including microfluidic chip, SERS probe, Cas12a, crRNA and Raman signal detector; The SERS probe is formed by Au@DNA and MB@BiotinDNA through base pairing; The microfluidic chip is provided with a droplet generation area, a droplet electrode fusion area, a liquid storage tank, a magnetic separation area and a detection tank which are distributed in sequence and interconnected with each other. The droplet generation area is used to divide the sample to be tested into a plurality of droplets. If the sample to be tested contains target DNA, some or all of the droplets contain target DNA; the droplet electrode fusion area is provided with a channel for adding the SERS probe, Cas12a and crRNA, and the outlet end of the channel is a fusion port, at which the SERS probe, Cas12a and crRNA are fused with the droplet; the Cas12a can form a binary complex with the crRNA to capture the target DNA in the droplet, and form a ternary complex to cut the SERS probe, and cut and separate the Au@DNA and the MB@BiotinDNA; The magnetic separation zone is used to separate the MB@BiotinDNA after cleavage and the SERS probe that has not been cleaved from the droplet; The detection pool is used to place the separated droplets; The Raman signal detector is used to detect the Raman signal of each droplet in the detection pool.

2. The nucleic acid detection platform according to claim 1, characterized in that: The incision size of the droplet generation area is 20-30 μm, and the fusion opening size of the droplet electrode fusion area is 40-60 μm.

3. The nucleic acid detection platform according to claim 1, characterized in that: Two empty PDMS channels are arranged next to the droplet electrode fusion zone, and the PDMS channels are filled with saturated sodium chloride solution to form two electrodes to provide an electric field for the droplet electrode fusion zone.

4. The nucleic acid detection platform according to claim 1, characterized in that: The outlet end of the liquid storage tank is tapered.

5. The nucleic acid detection platform according to claim 1, characterized in that: In the SERS probe, there are at least 10 complementary base pairs on the Au@DNA and the MB@BiotinDNA.

6. The method for preparing the nucleic acid detection platform according to any one of claims 1 to 5, characterized in that: The following steps are involved: (A) Construction of SERS probe 1) Synthesis of AuNPs: Add sodium citrate solution to a container, stir and heat until boiling, add HAuCl4 solution, cool to 80°C to 95°C after the reaction is completed; add sodium citrate solution and HAuCl4 solution in sequence, and repeat several times; after all the solutions are added, continue to maintain 80°C to 95°C for 20 to 40 minutes, then cool to room temperature to obtain a gold nanoparticle solution, i.e., AuNPs, which is stored for later use; 2) Synthesis of Au@MGITC: The obtained gold nanoparticle solution was mixed with the Raman reporter molecule MGITC, stirred, centrifuged, and the supernatant was discarded and resuspended to prepare AuNPs@MGITC; 3) Construction of Au@DNA: AuNPs@MGITC was mixed with DNA probe 1, microwave-treated, washed, centrifuged, and the supernatant was discarded and resuspended to obtain Au@DNA bound to Raman reporter molecules, which was stored for later use; 4) Construction of MB@BiotinDNA: Magnetic beads modified with streptavidin on the surface were mixed with DNA probe 2, oscillated for suspension, incubated at room temperature, centrifuged, and the supernatant was removed to obtain MB@BiotinDNA; 5) Construction of SERS probe: The obtained Au@DNA and MB@BiotinDNA were mixed, stirred, centrifuged to remove the supernatant, and washed to obtain the SERS probe; (B) Preparation of microfluidic chip 1) Printing a mask: Printing a designed mask pattern to obtain a mask; the mask pattern is provided with a droplet generation area, a droplet electrode fusion area, a liquid storage tank, a magnetic separation area and a detection tank; 2) Photolithography of silicon wafer: After the silicon wafer is pre-treated, coated and baked, the printed mask is placed on the photolithography machine, the mask and silicon wafer are adsorbed, and photolithography is started. The pattern is transferred to the photoresist through the mask pattern; then the mask and silicon wafer are separated, the silicon wafer is further baked, and then developed, cleaned and dried to obtain a silicon wafer with photolithography patterns; 3) PDMS chip production: PDMS is mixed with a curing agent, dried and degassed until there are no bubbles, and degassed PDMS is obtained; a silicon wafer with a photolithographic pattern is placed flat on a clean vacuum plate, and the degassed PDMS is poured on it, and it is degassed and cured again; after cooling, the PDMS is peeled off from the silicon wafer, and the PDMS is cut and punched to form a droplet generation area, a droplet electrode fusion area, a liquid storage tank, a magnetic separation area and a detection tank that are connected in sequence, and the droplet generation area is provided with a sample injection hole and an oil inlet hole, and the droplet electrode fusion area is provided with a probe hole; the PDMS and the glass slide are washed, dried, cooled, and placed in a plasma cleaning machine for treatment; then the PDMS is bonded to the glass slide and baked to solidify to obtain a microfluidic chip; (C) The sample inlet, oil inlet and probe hole of the obtained microfluidic chip are respectively connected to the corresponding injection pumps through connecting tubes or hoses, wherein the SERS probe is transported to the droplet electrode fusion area through the probe hole.

7. Use of the nucleic acid detection platform according to any one of claims 1 to 5 in detecting the concentration of target DNA in a sample.

8. Use of the nucleic acid detection platform according to any one of claims 1 to 5 in detecting biomarkers for early diagnosis of acute kidney injury.

9. The use according to claim 8, characterized in that: The biomarker includes the COX III gene; the sequence of the crRNA is shown in SEQ ID NO.1; the sequence of the DNA in the Au@DNA is shown in SEQ ID NO.2, and the sequence of the DNA in the MB@BiotinDNA is shown in SEQ ID NO.

3.

10. The use according to claim 9, characterized in that: During the detection, magnesium ions with a final concentration of 10-15 mM are added to the sample to be tested.

Images