Method for detecting human PEAR1 gene mutation

Abstract

The invention discloses a method for detecting human PEAR1 gene mutation, which comprises the following steps: S1, DNA extraction, S2, primer design, S3, PCR amplification and S4, electrophoretic separation, and relates to the technical field of biology. According to the method for detecting human PEAR1 gene mutation, high-accuracy ticagrelor precise medication gene detection is achieved through Sanger sequencing method detection, cardiovascular events can be pre-judged, and therefore individualized anti-platelet treatment is adopted, and precise treatment is achieved.

Description

Technical Field

[0001] The invention relates to the field of biotechnology, and in particular to a method for detecting human PEAR1 gene mutation. Background Art

[0002] As a standard drug for antiplatelet therapy, ticagrelor is an antiplatelet drug that works by inhibiting platelet activation and aggregation via the fibrinogen receptor pathway. It is widely used and can reduce myocardial infarction, sudden cardiac death, and stroke in high-risk patients. Ticagrelor is widely used in antiplatelet therapy for patients with acute coronary syndrome because it has a stronger P2Y12 receptor inhibitory effect than clopidogrel. However, the incidence of dyspnea during use of ticagrelor is 13.8%-56%, and the resulting discontinuation rate is 0.9%-6.5%. Studies have shown that PEAR1 (c.-9-3996G>A) is associated with adverse reactions to ticagrelor, and AA / AG patients may increase cardiovascular risk or death after taking ticagrelor.

[0003] Conducting genetic testing for precise medication of ticagrelor can predict cardiovascular events, thereby taking individualized antiplatelet therapy and achieving precise treatment. Therefore, the present application provides a method for detecting human PEAR1 gene mutations. Summary of the invention

[0004] 1. Technical issues to be resolved

[0005] In view of the deficiencies of the prior art, the present invention provides a method for detecting human PEAR1 gene mutations, which solves the problem that PEAR1 is associated with adverse reactions of ticagrelor, resulting in increased cardiovascular risk or death in patients after taking ticagrelor.

[0006] (II) Technical solution

[0007] To achieve the above objectives, the present invention is implemented by the following technical scheme: A method for detecting human PEAR1 gene mutations, comprising the following steps:

[0008] S1. DNA extraction: First, blood was drawn and cut into small fragments. Then, the nucleic acid extraction reagent was used to extract the genomic DNA from the blood into the kit. The DNA in the blood was extracted according to the standard operation method of the kit. The DNA extracted from all the tested samples was tested by the Thermo Scientifi Multiskango for concentration and purity, and then the OD was measured. 260 / 280 Between 1.8 and 2.0.

[0009] S2. Primer design: According to the location of the detection site in the genome, the reference sequence was obtained from the NCBI database, and the primers were designed for the reference sequence using Oligo7 software.

[0010] Primers were designed as follows: PEAR1-I1-F: 5'GGAAGCACTAATCTTATCCCCAT3'; PEAR1-I1-R: 5'GCCCACACAGAAGACCAGA3'. The primers were verified for primer specificity using the Primer-BLAST function in the NCBI database.

[0011] S3, PCR amplification, the primers need to be verified for experimental specificity after synthesis, using HSDNAPolymerase performs PCR amplification and enrichment on the extracted genomic DNA, and the steps are as follows;

[0012] ① Denaturation: heating breaks the hydrogen bonds of the DNA double helix, causing the double helix to dissociate into single-stranded DNA;

[0013] ② Annealing: When the temperature is suddenly lowered, since the template molecule structure is much more complex than the primer, the amount of primer DNA in the reaction system is much greater than that of the template DNA, so that the primer and its complementary template form a hybrid chain locally;

[0014] ③ Extension: In the presence of DNA polymerase, four dNTP substrates and Mg2+, the 5'→3' polymerase catalyzes the DNA chain extension reaction starting from the primer. The above three steps constitute a cycle. The product of each cycle can be used as a template for the next cycle. After a few hours, the specific DNA fragment between the two primers is replicated in large quantities to form a PCR product.

[0015] S4. Electrophoresis separation: the products were electrophoresed using agarose gel of corresponding concentration. The corresponding PCR product bands were consistent with the designed length and the bands were clear and single.

[0016] Preferably, the specific steps of electrophoretic separation in step S4 are as follows:

[0017] First, the PCR product is purified by gel excision using an agarose DNA recovery kit, and each DNA fragment is labeled with a specific fluorescent dye through fluorescent labeling for detection during electrophoresis separation. The brightness of the electrophoresis band of the target fragment amplified by the control system should be observed with the naked eye, and it should not be lower than the standard band brightness of the DNA Marker 5-10ng / uL, indicating that the amplification effect is good.

[0018] Preferably, the sample loading amount for agarose gel electrophoresis in step S4 is not less than 15 uL.

[0019] Preferably, the concentration of each standard band of the DNA Marker is as follows:

[0020] When a certain fragment is 10ng / uL, under the same loading amount, only the target band with brightness equivalent to the standard band is selected for gel tapping and recovery, and the target band with concentration lower than 10ng / uL is not tapped and recovered. In addition, the band brightness is analyzed by the software provided by the gel imaging system or any gel analysis software such as Quantity-one.

[0021] (III) Beneficial effects

[0022] The present invention provides a method for detecting human PEAR1 gene mutation. Compared with the prior art, it has the following beneficial effects:

[0023] This method for detecting human PEAR1 gene mutations can reduce the problem of PEAR1 being associated with adverse reactions to ticagrelor, which may lead to increased cardiovascular risk or death in patients after using ticagrelor, by detecting the PEAR1 gene through Sanger sequencing. BRIEF DESCRIPTION OF THE DRAWINGS

[0024] Figure 1 is an agarose gel electrophoresis diagram of the PEAR1 gene of the present invention;

[0025] Figure 2 This is a schematic diagram of the wild type of BJP2304768 PEAR1 of the present invention;

[0026] Figure 3 Schematic diagram of the BJP2304760 PEAR1 heterozygous mutant of the present invention. DETAILED DESCRIPTION

[0027] The technical solutions in the embodiments of the present invention are described clearly and completely. Obviously, the described embodiments are only part of the embodiments of the present invention, not all of the embodiments. Based on the embodiments of the present invention, all other embodiments obtained by ordinary technicians in this field without creative work are within the scope of protection of the present invention.

[0028] See also Figure 1-3 The embodiment of the present invention provides a technical solution: a method for detecting human PEAR1 gene mutation, S1, DNA extraction, first, blood is drawn by blood drawing and cut into small fragments, and then the blood genomic DNA is extracted into the kit using a nucleic acid extraction reagent, and the DNA in the blood is extracted according to the standard operation method of the kit. The DNA extracted from all the tested samples is tested for concentration and purity by the Thermo Scientifi Multiskango (full wavelength microplate reader), and then the (absorbance ratio) OD is measured.260 / 280 Between 1.8 and 2.0.

[0029] The kit includes two SuperTaq PCR Mixes, forward primer F, reverse primer R, DNA template and Sterile Water.

[0030] The following table shows the components of the kit;

[0031] System composition Addition amount 2×SuperTaq PCR Mix 12.5uL Forward Primer F 1.0uL Reverse primer R 1.0uL DNA template 1.0uL Sterile Water 9.5uL Total volume 25.0uL

[0032] Instructions for use of the kit: Just take an appropriate amount of 2×TaqPCR Mix solution, add template and primers, and add deionized water to make up the volume so that the concentration of the PCRMix solution is 1× for reaction. Please ensure that it is fully dissolved and mixed before use. The operation must be performed on ice. The product contains red dye. After the PCR reaction is completed, the sample can be directly loaded for electrophoresis without adding loading buffer. It can also be purified for subsequent operations such as enzyme digestion, ligation, and fluorescent sequencing.

[0033] S2. Primer design. According to the location of the detection site in the genome, the reference sequence was obtained from the NCBI database. The primers were designed for the reference sequence using Oligo7 software. The primers were designed as follows: PEAR1-I1-F: 5'GGAAGCACTAATCTTATCCCCAT3'; PEAR1-I1-R: 5'GCCCACACAGAAGACCAGA3'. The primers were verified for primer specificity using the Primer-BLAST function in the NCBI database.

[0034] S3, PCR amplification, the primers need to be verified for experimental specificity after synthesis, using HS DNA Polymerase performs PCR amplification and enrichment on the extracted genomic DNA, and the steps are as follows;

[0035] ① Denaturation: heating breaks the hydrogen bonds of the DNA double helix, causing the double helix to dissociate into single-stranded DNA;

[0036] ② Annealing: When the temperature is suddenly lowered, since the template molecule structure is much more complex than the primer, the amount of primer DNA in the reaction system is much greater than that of the template DNA, so that the primer and its complementary template form a hybrid chain locally;

[0037] ③ Extension: In the presence of DNA polymerase, four dNTP substrates and Mg2+, the 5'→3' polymerase catalyzes the DNA chain extension reaction starting from the primer. The above three steps constitute a cycle. The product of each cycle can be used as a template for the next cycle. After a few hours, the specific DNA fragment between the two primers is replicated in large quantities to form a PCR product.

[0038] S4, electrophoresis separation, the product is electrophoresed using agarose gel of corresponding concentration, the corresponding PCR product band is consistent with the designed length and the band is clear and single, the specific steps of electrophoresis separation in step S4 are as follows;

[0039] First, the PCR product is purified by gel cutting using an agarose DNA recovery kit. The sample loading volume for agarose gel electrophoresis is no less than 15uL, and each DNA fragment is labeled with a specific fluorescent dye through fluorescent labeling for detection during electrophoresis separation. The brightness of the electrophoresis band of the target fragment amplified by the control system should be no less than 5-10ng / uL lower than the brightness of the standard band of DNAMarker when observed with the naked eye, indicating that the amplification effect is good. In addition, according to the concentration of each standard band of DNAMarker, when a certain fragment is 10ng / uL, then under the same loading volume, only the target band with the brightness equivalent to the standard band is selected for gel cutting and recovery, and the target band with a concentration lower than 10ng / uL is not cut and recovered. In addition, the band brightness is analyzed by the software provided by the gel imaging system or any gel analysis software such as Quantity-one.

[0040] PCR reaction cycle settings:

[0041]

[0042]

[0043] See also Figure 1 Note: Marker is 2kb; from bottom to top, they are 100bp, 200bp, 500bp, 750bp, 1000bp and 2000bp; Lane 4 is the blank control; Lane 5 is the wild type; Lane 6 is the mutant.

[0044] Sequencing was performed on the machine and the purified samples were used by Applied Biosystems TM BigDye TM Terminator v3.1 Cycle Sequencing Kit (Cat. No. 4337458), followed by BigDye XTerminator TM Purification Kit Protocol (Cat. No.: 4374408), and finally the purified PCR product was sequenced using ABI 3730XL Genetic Analyzer (Cat. No.: A41046) fully automatic sequencer.

[0045] Reaction system:

[0046]

[0047] Reaction temperature:

[0048]

[0049]

[0050] Sequencing results analysis

[0051] The peak diagram of the Sanger sequencing results is clear, the impurity peak does not exceed 20% of the main peak, the peak diagram sequence is consistent with the reference sequence, and the genotype of the detection site can be clearly distinguished without any objection.

[0052] Beneficial effects:

[0053] The Sanger method has high accuracy and is the gold standard for SNP detection.

[0054] The Sanger method is to sequence DNA molecules. Its advantage is that the sequencing results are intuitive and easy to analyze. It is suitable for verification sequencing of known sequences, library screening, clone identification, PCR resequencing, etc.

[0055] Meanwhile, the contents not described in detail in this specification belong to the prior art known to those skilled in the art.

[0056] It should be noted that, in this article, relational terms such as first and second, etc. are only used to distinguish one entity or operation from another entity or operation, and do not necessarily require or imply any such actual relationship or order between these entities or operations. Moreover, the terms "include", "comprise" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device.

[0057] Although embodiments of the present invention have been shown and described, it will be appreciated by those skilled in the art that various changes, modifications, substitutions and variations may be made to the embodiments without departing from the principles and spirit of the present invention, and that the scope of the present invention is defined by the appended claims and their equivalents.

Claims

1. A method for detecting human PEAR1 gene mutation, characterized in that: The following steps are involved: S1. DNA extraction: First, blood was drawn and cut into small fragments. Then, the nucleic acid extraction reagent was used to extract the genomic DNA from the blood into the kit. The DNA in the blood was extracted according to the standard operation method of the kit. The DNA extracted from all the tested samples was tested for concentration and purity by the Thermo Scientific Multiskan go, and then the OD was measured. 260 / 280 Between 1.8 and 2.0; S2. Primer design: According to the location of the detection site in the genome, the reference sequence was obtained from the NCBI database, and the primers were designed for the reference sequence using Oligo7 software. Primers were designed as follows: PEAR1-I1-F: 5′ GGAAGCACTAATCTTATCCCCAT3′; PEAR1-I1-R: 5′ GCCCACACAGAAGACCAGA3′, and primer specificity was verified by Primer-BLAST function in the NCBI database; S3, PCR amplification, the primers need to be verified for experimental specificity after synthesis, and the extracted genomic DNA is PCR amplified and enriched using PrimeSTAR® HS DNA Polymerase, and the steps are as follows; ① Denaturation: heating breaks the hydrogen bonds of the DNA double helix, causing the double helix to dissociate into single-stranded DNA; ② Annealing: When the temperature is suddenly lowered, since the template molecule structure is much more complex than the primer, the amount of primer DNA in the reaction system is much greater than that of the template DNA, so that the primer and its complementary template form a hybrid chain locally; ③ Extension: In the presence of DNA polymerase, four dNTP substrates and Mg2+, the 5'→3' polymerase catalyzes the DNA chain extension reaction starting from the primer. The above three steps constitute a cycle. The product of each cycle can be used as a template for the next cycle. After a few hours, the specific DNA fragment between the two primers is replicated in large quantities to form a PCR product. S4. Electrophoresis separation: The products were electrophoresed using agarose gel of corresponding concentration. The corresponding PCR product bands were consistent with the designed length and the bands were clear and single.

2. A method for detecting human PEAR1 gene mutation according to claim 1, characterized in that: The specific steps of electrophoretic separation in step S4 are as follows: First, the PCR product is purified by gel excision using an agarose DNA recovery kit, and each DNA fragment is labeled with a specific fluorescent dye through fluorescent labeling for detection during electrophoresis separation. The brightness of the electrophoresis band of the target fragment amplified by the control system should be observed with the naked eye, and it should not be lower than the standard band brightness of the DNA Marker 5-10ng / uL, indicating that the amplification effect is good.

3. A method for detecting human PEAR1 gene mutation according to claim 1, wherein the sample loading amount for agarose gel electrophoresis in step S4 is not less than 15uL.

4. A method for detecting human PEAR1 gene mutation according to claim 2, characterized in that: The concentrations of the standard bands of the DNAMarker are as follows: When a certain fragment is 10ng / uL, under the same loading amount, only the target band with brightness equivalent to the standard band is selected for gel tapping and recovery, and the target band with concentration lower than 10ng / uL is not tapped and recovered. In addition, the band brightness is analyzed by the software provided by the gel imaging system or any gel analysis software such as Quantity-one.

Images