Prostate cancer detection method and kit based on exosome RNA

Abstract

The invention provides a prostate cancer detection method and kit based on exosome RNA, and the method comprises the following steps: preparing nano-scale cationic lipid particles coated with RNA molecular beacons, each RNA molecular beacon is combined with a corresponding target exosome to generate fluorescence, and the fluorescence is used for detecting the prostate cancer. The target exosome is allowed to be one or more of the following exosomes in the urine: miR-141, miR-375, PCA3 and T1-E2; a porous chip plate is coated with an exosome capture system and nanoscale cationic lipid particles to form the detection kit; the exosome capturing system is used for capturing exosomes; a to-be-detected sample is pretreated, the pretreated to-be-detected sample is added into the kit, and whether a subject suffers from the prostate cancer or not is judged according to a fluorescence imaging result of the kit; wherein the to-be-detected sample at least comprises urine of a subject, non-invasive detection of prostatic cancer can be realized, the detection cost is low, the time is short, and the cost is relatively low.

Description

Technical Field

[0001] The present application relates to the field of disease detection, and in particular to a prostate cancer detection method and kit based on exosome RNA. Background Art

[0002] Prostate cancer (PCa) is the most common malignant tumor of the urinary system worldwide, the fifth leading cause of cancer death in men, and the malignant tumor with the fastest increasing incidence and mortality rate in China in recent years. Early diagnosis of cancer is a diagnostic and treatment method specifically for early cancer subjects. Its purpose is to detect and treat early, thereby reducing the pain and mental and economic burden of the subjects, and strive to make cancer subjects recover as soon as possible through early diagnosis and treatment of cancer. Clinical diagnosis of prostate cancer mainly relies on rectal digital examination, serum PSA, transrectal prostate ultrasound and pelvic MRI examination. Prostate puncture biopsy is required for pathological examination to confirm prostate cancer. Overall, the early diagnosis method of prostate cancer, which mainly relies on imaging and pathological biopsy, has a high detection rate. However, due to the hidden symptoms of prostate cancer, most subjects are already in the middle and late stages when diagnosed. However, the cure rate of early prostate cancer can reach 80%, while the cure rate of middle and late prostate cancer is only 10% to 20%. In addition, cell and tissue pathology detection requires puncture or surgery to obtain tumor tissue samples from the subjects, which is not only inconvenient, but also causes human harm to the subjects. Summary of the invention

[0003] The embodiments of the present application provide a prostate cancer detection method and kit based on exosome RNA, which has fast detection speed, low cost and is easy for clinical application.

[0004] In a first aspect, the present application provides a method for detecting prostate cancer based on exosome RNA, the method comprising:

[0005] S1: preparing nano-scale cationic lipid particles encapsulating RNA molecular beacons, wherein the RNA molecular beacons are of multiple types, each of which generates fluorescence after binding to a corresponding target exosome, and the target exosome is allowed to be one or more of the following exosomes in urine: miR-141, miR-375, PCA3, T1-E2;

[0006] S2: coating an exosome capture system and the nanoscale cationic lipid particles on a porous chip plate to form a detection kit; the exosome capture system is used to capture exosomes;

[0007] S3: pre-treating the sample to be tested, adding the pre-treated sample to the kit, and judging whether the subject suffers from prostate cancer according to the fluorescence imaging result of the kit; wherein the sample to be tested at least includes urine of the subject.

[0008] In some embodiments, the target exosomes are also allowed to be one or more of the following exosomes in the blood: miR-141, miR-375, Let-7c; and the sample to be tested also includes the blood of the subject.

[0009] In some embodiments, the exosome capture system is streptavidin-biotin-exosome specific antibody; the exosome capture system coated on the multi-well chip plate comprises:

[0010] The chip plate bottom substrate of the porous chip plate is activated and functionalized, and streptavidin is immobilized on the porous chip plate; the exosome-specific antibody is connected with biotin, and the exosome-specific antibody is coated on the porous chip plate; wherein the exosome-specific antibody is at least allowed to be a CD63 capture antibody.

[0011] In some embodiments, the RNA molecular beacon includes a fluorescent group and a quenching group; the fluorescent group includes at least one or more of the following: Texas Red, fluorescein, rhodamine B, fluorescent dye Cy5, fluorescent dye Cy3, methylene blue, fluorescein-5-isothiocyanate, indole orange, and fluorescein-5-acetate; different types of the RNA molecular beacons carry different fluorescent groups to distinguish the captured target exosomes; after the exosome capture system captures the exosomes, the negatively charged nanoscale cationic lipid particles and the positively charged exosomes undergo lipid membrane fusion, and the encapsulated RNA molecular beacons contact the exosomes; if the RNA molecular beacon hybridizes with the captured exosomes, the stem-loop structure in the RNA molecular beacon opens, and the fluorescent group and the quenching group separate to generate fluorescence; if the RNA molecular beacon does not hybridize with the captured exosomes, the positions of the fluorescent group and the quenching group remain unchanged to maintain fluorescence quenching.

[0012] In some embodiments, judging whether the subject has prostate cancer according to the fluorescence imaging results of the kit specifically includes:

[0013] The kit is imaged using a total internal reflection fluorescence microscope to generate an image to be processed; the image to be processed is input into a preset fluorescence image analysis model, and whether the subject has prostate cancer is confirmed based on the feedback result of the preset fluorescence image analysis model.

[0014] In some embodiments, the method further comprises:

[0015] A plurality of training samples are prepared, and the source subjects of the training samples are known to have prostate cancer; the training samples are added to the kit, and the kit is imaged using a total internal reflection fluorescence microscope to generate a plurality of training images; an initial image model is trained using the plurality of training images to generate the preset fluorescence image analysis model.

[0016] In some embodiments, if the sample to be tested is blood, the pretreatment specifically includes: obtaining a serum sample from the blood; centrifuging the serum sample at 300g for 10 minutes, and continuing to centrifuge the serum sample at 2000g for 10 minutes, then adding the obtained sample to an extractor for extraction and purification, and then resuspending it with PBS to form a pretreated sample to be tested;

[0017] If the sample to be tested is urine, the pretreatment includes:

[0018] (1) Centrifuge at 300 g for 10 minutes to remove cell debris and transfer the supernatant to a new centrifuge tube; continue centrifuging at 2000 g for 10 minutes to remove cell debris and transfer the supernatant to a new centrifuge tube; continue centrifuging at 10000 g for 30 minutes to further remove large particles and debris and retain the supernatant;

[0019] (2) The supernatant was directly ultrafiltered using a 100 kDa ultrafiltration membrane to concentrate the volume to 1 / 10 of the original volume;

[0020] (3) The concentrated solution was added to a PEG precipitator, mixed with an equal volume of 8% PEG, and incubated in a refrigerator at 4°C for 2 hours;

[0021] (4) Transfer the incubated solution to an appropriate centrifuge tube and centrifuge at 10,000 × g for 30 minutes. After centrifugation, carefully discard the supernatant and retain the precipitate;

[0022] (5) Wash the precipitate 1 to 2 times with phosphate buffered saline (PBS), and then resuspend it with 100 to 200 μL of PBS to form a pre-treated sample to be tested.

[0023] In some embodiments, the sample to be tested is also allowed to be a cell culture fluid; the pretreatment of the cell culture fluid is the same as the pretreatment of the urine;

[0024] or,

[0025] The cell culture fluid is pretreated by ultracentrifugation, and then the obtained precipitate is resuspended with PBS to form the pretreated sample to be tested.

[0026] In a second aspect, the present application embodiment provides a prostate cancer detection kit based on exosome RNA, wherein the prostate cancer detection kit comprises:

[0027] Multi-well chip board;

[0028] An exosome capture system coated on the multi-well chip plate; the exosome capture system is used to capture exosomes;

[0029] Nanoscale cationic lipid particles coated on the porous chip plate; the nanoscale cationic lipid particles are coated with nanoscale cationic lipid particles with RNA molecular beacons, the RNA molecular beacons are of multiple types, each RNA molecular beacon generates fluorescence after binding with the corresponding target exosomes, and the target exosomes are allowed to be one or more of the following exosomes in urine: miR-141, miR-375, PCA3, T1-E2.

[0030] In some embodiments, the target exosomes are also allowed to be one or more of the following exosomes in the blood: miR-141, miR-375, Let-7c.

[0031] The embodiments of the present application provide a prostate cancer detection method and kit based on exosome RNA. The detection object can be the urine of the subject, thereby realizing non-invasive detection of prostate cancer; alternatively, the detection object can be the blood and urine of the subject, with high detection sensitivity, low overall detection cost, short time and low cost. BRIEF DESCRIPTION OF THE DRAWINGS

[0032] Figure 1 A schematic diagram of the process of the prostate cancer detection method provided by the present application is shown;

[0033] Figure 2 A schematic diagram of the structure after the porous chip plate provided by the present application is combined with exosomes is shown;

[0034] Figure 3 A schematic diagram of the fusion process of nanoscale cationic lipid particles and exosomes provided by the present application is shown;

[0035] Figure 4 The fluorescence characterization result diagram after the fusion of exosomes and nano-scale cationic lipid particles provided by the present application is shown;

[0036] Figure 5 An electron microscope image of the fusion process of exosomes and nano-scale cationic lipid particles provided by the present application is shown;

[0037] Figure 6 A schematic diagram showing the process of the prostate cancer detection method provided by the present application is shown;

[0038] Fig. 7AA comparison of the expression intensity of blood exosome RNA of the training cohort is shown;

[0039] Figure 7B A comparison of the detection performance of blood exosome RNA in the training cohort is shown;

[0040] Fig. 8A A comparison of the expression intensity of urine exosome RNA in the training cohort is shown;

[0041] Figure 8B A comparison of the detection performance of urine exosome RNA in the training cohort is shown;

[0042] Fig. 9 The detection performance diagram of the three blood exosomes screened in the validation cohort is shown;

[0043] Fig.10 The detection performance diagrams of the serum PSA group, the three blood exosome combination groups and the comprehensive group for prostate cancer are shown;

[0044] Fig.11 The performance graph of the assay for the four urinary exosomes screened in the validation cohort is shown;

[0045] Fig.12 The detection performance diagrams of the serum PSA group, the combined group of four urine exosomes and their comprehensive group for prostate cancer are shown. DETAILED DESCRIPTION

[0046] The technical solutions in the embodiments of the present application will be described clearly and completely below in conjunction with the accompanying drawings in the embodiments of the present application. It is to be understood that the specific embodiments described herein are only used to explain the related applications, rather than to limit the present application. It should also be noted that, for ease of description, only the parts related to the related applications are shown in the accompanying drawings.

[0047] Unless otherwise defined, all technical and scientific terms used herein have the same meaning as those commonly understood by those skilled in the art to which this application belongs. The terms used herein are only for the purpose of describing the embodiments of this application and are not intended to limit this application.

[0048] In the following description, reference is made to “some embodiments”, which describe a subset of all possible embodiments, but it will be understood that “some embodiments” may be the same subset or different subsets of all possible embodiments and may be combined with each other without conflict.

[0049] The embodiments of the present application will be described in detail below with reference to the accompanying drawings.

[0050] Embodiment 1:

[0051] See also Figure 1 , which provides a schematic flow chart of a prostate cancer detection method based on exosomal RNA. Figure 1 As shown, the method includes:

[0052] Step S1: preparing nano-sized cationic lipid particles encapsulating RNA molecular beacons.

[0053] It should be noted that there are many types of RNA molecular beacons, and each RNA molecular beacon generates fluorescence after binding to the corresponding target exosome.

[0054] It should be noted that RNA molecular beacon is a fluorescently labeled oligonucleotide chain. It generally includes the following three parts: ① Ring region: composed of 15 to 30 nucleotides that can specifically bind to the target molecule; ② Stem region: generally composed of 5 to 8 base pairs that can undergo reversible dissociation; ③ Fluorescent group and quenching group: The two ends of the RNA molecular beacon are labeled with fluorescent group and quenching group respectively. When there are no target exosomes, the fluorescent group and quenching group of the RNA molecular beacon are very close, and the fluorescence is quenched. After binding to the target exosomes, the spatial configuration of the RNA molecular beacon changes, resulting in fluorescence recovery.

[0055] Specifically, the target exosomes are allowed to be one or more of the following exosomes in urine: miR-141, miR-375, PCA3, T1-E2.

[0056] Among them, the specific sequence of miR-141 is (5' to 3'): UAGCAGCACGUAGUAGUUUGGUU; the specific sequence of miR-375 is (5' to 3'): UAGCAGCACGUAGUAGUUGGUU; PCA3 is a longer lncRNA molecule, and its complete sequence is usually longer (about 1.6kb), and its NCBI accession number is as follows: NCBI Reference Sequence: NR_132312.2; T1-E2: represents the mRNA transcript of the TMPRSS2-ERG fusion gene (T1 refers to exon 1 of TMPRSS2, E2 refers to exon 2 of the ERG gene, and the two are fused), CB I accession number: GenBank: EU432099.1.

[0057] It should also be noted that the fluorescent group is allowed to be one or more of the following: Texas Red, fluorescein, rhodamine B, fluorescent dye Cy5, fluorescent dye Cy3, methylene blue, fluorescein-5-isothiocyanate, indole orange, fluorescein-5-acetate; RNA molecular beacons for different exosomes (i.e., different types of RNA molecular beacons) carry different fluorescent groups, and the captured exosomes can be distinguished by fluorescent color after fluorescence imaging.

[0058] It should be noted that nano-sized cationic lipid particles are usually composed of ionizable cationic lipids, phospholipids, cholesterol or cholesterol derivatives and possible polyethylene glycol (PEG)-lipids, and have positively charged surfaces, good biocompatibility and stability, and efficient gene or drug delivery capabilities. Nano-sized cationic lipid particles can be prepared by thin film hydration, ethanol injection or microemulsion methods. They are already commercially available.

[0059] In a specific embodiment, each nanoscale cationic lipid particle encapsulates only one RNA molecular beacon. For example, some nanoscale cationic lipid particles encapsulate RNA molecular beacons targeting miR-141, and other nanoscale cationic lipid particles encapsulate RNA molecular beacons targeting miR-375.

[0060] or,

[0061] In another specific embodiment, each nano-scale cationic lipid particle can encapsulate a variety of RNA molecular beacons. For example, the nano-scale cationic lipid particle encapsulates RNA molecular beacons for miR-141 and RNA molecular beacons for miR-375. At this time, different RNA molecular beacons need to be labeled with different fluorescence, and the corresponding fluorescence channels of different wavelengths are detected during detection.

[0062] Step S2: coating an exosome capture system and nano-scale cationic lipid particles on a porous chip plate to form a detection kit; the exosome capture system is used to capture exosomes.

[0063] Here, the multi-hole chip plate can be in specifications of 8, 24, 96, 384, etc.

[0064] It should be noted that the exosome capture system is streptavidin-biotin-exosome specific antibody. Here, the exosome specific antibody is at least allowed to be a CD63 capture antibody. Figure 2 The structure of the test kit after mixing with exosomes is shown. The functionalized glass refers to the bottom of the multi-well chip plate, and the exosome-specific antibodies on it are used to bind to the exosomes in the sample to be tested. After the exosomes are captured by the exosome capture system, the negatively charged nano-scale cationic lipid particles fuse with the positively charged exosomes. For details, please refer to Figure 3 , after lipid membrane fusion, the RNA molecular beacons encapsulated by nanoscale cationic lipid particles come into contact with the captured exosomes.

[0065] See also Figure 4If the RNA molecular beacon hybridizes with the captured exosomes (i.e., the captured exosomes contain the target RNA), the stem-loop structure in the RNA molecular beacon opens, and the fluorescent group and the quenching group separate to generate fluorescence; if the RNA molecular beacon does not hybridize with the captured exosomes (i.e., the captured exosomes do not contain the target RNA), the positions of the fluorescent group and the quenching group remain unchanged and the fluorescence is quenched.

[0066] See also Figure 5 , which shows the various stages of fusion of nanoscale cationic lipid particles with exosomes under electron microscopy.

[0067] Accordingly, the aforementioned “coating of an exosome capture system on a porous chip plate” specifically includes:

[0068] S21: activating and functionalizing the chip plate bottom substrate of the multi-well chip plate, and immobilizing streptavidin on the multi-well chip plate.

[0069] S22: using biotin to link exosome-specific antibodies, and coating the exosome-specific antibodies on a multi-well chip plate.

[0070] In this way, Figure 5 As shown, for the multi-well chip plate that simultaneously encapsulates the exosome capture system and the nano-scale cationic lipid particles, after the exosome capture system captures the exosomes, the RNA molecular beacon inside the nano-scale cationic lipid particles is used to confirm whether it is the target exosome.

[0071] Step S3: pre-treat the sample to be tested, add the pre-treated sample to the test kit, and determine whether the subject has prostate cancer based on the fluorescence imaging results of the kit.

[0072] In this embodiment, the sample to be tested at least includes urine of the subject.

[0073] It should be noted that, since the RNA molecular beacon in this embodiment is mainly for exosome RNA in urine, the sample to be tested is also the urine of the subject. In this way, prostate cancer can be detected only through urine, which can achieve non-invasive detection, with less burden on the subject, and is conducive to early detection of prostate cancer; at the same time, multiple exosome RNAs in urine can be detected and uniformly determined, and the results are more accurate.

[0074] Specifically, the aforementioned “determining whether the subject has prostate cancer based on the fluorescence imaging results of the kit” specifically includes:

[0075] S31: Imaging the reagent kit using a total internal reflection fluorescence microscope to generate an image to be processed.

[0076] Of course, the total internal reflection fluorescence microscope can also be replaced by other microscopes that can realize fluorescence imaging functions.

[0077] S32: Inputting the image to be processed into a preset fluorescence image analysis model, and confirming whether the subject has prostate cancer based on the feedback result of the preset fluorescence image analysis model.

[0078] It should be noted that the preset fluorescence image analysis model can be a computer software model based on various principles, obtained through a large number of sample training. Therefore, the method further includes:

[0079] Preparing a plurality of training samples, wherein the source subjects of the training samples are known to have prostate cancer;

[0080] adding a training sample to the reagent kit, imaging the reagent kit using a total internal reflection fluorescence microscope, and generating a plurality of training images;

[0081] The initial image model is trained using a plurality of training images to generate the aforementioned preset fluorescence image analysis model.

[0082] Here, the initial image model can be a neural network model, which is learned through a large number of samples to generate a preset fluorescence image analysis model. In this way, the more samples there are, the more accurate the result of the preset fluorescence image analysis model is, and it is more objective than the manual judgment result.

[0083] Meanwhile, in the embodiment of the present application, the sampling method of the sample to be tested is as follows: without performing prostate rectal examination or massage, the morning urine (15-40 mL) of all subjects is taken as the sample to be tested, and the pretreatment process of the sample to be tested is:

[0084] 1. Centrifugation to remove cellular components

[0085] 1.1 Centrifuge at 300×g for 10 minutes, remove the cells, and transfer the supernatant to a new centrifuge tube;

[0086] 1.2 Centrifuge at 2000×g for 10 minutes to remove cell debris and transfer the supernatant to a new centrifuge tube;

[0087] 1.3 Centrifuge at 10,000 × g for 30 minutes to further remove large particles and debris, and save the supernatant.

[0088] 2. Ultrafiltration and concentration of urine

[0089] The retained supernatant was directly ultrafiltered using a 100 kDa ultrafiltration membrane to concentrate the volume to 1 / 10 of the original volume.

[0090] 3. Isolation of exosomes by PEG precipitation

[0091] 3.1 Add the concentrated solution to the PEG precipitator (mixed with an equal volume of 8% PEG) and incubate in a refrigerator at 4 degrees for 2 hours;

[0092] 3.2 Transfer the incubated solution to an appropriate centrifuge tube and centrifuge at 10,000×g for 30 minutes. After centrifugation, carefully discard the supernatant and retain the precipitate;

[0093] 3.3 Wash with PBS 1-2 times, and then resuspend with 100-200 μL PBS to form the sample to be tested.

[0094] This embodiment provides a prostate cancer detection method based on exosomal RNA, which uses urine as the detection object to achieve non-invasive detection of prostate cancer, and also has the following advantages: small amount of specimens, only 15mL of urine per case, fast detection speed, only 6 hours from specimen processing to detection, analysis, and report issuance, low detection cost (150 yuan per case per target), and can be manufactured into chips of various specifications such as 96-well and 384-well commonly used in the bio-industry.

[0095] Embodiment 2:

[0096] In another embodiment of the present application, another method for detecting prostate cancer based on exosomal RNA is provided, the method comprising:

[0097] Step S1: preparing nano-sized cationic lipid particles encapsulating RNA molecular beacons.

[0098] It should be noted that there are multiple types of RNA molecular beacons, and each RNA molecular beacon generates fluorescence after binding to the corresponding target exosomes. The target exosomes are also allowed to be one or more of the following exosomes in the blood: miR-141, miR-375, and Let-7c.

[0099] Step S2: coating an exosome capture system and nano-scale cationic lipid particles on a porous chip plate to form a detection kit; the exosome capture system is used to capture exosomes.

[0100] Step S3: pre-treat the sample to be tested, add the pre-treated sample to the test kit, and determine whether the subject has prostate cancer based on the fluorescence imaging results of the kit; wherein the sample to be tested includes at least the subject's blood.

[0101] In this way, the blood of the subjects can also be used for testing to enrich the application scenarios.

[0102] In this embodiment, the pretreatment specifically includes: obtaining a serum sample from the blood; centrifuging the serum sample at 300g for 10 minutes, and continuing to centrifuge the serum sample at 2000g for 10 minutes, and then adding the obtained sample to an extractor for extraction and purification, and then resuspending it with PBS to form a pretreated sample to be tested.

[0103] The extractor can be Chromatographic columns (Echobiotech, China).

[0104] This embodiment provides a prostate cancer detection method based on exosome RNA, using blood as the detection object, and has the following advantages: small amount of specimens, only 90uL of plasma per case, fast detection speed, only 6 hours from specimen processing to detection, analysis, and report issuance, low detection cost (150 yuan per case per target), and can be manufactured into chips of various specifications such as 96-well and 384-well commonly used in the bio-industry.

[0105] Embodiment 3:

[0106] In another embodiment of the present application, another method for detecting prostate cancer based on exosomal RNA is provided, the method comprising:

[0107] Step S1: preparing nano-sized cationic lipid particles encapsulating RNA molecular beacons.

[0108] It should be noted that there are multiple types of RNA molecular beacons, and each RNA molecular beacon generates fluorescence after binding to the corresponding target exosomes. The target exosomes are allowed to be one or more of the following exosomes in urine: miR-141, miR-375, PCA3, T1-E2, and the target exosomes are also allowed to be one or more of the following exosomes in blood: miR-141, miR-375, Let-7c.

[0109] Step S2: coating an exosome capture system and nano-scale cationic lipid particles on a porous chip plate to form a detection kit; the exosome capture system is used to capture exosomes.

[0110] Step S3: pre-treat the sample to be tested, add the pre-treated sample to the test kit, and determine whether the subject has prostate cancer based on the fluorescence imaging results of the kit; wherein the sample to be tested includes at least the subject's blood and urine.

[0111] The pretreatment steps of blood and urine can refer to the above embodiments. The overall process is as follows: Figure 6 shown.

[0112] In this way, combined detection of exosomes in blood and urine can be performed with higher accuracy.

[0113] In another embodiment, the sample to be tested is also allowed to be a cell culture medium; if the sample to be tested is a cell culture medium, the pretreatment is a differential centrifugation treatment, and then the obtained precipitate is resuspended with PBS to form the pretreated sample to be tested.

[0114] If the sample to be tested is a cell culture fluid, the pretreatment is ultracentrifugation, and then the obtained precipitate is resuspended with PBS to form the pretreated sample to be tested. The specific parameters of the ultracentrifugation treatment are as follows: after centrifugation at 2000g×10 minutes, continue to centrifuge at 120,000g×70 (Beckman Coulter type 45Ti rotor) centrifuge.

[0115] Alternatively, cell culture fluid is pretreated in the same manner as described above for urine.

[0116] Overall, the overall idea of ​​the detection method provided in the embodiment of the present application is as follows:

[0117] (1) Efficient and fidelity capture of exosomes: Exosome-specific antibodies (capture antibodies) are coated on multi-well chip plates of various specifications (e.g. 8 / 24 / 96 / 384-well plates) to separate and enrich exosomes. The chip plate substrate is a special glass with ultra-thin (<0.19 mm), geometric mean roughness (RMS roughness) <100 nm, and excellent light transmittance. It is activated and functionalized through multiple steps to achieve efficient and high-density immobilization of streptavidin (SA), and further coated with biotin-linked exosome-specific capture antibodies (anti-CD63 antibodies). The resulting exosome in situ enrichment and purification chip exhibits a multi-level amplification effect and can efficiently capture, purify, and anchor exosomes in clinical liquid samples. In addition, the chip surface has been softened similar to a high-density molecular brush. While efficiently capturing exosomes, it can also completely preserve the overall physiological structure of the exosomes and the molecular target structure on the membrane, making it very suitable for the detection of trace exosome targets.

[0118] (2) Exosome RNA target detection: In addition to being coated with the exosome capture system (SA-biotin-CD63 capture antibody), the bottom glass of the chip board is also pre-coated with nano-scale cationic lipid particles. After the exosomes are purified and enriched, the nano-scale cationic lipid particles fuse with the negatively charged exosomes due to the mutual attraction between positive and negative charges. The molecular beacon (probe) encapsulated in the nano-scale cationic lipid particles hybridizes with the target RNA, the stem-loop structure opens, the fluorescent and quenching groups separate, and emit fluorescence.

[0119] (3) Prostate cancer hematuria target combination: Based on the preliminary analysis of prostate cancer exosome RNA-omics research, two control groups (normal control group Control or benign prostatic hyperplasia patient group BPH) and prostate cancer patient group PCa (biopsy positive, untreated, plasma 42 cases, urine 45 cases) were detected using exosome RNA chips to screen target exosomes as detection markers.

[0120] Blood training cohort: Screening experiments were conducted on 8 exosomes in the blood (PSA mRNA, miR-141, miR-375, PCA3IncRNA, T1-E2, T1-E4, miR21, Let-7c). For specific results, please see Fig. 7A and Figure 7B . Fig. 7A Indicates the expression intensity of 8 exosomes in the blood of the normal control group Control, benign prostatic hyperplasia patient group BPH and prostate cancer patient group PCa, where Mean Fluorescence refers to the average fluorescence intensity. Figure 7B The sensitivity of detection of 8 exosomes in the blood of the normal control group (Control), the benign prostatic hyperplasia (BPH) patient group, and the prostate cancer (PCa) patient group is shown.

[0121] Urine training cohort: Screening experiments were conducted on 7 types of exosomes in urine. For specific results, please see Fig. 8A and Figure 8B .in, Fig. 8A Indicates the expression intensity of 7 exosomes in urine of normal control group Control, benign prostatic hyperplasia group BPH and prostate cancer group PCa, Figure 8B The sensitivity of detection of 7 exosomes in urine of normal control group (Control), benign prostatic hyperplasia (BPH) and prostate cancer (PCa) patients is shown.

[0122] Combination Figures 7A to 8B , a total of 8 candidate exosomal RNAs were screened from plasma and urine. Candidate markers with AUC greater than 0.7 were selected for validation in another 62 cohorts. Results:

[0123] (1) The validation results of three exosomal RNAs (miR-141, miR-375, and Let-7c) screened from plasma are as follows Fig. 9As shown, specifically including: (a) the fluorescence intensity of miR-141, miR-375, and Let-7c detected by the above-mentioned detection kit in the normal control group Control, the benign prostatic hyperplasia patient group BPH, and the prostate cancer patient group PCa; (b) the ROC curves and AUCs of serum PSA (serum PSA), miR-141, miR-375, and let-7c for the normal control group Control and the prostate cancer patient group PCa; (c) the ROC curves and AUCs of serum PSA (serum PSA), each selected serum exosome biomarker miR-141, miR-375, and let-7c for the benign prostatic hyperplasia patient group BPH and the prostate cancer patient group PCa; Fig.10 The ROC curves and AUCs of serum PSA, a combined set of three blood exosomes (combined set of RNA Biomarkers), and a comprehensive set (PSA+combined set of RNA Biomarkers) in the diagnosis of prostate cancer are shown. In other words, the combination of three blood exosomes and serum PSA can further improve the detection efficiency.

[0124] (2) The validation results of four exosomal RNAs (miR-141, miR-375, PCA3 lncRNA, and T1-E2 mRNA) screened out in urine are as follows Fig.11 As shown, specifically including: (a) the fluorescence intensity of miR-141, miR-375, PCA3 lncRNA and T1-E2 mRNA detected by the above-mentioned detection kit in the normal control group Control, benign prostatic hyperplasia patient group BPH, and prostate cancer patient group PCa, respectively; (b) the ROC curves and AUCs of serum PSA (serum PSA), each selected urine exosome biomarker miR-141, miR-375, PCA3 lncRNA and T1-E2 mRNA in the normal control group Control and prostate cancer patient group PCa; (c) the ROC curves and AUCs of serum PSA (serum PSA), each selected urine exosome biomarker miR-141, miR-375, PCA3 lncRNA and T1-E2 mRNA in the benign prostatic hyperplasia patient group BPH and prostate cancer patient group PCa; Fig.12The ROC curves and AUCs of serum PSA, four urine exosomes combined set (combined set of RNA Biomarkers) and their combined set (PSA+combined set of RNA Biomarkers) in the diagnosis of prostate cancer are shown. In other words, the combination of four urine exosomes and serum PSA can further improve the detection efficiency.

[0125] The above five exosomal RNAs (miR-141, miR-375, Let-7c, PCA3lncRNA, T1-E2) were further encapsulated in a nano-sized cationic lipid particle to prepare a blood and urine test kit to improve the diagnostic efficacy. The above method has been proven to improve the diagnostic effect of plasma PSA on prostate cancer (PSA combined with plasma detection AUC = 0.855; PSA combined with urine detection AUC = 0.769).

[0126] (4) Data acquisition and analysis: The ultra-microscopic and ultra-sensitive characteristics of total internal reflection fluorescence microscopy (TIRFM) technology are used to achieve direct imaging of nanoscale exosome surface substances and the determination of target content. In the early stage, through the classification and labeling of massive images obtained from large-sample experiments, a fluorescence image classification database of more than 1,000,000 (512×512 pixels / image) has been established, and this database is used for intelligent image screening training based on artificial intelligence and deep learning, and then the fluorescence image analysis software is developed. During the test, each sample is added to a single well of the chip plate, and the computer controls 100 random pictures of each well. The image analysis software is used to automatically calculate the mean fluorescence intensity (MFI) and convert it into exosome density per unit area, thereby achieving semi-quantitative detection of the target and judging sample differences.

[0127] (5) Advantages in clinical application: small amount of specimen required (90uL plasma / case, 15mL urine / case), fast detection speed (only 6 hours from specimen processing to detection, analysis, and report issuance), low detection cost (150 yuan / case / target), and can be manufactured into chips of various specifications such as 96-well and 384-well commonly used in the bio-industry.

[0128] In summary, the present application relates to a prostate cancer detection method and system based on an exosome RNA nanochip model, the method comprising: (1) obtaining a scanned image obtained by scanning a detection kit to which a sample to be tested has been added using a total internal reflection fluorescence microscope, the detection kit being coated with nano-scale cationic lipid particles and an exosome capture system, the sample to be tested being plasma and / or urine of a prostate cancer patient, and the molecular beacon in the nanoparticles being complementary to the RNA marker in the blood and urine specimen to be tested and emitting green fluorescence; (2) inputting the scanned image into a pre-trained detection model to obtain RNA marker detection data; wherein the detection model is obtained by training a machine learning model based on scanned images of multiple clinically confirmed prostate cancer samples, and the molecular beacon types and mean fluorescence intensity cutoff values ​​in the nanoparticles targeting plasma or urine are different. Combined detection of plasma and urine markers is used to determine the lesion results and improve the specificity of screening.

[0129] Example 4

[0130] In yet another embodiment of the present application, a prostate cancer detection kit based on exosome RNA is provided, and the prostate cancer detection kit comprises:

[0131] Multi-well chip board;

[0132] An exosome capture system coated on a multi-well chip plate; the exosome capture system is used to capture exosomes;

[0133] Nano-scale cationic lipid particles coated on a porous chip plate; nano-scale cationic lipid particles coated with RNA molecular beacons, there are multiple types of RNA molecular beacons, each RNA molecular beacon generates fluorescence after binding with the corresponding target exosomes, and the target exosomes are allowed to be one or more of the following exosomes in urine: miR-141, miR-375, PCA3, T1-E2.

[0134] In some implementations, the target exosomes are also allowed to be one or more of the following exosomes in the blood: miR-141, miR-375, Let-7c.

[0135] Details not disclosed in the embodiments of the present application may be understood by referring to the description of the aforementioned embodiments.

[0136] The above are only preferred embodiments of the present application and are not intended to limit the protection scope of the present application.

[0137] It should be noted that, in this application, the terms "include", "comprises" or any other variants thereof are intended to cover non-exclusive inclusion, so that a process, method, article or device including a series of elements includes not only those elements, but also other elements not explicitly listed, or also includes elements inherent to such process, method, article or device. In the absence of further restrictions, an element defined by the sentence "includes a ..." does not exclude the existence of other identical elements in the process, method, article or device including the element.

[0138] The serial numbers of the above-mentioned embodiments of the present application are for description only and do not represent the advantages or disadvantages of the embodiments.

[0139] The methods disclosed in several method embodiments provided in this application can be arbitrarily combined without conflict to obtain new method embodiments.

[0140] The features disclosed in several product embodiments provided in this application can be arbitrarily combined without conflict to obtain new product embodiments.

[0141] The features disclosed in several method or device embodiments provided in this application can be arbitrarily combined without conflict to obtain new method embodiments or device embodiments.

[0142] The above is only a specific implementation of the present application, but the protection scope of the present application is not limited thereto. Any person skilled in the art who is familiar with the present technical field can easily think of changes or substitutions within the technical scope disclosed in the present application, which should be included in the protection scope of the present application. Therefore, the protection scope of the present application should be based on the protection scope of the claims.

Claims

1. A prostate cancer detection method based on exosomal RNA, characterized in that: The method comprises: S1: preparing nano-scale cationic lipid particles encapsulating RNA molecular beacons, wherein the RNA molecular beacons are of multiple types, each of which generates fluorescence after binding to a corresponding target exosome, and the target exosome is allowed to be one or more of the following exosomes in urine: miR-141, miR-375, PCA3, T1-E2; S2: coating an exosome capture system and the nanoscale cationic lipid particles on a porous chip plate to form a detection kit; the exosome capture system is used to capture exosomes; S3: pre-treating the sample to be tested, adding the pre-treated sample to the kit, and judging whether the subject suffers from prostate cancer according to the fluorescence imaging result of the kit; wherein the sample to be tested at least includes urine of the subject.

2. The method according to claim 1, characterized in that The target exosomes are also allowed to be one or more of the following exosomes in the blood: miR-141, miR-375, Let-7c; The sample to be tested also includes blood from a subject.

3. The method according to claim 1 or 2, characterized in that: The exosome capture system is streptavidin-biotin-exosome specific antibody; the exosome capture system coated on the multi-well chip plate includes: Activating and functionalizing the chip plate bottom substrate of the multi-well chip plate, and immobilizing streptavidin on the multi-well chip plate; The exosome-specific antibody is linked to the exosome-specific antibody by biotin, and the exosome-specific antibody is coated on the multi-well chip plate; Wherein, the exosome-specific antibody is at least allowed to be a CD63 capture antibody.

4. The method according to claim 3, characterized in that The RNA molecular beacon includes a fluorescent group and a quenching group; the fluorescent group includes at least one or more of the following: Texas Red, fluorescein, rhodamine B, fluorescent dye Cy5, fluorescent dye Cy3, methylene blue, fluorescein-5-isothiocyanate, indolar orange, fluorescein-5-acetate; different types of RNA molecular beacons carry different fluorescent groups to distinguish the captured target exosomes; After the exosome capture system captures the exosomes, the negatively charged nano-scale cationic lipid particles fuse with the positively charged exosomes, and the encapsulated RNA molecular beacons come into contact with the exosomes; If the RNA molecular beacon is hybridized with the captured exosomes, the stem-loop structure in the RNA molecular beacon opens, and the fluorescent group and the quenching group separate to generate fluorescence; If the RNA molecular beacon does not hybridize with the captured exosomes, the positions of the fluorescent group and the quenching group remain unchanged and the fluorescence quenching is maintained.

5. The method according to claim 4, characterized in that The step of judging whether the subject has prostate cancer according to the fluorescence imaging result of the kit specifically comprises: Using a total internal reflection fluorescence microscope to image the kit to generate an image to be processed; The image to be processed is input into a preset fluorescence image analysis model, and whether the subject suffers from prostate cancer is confirmed based on the feedback result of the preset fluorescence image analysis model.

6. The method according to claim 5, characterized in that The method further comprises: Preparing a plurality of training samples, wherein the source subjects of the training samples are known to have prostate cancer; Adding the training sample to the reagent kit, imaging the reagent kit using a total internal reflection fluorescence microscope to generate a plurality of training images; The initial image model is trained using a plurality of the training images to generate the preset fluorescence image analysis model.

7. The method according to claim 2, characterized in that If the sample to be tested is blood, the pretreatment specifically includes: Obtaining a serum sample from the blood; centrifuging the serum sample at 300 g for 10 minutes, and continuing to centrifuge the serum sample at 2000 g for 10 minutes, then adding the obtained sample to an extractor for extraction and purification, and then resuspending it with PBS to form a pre-treated sample to be tested; If the sample to be tested is urine, the pretreatment includes: (1) Centrifuge at 300 g for 10 minutes to remove cell debris and transfer the supernatant to a new centrifuge tube; continue centrifuging at 2000 g for 10 minutes to remove cell debris and transfer the supernatant to a new centrifuge tube; continue centrifuging at 10000 g for 30 minutes to further remove large particles and debris and retain the supernatant; (2) The supernatant was directly ultrafiltered using a 100 kDa ultrafiltration membrane to concentrate the volume to 1 / 10 of the original volume; (3) The concentrated solution was added to a polyethylene glycol PEG precipitator, mixed with an equal volume of 8% PEG, and incubated in a refrigerator at 4 degrees for 2 hours; (4) Transfer the incubated solution to an appropriate centrifuge tube and centrifuge at 10,000 × g for 30 minutes. After centrifugation, carefully discard the supernatant and retain the precipitate; (5) Wash the precipitate 1 to 2 times with phosphate buffered saline (PBS), and then resuspend it with 100 to 200 μL of PBS to form a pre-treated sample to be tested.

8. The method according to claim 7, characterized in that The sample to be tested may also be a cell culture fluid; The pretreatment of the cell culture fluid is the same as the pretreatment of the urine; or, The cell culture fluid is pretreated by ultracentrifugation, and then the obtained precipitate is resuspended with PBS to form the pretreated sample to be tested.

9. A prostate cancer detection kit based on exosomal RNA, characterized in that: The prostate cancer detection kit comprises: Multi-well chip board; An exosome capture system coated on the multi-well chip plate; the exosome capture system is used to capture exosomes; Nanoscale cationic lipid particles coated on the porous chip plate; the nanoscale cationic lipid particles are coated with nanoscale cationic lipid particles with RNA molecular beacons, the RNA molecular beacons are of multiple types, each RNA molecular beacon generates fluorescence after binding with the corresponding target exosomes, and the target exosomes are allowed to be one or more of the following exosomes in urine: miR-141, miR-375, PCA3, T1-E2.

10. The kit according to claim 9, characterized in that The target exosomes may also be one or more of the following exosomes in the blood: miR-141, miR-375, Let-7c.

Images